ID: 1153514481

View in Genome Browser
Species Human (GRCh38)
Location 18:5891335-5891357
Sequence CCCGGGGGGCGCCGCGGCGG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 861
Summary {0: 1, 1: 1, 2: 3, 3: 128, 4: 728}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153514464_1153514481 20 Left 1153514464 18:5891292-5891314 CCCGCGACTGCACGTAGCTGAGG 0: 1
1: 0
2: 0
3: 11
4: 69
Right 1153514481 18:5891335-5891357 CCCGGGGGGCGCCGCGGCGGGGG 0: 1
1: 1
2: 3
3: 128
4: 728
1153514466_1153514481 19 Left 1153514466 18:5891293-5891315 CCGCGACTGCACGTAGCTGAGGA 0: 1
1: 0
2: 0
3: 5
4: 67
Right 1153514481 18:5891335-5891357 CCCGGGGGGCGCCGCGGCGGGGG 0: 1
1: 1
2: 3
3: 128
4: 728
1153514462_1153514481 26 Left 1153514462 18:5891286-5891308 CCAGGCCCCGCGACTGCACGTAG 0: 1
1: 0
2: 0
3: 4
4: 60
Right 1153514481 18:5891335-5891357 CCCGGGGGGCGCCGCGGCGGGGG 0: 1
1: 1
2: 3
3: 128
4: 728
1153514463_1153514481 21 Left 1153514463 18:5891291-5891313 CCCCGCGACTGCACGTAGCTGAG 0: 1
1: 0
2: 0
3: 2
4: 39
Right 1153514481 18:5891335-5891357 CCCGGGGGGCGCCGCGGCGGGGG 0: 1
1: 1
2: 3
3: 128
4: 728
1153514470_1153514481 -6 Left 1153514470 18:5891318-5891340 CCGTTGAGCGGTATGGCCCCGGG 0: 1
1: 0
2: 0
3: 0
4: 35
Right 1153514481 18:5891335-5891357 CCCGGGGGGCGCCGCGGCGGGGG 0: 1
1: 1
2: 3
3: 128
4: 728

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153514481 Original CRISPR CCCGGGGGGCGCCGCGGCGG GGG Exonic
900003669 1:29722-29744 CCCGGGGTGCGCCCCGGGGCAGG + Intergenic
900023388 1:200238-200260 CCCGGGGTGCGCCCCGGGGCAGG + Intergenic
900100458 1:960118-960140 CCTGGGGGGCTCCTCGGAGGAGG + Intergenic
900113610 1:1019774-1019796 CCGGGGGGCCGCGGCGGGGGAGG + Intergenic
900227605 1:1540379-1540401 CCGGGGGGGCGCCGGGGCCGGGG - Intronic
900233504 1:1574795-1574817 GCCGGGGGCCGGCGCGGCGTTGG - Exonic
900353400 1:2247994-2248016 ACGGGGGGGCGCGGTGGCGGGGG + Intronic
900382496 1:2391809-2391831 CCCTGGAGGCGGCGCCGCGGAGG + Intronic
900550579 1:3252467-3252489 CCCAGTGGGGGCCGCGGTGGAGG + Intronic
901007900 1:6180466-6180488 ACCGGGGGGCGCCCCGGCAGGGG + Intergenic
901059638 1:6466074-6466096 GCCGCGGGGCTGCGCGGCGGTGG - Exonic
901086147 1:6613549-6613571 CCCATGAGGCTCCGCGGCGGCGG - Intronic
901242602 1:7704161-7704183 CCCGGCGCGCCCTGCGGCGGCGG - Intronic
901279849 1:8025914-8025936 CCCGGGCTGCGCCGCCGGGGAGG + Intronic
901443555 1:9293346-9293368 CCCGGGGCGAGGCGCGGCGGGGG + Intronic
901489284 1:9588655-9588677 CCGGGTGGGCGGGGCGGCGGCGG - Intergenic
901641192 1:10694026-10694048 CCGGGCGGGCGCCGAGGCCGCGG + Intronic
901660786 1:10796523-10796545 ACGTGGGGGGGCCGCGGCGGAGG + Intronic
901791343 1:11654971-11654993 CGCGGGGGGCGCTGGGGAGGGGG + Intronic
902048533 1:13543687-13543709 CCCGGGGGGAGCTGGGGAGGTGG - Intergenic
902067511 1:13700359-13700381 CCCGAGGAGCGCGGCGGCGACGG + Intronic
902169423 1:14598536-14598558 CCCCGGGGGGGCGGAGGCGGCGG - Intergenic
902336855 1:15758959-15758981 CTCCAGGGGCGCCGCGCCGGGGG - Intronic
902823239 1:18956235-18956257 CCTGGCGGGGGCGGCGGCGGCGG - Exonic
