ID: 1153508341

View in Genome Browser
Species Human (GRCh38)
Location 18:5826828-5826850
Sequence CAGGCCTCCATGGACACTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153508337_1153508341 2 Left 1153508337 18:5826803-5826825 CCAGCATTCCTCTTTGGGAGACA No data
Right 1153508341 18:5826828-5826850 CAGGCCTCCATGGACACTACAGG No data
1153508339_1153508341 -6 Left 1153508339 18:5826811-5826833 CCTCTTTGGGAGACAAGCAGGCC No data
Right 1153508341 18:5826828-5826850 CAGGCCTCCATGGACACTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153508341 Original CRISPR CAGGCCTCCATGGACACTAC AGG Intergenic
No off target data available for this crispr