ID: 1153513154

View in Genome Browser
Species Human (GRCh38)
Location 18:5877529-5877551
Sequence AAGATCTTAGTTCCAAAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153513153_1153513154 9 Left 1153513153 18:5877497-5877519 CCGTAGCTGCAATTCTGGGCTAT No data
Right 1153513154 18:5877529-5877551 AAGATCTTAGTTCCAAAGACAGG No data
1153513152_1153513154 10 Left 1153513152 18:5877496-5877518 CCCGTAGCTGCAATTCTGGGCTA No data
Right 1153513154 18:5877529-5877551 AAGATCTTAGTTCCAAAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153513154 Original CRISPR AAGATCTTAGTTCCAAAGAC AGG Intergenic
No off target data available for this crispr