903034496 1:20485484-20485506 CCCGCGGGCTGCTGCGGCGGTGG + Exonic
903069098 1:20717822-20717844 CAGGGGCGGGGCCGCGGCGGGGG + Exonic
903132735 1:21290243-21290265 GCCGGGGCGGGGCGCGGCGGCGG - Intronic
903750582 1:25618051-25618073 GCCCGGGGCCGGCGCGGCGGGGG - Exonic
903883718 1:26529629-26529651 CCCTCGGGGCGCGGCGGGGGCGG + Intergenic
903883796 1:26529862-26529884 CCCGGGAGGCGGCGCAGCCGGGG + Intronic
903907410 1:26696505-26696527 GGCGGGGGGCGAGGCGGCGGCGG + Exonic
903907710 1:26697493-26697515 CCCGGGAGCAGCGGCGGCGGGGG + Exonic
904500204 1:30908795-30908817 CGCTGGGGGCGGCCCGGCGGCGG - Intergenic
905449289 1:38046650-38046672 CCCGGACGCCGCGGCGGCGGCGG - Exonic
905912043 1:41662026-41662048 ACCGGAGGGAGCCGCGTCGGTGG - Intronic
906317927 1:44800183-44800205 CCCGGGGCGCGGCGAGGAGGCGG + Intergenic
906365377 1:45205873-45205895 CCCCGGGGGCGTCGCGGCTGGGG - Exonic
906960922 1:50419100-50419122 CCCGGCGGCGGCGGCGGCGGCGG + Exonic
907010629 1:50959890-50959912 CCCGGCGGCGGCGGCGGCGGTGG - Exonic
907341547 1:53739191-53739213 CCCGCAGGACGCGGCGGCGGCGG - Intergenic
907767355 1:57424142-57424164 CGCGGGGGGCGGCGGGGCGGGGG - Intronic
908473923 1:64470529-64470551 ATCGCGGGGCTCCGCGGCGGTGG - Intergenic
908561292 1:65309456-65309478 GCCGGGCGGCTCCGCGGCGTTGG + Intronic
909075645 1:71047736-71047758 CCCTGGCGCCGCCGCGGCCGCGG - Exonic
910981245 1:92961550-92961572 CGCGGCGCGCGCCGCGGCGGGGG - Intergenic
911002444 1:93180356-93180378 CCAGGTGGCGGCCGCGGCGGCGG + Exonic
911208735 1:95117905-95117927 CCCGGGCGGCGCGGGGGCCGCGG - Exonic
911527541 1:99004752-99004774 CACCGGGGGCGCGGCGGCGGAGG + Exonic
914286158 1:146228802-146228824 CCAGGCGGCCGCGGCGGCGGCGG - Exonic
914428600 1:147600195-147600217 CCCGGCGGCGGCAGCGGCGGCGG - Intronic
914845690 1:151282491-151282513 CCCAGGGGGCGGCGCGGAGAAGG - Intronic
915354996 1:155250596-155250618 CGTGGGGGGCGCCGTGGCAGGGG + Exonic
915967840 1:160327459-160327481 CCCGGGGGGCGGGGCTGGGGGGG + Intronic
916548455 1:165828089-165828111 GCCTGGGGGCGCTGCGGCGGGGG + Intronic
916651767 1:166839896-166839918 GCCCGGGGGCGCGGCGGCGGTGG + Intronic
917329678 1:173868482-173868504 CCAGGAGCGCGCTGCGGCGGAGG - Intronic
918215938 1:182391927-182391949 CCCGGCGGGCGCCGCTGGGGTGG + Exonic
918388886 1:184037534-184037556 CCTGGGCGGTGCAGCGGCGGCGG - Exonic
919712283 1:200739614-200739636 CCCGGGAGCGGCGGCGGCGGCGG + Exonic
920886867 1:209938116-209938138 CGCGAGGGGCGCCGCGGGCGGGG - Intergenic
921023737 1:211259313-211259335 CGCGGGGCGGGCGGCGGCGGAGG + Intronic
921390568 1:214609184-214609206 TTCGGGGGGAGCTGCGGCGGTGG - Intronic
922234541 1:223712941-223712963 CCCGCGGCGCGCTGGGGCGGGGG + Intronic
922502885 1:226110048-226110070 TCCGGGGAGCGCGGGGGCGGGGG + Intergenic
922958588 1:229625910-229625932 CCCGGAGGCGGCGGCGGCGGGGG - Exonic
923141497 1:231163818-231163840 CCCGGGAGGCGCGGGGGCGGGGG + Exonic
923783010 1:237042463-237042485 CCCGCGGAGCTCGGCGGCGGCGG - Exonic
924172417 1:241356679-241356701 TCCGGCGGCCGCCGCGGCGCGGG - Intronic
