ID: 1153508450

View in Genome Browser
Species Human (GRCh38)
Location 18:5827916-5827938
Sequence ATTGGCAGCTTAGTTAGGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153508447_1153508450 -7 Left 1153508447 18:5827900-5827922 CCCAGAGGGGTTAGAGATTGGCA No data
Right 1153508450 18:5827916-5827938 ATTGGCAGCTTAGTTAGGAGTGG No data
1153508448_1153508450 -8 Left 1153508448 18:5827901-5827923 CCAGAGGGGTTAGAGATTGGCAG No data
Right 1153508450 18:5827916-5827938 ATTGGCAGCTTAGTTAGGAGTGG No data
1153508446_1153508450 -6 Left 1153508446 18:5827899-5827921 CCCCAGAGGGGTTAGAGATTGGC No data
Right 1153508450 18:5827916-5827938 ATTGGCAGCTTAGTTAGGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153508450 Original CRISPR ATTGGCAGCTTAGTTAGGAG TGG Intergenic