ID: 1153513155

View in Genome Browser
Species Human (GRCh38)
Location 18:5877530-5877552
Sequence AGATCTTAGTTCCAAAGACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153513152_1153513155 11 Left 1153513152 18:5877496-5877518 CCCGTAGCTGCAATTCTGGGCTA No data
Right 1153513155 18:5877530-5877552 AGATCTTAGTTCCAAAGACAGGG No data
1153513153_1153513155 10 Left 1153513153 18:5877497-5877519 CCGTAGCTGCAATTCTGGGCTAT No data
Right 1153513155 18:5877530-5877552 AGATCTTAGTTCCAAAGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153513155 Original CRISPR AGATCTTAGTTCCAAAGACA GGG Intergenic
No off target data available for this crispr