924560831 1:245155588-245155610 CCCCGGGGGCGCCTCTGCAGCGG - Intronic
1062874032 10:931320-931342 CCCGGAGGACGCGGCCGCGGCGG - Intronic
1063200891 10:3784868-3784890 CCCTGCGGGCGCCGGGGCGCGGG - Intronic
1064151908 10:12872344-12872366 CCCGGGTGGAGCCGCAGGGGAGG + Intergenic
1064209077 10:13348111-13348133 CCCGGCGGCGGCGGCGGCGGCGG + Exonic
1064354286 10:14603992-14604014 TGCGGGGGGCGCCGCGGAGGCGG - Intronic
1064384511 10:14878715-14878737 CGCGCTGGCCGCCGCGGCGGGGG + Intergenic
1064981871 10:21173844-21173866 CCCGGGGGCGGCGGCGGCGGCGG + Intronic
1065022239 10:21510035-21510057 CTCGGGAGGTGCCGCGGCGCTGG + Intergenic
1065526079 10:26622524-26622546 CCCGGGAGGCGGCGGGGCAGGGG - Intergenic
1065533558 10:26697483-26697505 CCCGGGAGGCGACGGGGCAGGGG - Intergenic
1065712949 10:28533902-28533924 CCCGCGGGGAGGGGCGGCGGGGG + Intronic
1066080713 10:31928544-31928566 TGCGGGAGGCGCGGCGGCGGCGG - Intronic
1066460341 10:35607837-35607859 CCCGGGGGTCGGGGCAGCGGCGG - Exonic
1066464214 10:35639478-35639500 CCGGGGGGCGGCGGCGGCGGGGG - Exonic
1067071895 10:43138515-43138537 CCCGGGTGTCCCCGCGGCGCAGG + Exonic
1067474469 10:46556753-46556775 CCCGGGCCGCGGCGGGGCGGTGG - Intergenic
1067694201 10:48523733-48523755 CCCGGGGCTGGCCGCGGCGCCGG - Intronic
1067980032 10:51074295-51074317 CGCGGTGGGCGCCGCGGCGCGGG - Exonic
1069819272 10:71217544-71217566 CCGCGGGGGCGCAGCGGCTGAGG - Intronic
1070257944 10:74826752-74826774 CCCGGCAGGCGCGGTGGCGGTGG + Exonic
1070877308 10:79826115-79826137 CCCGGCGGGCAAGGCGGCGGCGG + Intergenic
1071573767 10:86711643-86711665 CCCGGGGGGAGCTGCGGCTGCGG - Intronic
1071618178 10:87094980-87095002 GCCCGGGGAGGCCGCGGCGGAGG - Intronic
1071643805 10:87342159-87342181 CCCGGCGGGCAAGGCGGCGGCGG + Intergenic
1072059742 10:91798478-91798500 CCCCGGCTGCCCCGCGGCGGCGG - Exonic
1072710791 10:97714469-97714491 CCCGCGCGGGGCGGCGGCGGGGG - Exonic
1073059428 10:100724538-100724560 CCCGGCGGGCTCCGCGGCGGCGG + Intergenic
1073099598 10:100999781-100999803 GGCCGGGGGCGCCGCGGAGGCGG + Exonic
1073266418 10:102230802-102230824 GCCCGGGGCAGCCGCGGCGGAGG + Exonic
1073290111 10:102409239-102409261 CACGGAGTGCGCGGCGGCGGCGG + Intronic
1075031970 10:119029834-119029856 GCGGGGGGGCGCGGCCGCGGCGG - Exonic
1075992203 10:126847760-126847782 CCTGGGGGGCGCGGCAGGGGTGG + Intergenic
1075999893 10:126905860-126905882 CCCGGGGGGCTCCACGGCAGAGG - Intronic
1076374191 10:129972707-129972729 CGCGGGCGGGGCTGCGGCGGAGG - Intergenic
1076638914 10:131901019-131901041 CCCGGCGGCGGCGGCGGCGGCGG + Exonic
1076639008 10:131901337-131901359 CCCGGGGCGGGGCGCGGCGCGGG - Intronic
1076722086 10:132397162-132397184 CCCGGCGGCGGCGGCGGCGGCGG + Exonic
1076722212 10:132397574-132397596 GCCGGGGCGGGCCGGGGCGGGGG + Intronic
1076864492 10:133160280-133160302 CCCGGGGGGCGCGGGGGGCGCGG - Intergenic
1077008391 11:369592-369614 CCCGGGGTGGGCGGCGGGGGCGG - Intergenic
1077049646 11:560957-560979 GCCCGGGTGCGCCGCGGCGCTGG + Intronic
1077121514 11:910961-910983 CCGGGGCGGGGCCGCGCCGGGGG + Intronic
1077192591 11:1261685-1261707 GCCGGGGGGCTCCGCAGAGGAGG - Exonic
1077253741 11:1571773-1571795 CCCGGTGGGCGCCCGGGAGGAGG - Intronic
1077253754 11:1571812-1571834 GGCGGAGGGCGCCGCGTCGGGGG - Intronic
1077297340 11:1832352-1832374 CCAGGGGGGAGCCGGGGAGGAGG + Intronic
1077544945 11:3165178-3165200 CCCGGGGGGCGGCAGGGCGGCGG - Intronic
1078474644 11:11620590-11620612 CCCGGGCGGCTCCGCGGGGAAGG + Intronic
1081528502 11:43942825-43942847 CCCGGGGGGCCCCGGCGCAGCGG + Exonic
1081699975 11:45146807-45146829 CCCGGCGGGCGGCTCGGCGGAGG - Intronic
1081700018 11:45146950-45146972 CGCGGGGGCCGCCGGTGCGGGGG + Intronic
1083171091 11:60924493-60924515 CGCGGGGCGGGCGGCGGCGGCGG + Exonic
1083258120 11:61508891-61508913 CCCGGGGGCCGGCGCGGCTCCGG + Exonic
1083258291 11:61509737-61509759 CGCGCTGGGCGCCGGGGCGGAGG - Exonic
1083599741 11:63939312-63939334 CGCTGGGGGCGCCGAGGGGGTGG - Intronic
1083659754 11:64246634-64246656 CGCGGGGGGCGCGGCGTTGGCGG - Exonic
1083747768 11:64745004-64745026 CCCGGGCGGCGCGGCAGGGGAGG - Intronic
1083904828 11:65662770-65662792 CGCCGGGGCCGCCGCGGCTGTGG - Intronic
1084146266 11:67266845-67266867 CCCCGCGGGCGCCCCGGCCGCGG + Intronic
1084171277 11:67401979-67402001 CCCGGGGGGCGGGGCCTCGGCGG + Intronic
1084295912 11:68213390-68213412 CGCGGGGGGCGCGACGGCGGCGG - Exonic
1084295984 11:68213615-68213637 CGGGGGCGGCGACGCGGCGGCGG - Intronic
1085044003 11:73343091-73343113 CCGGGGTGGCGGCGGGGCGGGGG - Intronic
1085197963 11:74683642-74683664 CGCGGTGGGGGCCGCGGTGGGGG - Intergenic
1085266731 11:75241832-75241854 CCCGCGGGGCGGCGCAGCGCAGG - Exonic
1085457101 11:76671212-76671234 CCCTGGGGCGGCCGCGGAGGGGG + Intergenic
1085561097 11:77473669-77473691 CACGGGCAGCGCGGCGGCGGCGG - Exonic
1086064750 11:82733183-82733205 CCCCGGGGGTGCCGAGCCGGCGG - Exonic
1087118005 11:94544554-94544576 CGCGGGTGGCGCCGAGGCCGGGG + Exonic
1087138110 11:94740504-94740526 CCGAGGGCGCGCGGCGGCGGCGG - Intronic
1087672750 11:101127541-101127563 CGCGGGGGCCGCCCCGGCGGCGG + Exonic
1088172936 11:107018202-107018224 CTCGGGGGGCTCCGCGGCCCCGG - Exonic
1089432652 11:118436558-118436580 ACCGGGGGCGGCGGCGGCGGGGG + Exonic
1089499888 11:118925728-118925750 CCCGGGCGGCGCGGCGCCGGGGG + Intronic
1091377087 12:31776-31798 CCCGGGGTGCGCCCCGGGGCAGG + Intergenic
1091450320 12:568877-568899 CCCGGGGGGCGGGGGGGGGGGGG - Intronic
1092219122 12:6700756-6700778 CCTGGGGCGCGGGGCGGCGGCGG + Intronic
1092256236 12:6928064-6928086 GCCGGGCGGCGCGGCGGGGGCGG + Intronic
1093715434 12:22376760-22376782 CCAAGGGGGCGCCGAGGCCGAGG - Intronic
1093894676 12:24562724-24562746 CCCGGGGGGTGCGGCGGGGGCGG + Intergenic
1094041110 12:26122617-26122639 CCCGGGGGGCGGCGCGGCGGCGG - Exonic
1095432022 12:42144671-42144693 CGGGGCGGGCGCGGCGGCGGCGG - Exonic
1096073566 12:48788936-48788958 CCGCGGGGGCGGCGGGGCGGGGG - Intronic
1096101236 12:48971609-48971631 CCCGGCGGCCGCGGCGGCGCTGG - Exonic
1096622658 12:52874243-52874265 CCCGCGGGGCGCGGCGGGGCGGG + Intergenic
1096668140 12:53180738-53180760 CCCGGTGGGGGCAGCCGCGGCGG + Exonic
1096695321 12:53344993-53345015 CCCGGGGGAGGGGGCGGCGGCGG + Intronic
1097267757 12:57755616-57755638 CCCCGGGGGGGCCGGGGAGGCGG + Exonic
1097293732 12:57941725-57941747 CCGGCGGGGCCCCGCGGCAGGGG + Exonic
1097664805 12:62466742-62466764 GCCGGGGTTGGCCGCGGCGGTGG + Intergenic
1097981716 12:65742448-65742470 CCGGGGGCGCTCCCCGGCGGGGG + Intergenic
1097989927 12:65824205-65824227 CCCGGGCGCCGCCGCCGCCGAGG + Exonic
1098022335 12:66169569-66169591 CCCAGCGGGCGCCGCGGTGTAGG - Intronic
1099956203 12:89354012-89354034 CCGGGTGGGGGCCGCGGCGGCGG + Intergenic
1100260667 12:92929352-92929374 GCCGGGGGGCGGGGCGGTGGCGG + Intergenic
1100611499 12:96194804-96194826 GGCGGGGGGCGCCGCGGGGTGGG + Intronic
1101606007 12:106248042-106248064 CGGGGTCGGCGCCGCGGCGGCGG - Intronic
1103649642 12:122422639-122422661 CCCGCCCGGCCCCGCGGCGGCGG - Intergenic
1103708856 12:122896085-122896107 CCTGGTGGCCGCAGCGGCGGTGG - Exonic
1103764092 12:123269671-123269693 CCTGGGGGGCTCTGGGGCGGGGG + Intronic
1103800441 12:123534011-123534033 CCCGGGGCGCCCCCGGGCGGCGG - Intergenic
1103954252 12:124567589-124567611 CCCGGCGGCCGCGGCGGCGGTGG + Intronic
1104078727 12:125412006-125412028 CACGGGGGGTGCCGTGGCAGGGG - Intronic
1104929322 12:132329696-132329718 CCGGGGGGGCGCGGTGGGGGGGG - Intergenic
1105019964 12:132809431-132809453 ACCGGGGGGCGGGGGGGCGGGGG - Intronic
1106269486 13:28139102-28139124 GGCGGGGCGGGCCGCGGCGGCGG + Intronic
1106735832 13:32586909-32586931 CCCGGCCGGGGCGGCGGCGGCGG + Intronic
1107603952 13:42040582-42040604 CCCGTGGGAGGCTGCGGCGGTGG + Intronic
1107605061 13:42048720-42048742 CCCGGCGGGGGCGGCGGCGTTGG - Intronic
1108313889 13:49220110-49220132 GCCGGGGCGGGCCGCGGCCGTGG + Intergenic
1108727792 13:53201120-53201142 CCCGAGGGCAGCGGCGGCGGCGG - Intergenic
1110318511 13:74135308-74135330 CCCGCGGGGCCCGGGGGCGGCGG + Intergenic
1110705932 13:78602166-78602188 CCCGGGGGAGGCGGCGGTGGCGG - Exonic
1111396303 13:87672632-87672654 GCCTGGGGCCGCCGCCGCGGTGG - Exonic
1111951678 13:94713141-94713163 CGAGAGGGGCGCCGCGGCGCAGG - Intergenic
1113378817 13:109785571-109785593 CGCGGCGGGCGCGGCGGCGGGGG + Exonic
1113655914 13:112067734-112067756 GCCGGGGCGGGCGGCGGCGGGGG + Exonic
1113656160 13:112068711-112068733 CGAGGGGGGCGACCCGGCGGCGG + Exonic
1113841704 13:113364483-113364505 CCCGCGGGACGCCGCGGCCTCGG - Intergenic
1115028400 14:28767499-28767521 GCCGGGGGCGGCGGCGGCGGCGG - Exonic
1115664803 14:35534666-35534688 CCCCGGGGGCGCCGCCGCCGTGG + Exonic
1115851782 14:37595133-37595155 CGCGGCGTGCGCGGCGGCGGCGG + Intronic
1116018247 14:39432076-39432098 CCCGGGTGGCGCGGTGGCGGCGG - Exonic
1117119621 14:52553214-52553236 CCCGGCGGGGGCAGCGGAGGCGG + Exonic
1117252927 14:53953661-53953683 CCCTGGGAGCGCGGCGGCCGCGG - Intronic
1117478346 14:56118874-56118896 CCCGGACGGCGGCGCGGGGGCGG + Intronic
1118289203 14:64504519-64504541 CGCGGGGGCCGTCGCGGCGGCGG - Intronic
1118339098 14:64879825-64879847 CCCGGGGGTGGCGGCGGCGGCGG + Exonic
1118575996 14:67241585-67241607 CCCTGGGAGCGCGGCGGGGGAGG + Intronic
1118607702 14:67515406-67515428 CCCGGCGGCGGCGGCGGCGGCGG + Intronic
1118610163 14:67533432-67533454 CTGGGGCTGCGCCGCGGCGGAGG + Intronic
1118887489 14:69879238-69879260 CCCGCGGAGCTCCTCGGCGGGGG + Intronic
1118971545 14:70642058-70642080 CCGGGAAGGCGCGGCGGCGGCGG + Exonic
1118971588 14:70642205-70642227 CCCGGGACGCACAGCGGCGGCGG - Exonic
1119003890 14:70907488-70907510 GCCGGCGGGGGTCGCGGCGGCGG + Exonic
1119622125 14:76138967-76138989 CGCGGGGGGCGGCGCGGCGCCGG + Intergenic
1121050443 14:90816340-90816362 GCGAGGGGGCGCCGCGGCGGCGG - Exonic
1122066034 14:99175080-99175102 CGCGGGGGGCGGCGCGGCCAAGG - Exonic
1122131011 14:99604471-99604493 CGCGGGGGAAGCTGCGGCGGTGG + Intergenic
1122183499 14:99971992-99972014 CCCGGCGGCGGCGGCGGCGGCGG - Intronic
1122220980 14:100239076-100239098 AGGGGCGGGCGCCGCGGCGGCGG - Exonic
1122221235 14:100240060-100240082 CGGCGGGGGCGCGGCGGCGGCGG + Intronic
1122602938 14:102930296-102930318 CCCGCGCGGCGCAGCAGCGGCGG - Exonic
1122688929 14:103522575-103522597 GCCGGGGGGCCCGGCGGCGGGGG - Intronic
1123036716 14:105474689-105474711 GCCTGGGGGCGCCGCGGGGGCGG - Intronic
1123630801 15:22258321-22258343 CCCGGGGCGCGGCGCGGCGCGGG + Intergenic
1124340472 15:28886555-28886577 CGCGGGGGGCACCGCGGCAAGGG + Intronic
1124427041 15:29570932-29570954 GGCGGGCGGCGCGGCGGCGGCGG - Intergenic
1124427042 15:29570935-29570957 GCGGGCGGGCGGCGCGGCGGCGG - Intergenic
1124500347 15:30223034-30223056 TTGGGGGGGCGCGGCGGCGGCGG - Intergenic
1124629398 15:31328042-31328064 CTCGGGTGGGGCCGCGGGGGCGG + Intronic
1124743226 15:32315632-32315654 TTGGGGGGGCGCGGCGGCGGCGG + Intergenic
1125301024 15:38253073-38253095 CCGGGGGGGCGCGGGGGCAGCGG - Exonic
1125429317 15:39580351-39580373 CCGAGGGAGCGCCGCGGCAGCGG + Intergenic
1126113287 15:45187758-45187780 CGCGGGGGGGGCGGCGGCGGAGG - Intronic
1126767001 15:52019434-52019456 CGCGGCGGGCCCGGCGGCGGCGG + Intronic
1126767005 15:52019443-52019465 CCCGGCGGCGGCGGCGGCGGCGG + Intronic
1127103204 15:55588101-55588123 CCGGCGGGGCTCAGCGGCGGTGG + Intronic
1127606432 15:60592217-60592239 CTCAGGTGGCGCCGCGGCGGTGG + Intronic
1128099908 15:64989973-64989995 CCCGGCGGTCGCCACGGCGACGG + Intronic
1128115425 15:65102160-65102182 CCGCGGGGGCGACGCGGGGGCGG + Exonic
1128119283 15:65133675-65133697 GCCGGGGAGGGCAGCGGCGGTGG + Exonic
1128651171 15:69414672-69414694 GGCGGGGGGCGACGCGGCAGGGG - Intronic
1128992505 15:72272547-72272569 CCCGGGACGCCCCGCGGGGGCGG + Exonic
1129016719 15:72474865-72474887 CCCGGCGGTGGCGGCGGCGGCGG + Exonic
1129299170 15:74615679-74615701 TCCGGCGGGCGCCGCGGCCTAGG - Exonic
1129612337 15:77070831-77070853 GCCGGGCGAGGCCGCGGCGGAGG - Intronic
1130023645 15:80251957-80251979 CCCCGCAGGCGCCGCGGCAGCGG + Intergenic
1130908600 15:88256346-88256368 CCCGGCGGCGGCGGCGGCGGCGG - Exonic
1131517712 15:93089846-93089868 CCGCGGGGGAGCCGCGGCCGTGG - Intergenic
1131827204 15:96331273-96331295 CCCGGGGCAGGCGGCGGCGGCGG + Exonic
1131838084 15:96409877-96409899 GCTGGTGGGCGGCGCGGCGGGGG - Intergenic
1132365087 15:101251458-101251480 CCCGGCGGGCGGAGCGGCGCGGG - Exonic
1132449833 15:101961218-101961240 CCCGGGGTGCGCCCCGGGGCAGG - Intergenic
1132498840 16:275882-275904 GCCGGGGGGCGGCGCGGGGCCGG + Exonic
1132522216 16:397109-397131 GGCGGGGGGCTCCGGGGCGGCGG + Intronic
1132580085 16:680698-680720 CGCGGGGAGGGCGGCGGCGGTGG + Intronic
1132591393 16:727844-727866 CCCGGGGAGCGCCGGGGAGCGGG - Intronic
1132600468 16:770609-770631 CCCAGGCGGCGCCCCGGTGGAGG - Exonic
1132683418 16:1152927-1152949 CCCGGGGGGGGGCGGGGCGCCGG + Intergenic
1132741272 16:1414514-1414536 GCCGGGGGGCGCGGGGGCGGCGG + Intronic
1132741333 16:1414759-1414781 CGCGGGGGGCGTGGCCGCGGGGG - Intergenic
1132793351 16:1706109-1706131 CCCTGGCGGCGCGGCTGCGGCGG + Intergenic
1132797022 16:1729607-1729629 CGCGGGGCGCGGCGGGGCGGAGG + Intronic
1132805141 16:1771796-1771818 CCGGGGGGGCGCGGGGGGGGCGG - Intergenic
1132884914 16:2178393-2178415 CCCGGTGGGCGCCCCGGCCCGGG + Exonic
1132885097 16:2179027-2179049 GGCGGGGGGCGCGGCGGCGGCGG + Exonic
1133034804 16:3028658-3028680 CCCAGAGGGCGCTGGGGCGGTGG + Intronic
1133241460 16:4416598-4416620 CCCGGGTGGGGCCGAGGCAGCGG - Exonic
1133784383 16:8963443-8963465 CCCGCGGCGGGCGGCGGCGGCGG + Exonic
1134163837 16:11915182-11915204 CGCGGGGCGGCCCGCGGCGGTGG - Intronic
1136141645 16:28292546-28292568 CCGGGCGGGCGCCGGGGCCGGGG + Exonic
1136141855 16:28293267-28293289 CCGCGGGGACGCCGCGGCAGGGG - Exonic
1136220159 16:28823387-28823409 CCCGGGAGGAGCCGCAGAGGTGG - Exonic
1136261766 16:29082215-29082237 TCCGCGGGGCGCGGCGGCTGCGG - Intergenic
1136365220 16:29806494-29806516 GCCGCGGAGCGCCGCGGCGACGG - Intronic
1136458471 16:30395536-30395558 TCCGGAGGGCGCCGGGGTGGCGG + Exonic
1137708062 16:50548785-50548807 CGCGGGGGACACCGCGGCCGCGG + Intronic
1139546756 16:67653234-67653256 ACCTGGGGGCCCCCCGGCGGCGG - Exonic
1139575970 16:67842349-67842371 CCAGGCGGGCGGCGCGGCGCGGG + Exonic
1139631842 16:68236011-68236033 CCCGGGGGAGGGGGCGGCGGCGG + Exonic
1139664511 16:68447087-68447109 GGCGGGGGGCGCGGCCGCGGAGG - Intronic
1139890662 16:70251558-70251580 CCGGGGGAGCGCGGCGCCGGCGG + Exonic
1140033851 16:71358609-71358631 ACCGGGGCGCGGCGCGGCGGGGG - Intergenic
1141054559 16:80803839-80803861 GCCGGGCGGAGCCGGGGCGGGGG - Intronic
1141538556 16:84700264-84700286 CGCGGCGGGCGCGGAGGCGGCGG - Intronic
1141608622 16:85169353-85169375 CCGGGGGGGCGCCGCTGCGAGGG + Intergenic
1141665294 16:85462683-85462705 CGGCGGGGGCGCCGCGGCGCGGG + Intergenic
1141840127 16:86568574-86568596 GCCCGGGGCCGCCGCGGCGCAGG + Exonic
1141972241 16:87492246-87492268 CCCGGGTCGCGGCGCGGCGCGGG - Intergenic
1141972313 16:87492385-87492407 CCGGGCGGGCGCCGGGGCGGGGG + Intergenic
1142006132 16:87690363-87690385 CACGGCGGGCTCCGCGGAGGAGG - Exonic
1142262916 16:89050991-89051013 CCCGGGAGGCGCTGCTGTGGCGG - Intergenic
1142271790 16:89093787-89093809 CCGGCGCGGCGCCGTGGCGGCGG - Exonic
1142623754 17:1179987-1180009 CGCGGGGGGCGGGGCGGGGGTGG + Intronic
1142752787 17:1998489-1998511 CCCGGGGGCAGCCGCGGGGAGGG - Intronic
1142812229 17:2400727-2400749 CCGGGGGCGCGCCGGGGCCGAGG + Exonic
1143202535 17:5122603-5122625 CCGGGAGGGCCCCGCAGCGGAGG - Intronic
1143548690 17:7615231-7615253 CCCGGTGGGGCCAGCGGCGGCGG - Intronic
1144107209 17:11997171-11997193 CCCGCGGGGCGCAGAGGCGCAGG + Intronic
1146398653 17:32487287-32487309 CCTGGGGACCGCAGCGGCGGCGG + Intronic
1146492673 17:33293294-33293316 CCGGGCGGGCGGGGCGGCGGCGG + Intronic
1147307402 17:39573631-39573653 CCCGGCGGCGGCGGCGGCGGCGG - Intergenic
1147393068 17:40122077-40122099 CCCGGGGGTCTCCGCGGCTCGGG - Intergenic
1147741763 17:42674199-42674221 CCCGGGGGGCGGTCCGGCTGGGG - Intronic
1147752456 17:42744750-42744772 CCCGGGAGGAGGAGCGGCGGGGG - Intronic
1148440412 17:47709015-47709037 CCCGGCGGGGGCGGCGGCGGTGG - Exonic
1148471530 17:47896517-47896539 CCCGGCGGGCTCCGAGGGGGCGG - Intronic
1148493478 17:48037834-48037856 GCCGCGGGGCGGCGCGGAGGCGG - Intronic
1148603037 17:48908533-48908555 AACGGCGGGCGCCGGGGCGGCGG + Exonic
1148615785 17:48998498-48998520 GCGGGGTGGCGCGGCGGCGGCGG + Intronic
1148664077 17:49361852-49361874 TGCCGGGGGCGCCGCCGCGGCGG + Intronic
1148664079 17:49361855-49361877 CGGGGGCGCCGCCGCGGCGGTGG + Intronic
1148852350 17:50561258-50561280 CCCGCGGGGCGCCGGGGCGCAGG - Intronic
1149849492 17:60026608-60026630 CCGGGAGGGCCCCGCAGCGGAGG + Intergenic
1149860676 17:60119916-60119938 CCGGGAGGGCCCCGCAGCGGAGG - Intergenic
1150250123 17:63700321-63700343 CCCGCGGGGCGCTGCGGAGCCGG - Intronic
1150675743 17:67245028-67245050 CCCCGGGGCCGCCGCGCCCGGGG + Intronic
1150764593 17:67993383-67993405 CTCGCGGGGCGGCGGGGCGGCGG + Intronic
1151370871 17:73645325-73645347 GCCGGGAGGGGCGGCGGCGGCGG + Intergenic
1151472315 17:74326081-74326103 CTCGGGGGCCTCCTCGGCGGAGG + Intergenic
1151703144 17:75753879-75753901 CCCGTGGGGCGCCTCGGCGTCGG - Exonic
1152049188 17:77959098-77959120 CCCGGCGCGGGCGGCGGCGGCGG - Intergenic
1152069728 17:78128611-78128633 CCTGGGAGGCGCCGGGGAGGAGG + Exonic
1152352960 17:79793528-79793550 CACGGAGGGAGGCGCGGCGGCGG - Exonic
1152357708 17:79814824-79814846 CTCGGGGAGCCCGGCGGCGGCGG + Intergenic
1152396302 17:80035759-80035781 CCCGGACGGGGCCGCGGGGGCGG - Intronic
1152426366 17:80220634-80220656 CCCGGGTAGGGACGCGGCGGGGG - Intronic
1152527714 17:80898696-80898718 TGCGGGGGGAGCCGGGGCGGGGG - Intronic
1152541916 17:80981141-80981163 CCGCGGGGGCGCGGGGGCGGGGG - Intergenic
1152552310 17:81035695-81035717 CCCGGGCAGGGCCGGGGCGGCGG + Intronic
1152628603 17:81399646-81399668 CGCGGGCGGCGCAGAGGCGGCGG - Exonic
1152689767 17:81712604-81712626 CCCGGGGATCGCCGCGCCCGGGG + Intronic
1152721883 17:81927476-81927498 CGGTGGGGGCGGCGCGGCGGGGG - Intronic
1152782632 17:82232906-82232928 CCTGGGGGGCGGCGGGGGGGGGG + Intronic
1152870637 17:82751579-82751601 GCCGGGGGGCGGGGCGGGGGCGG - Intergenic
1152903999 17:82960686-82960708 CCTGGGGGGCGCAGCTGCCGTGG - Intronic
1152928915 17:83100254-83100276 CCCGGGGGGCTCCGGTGAGGGGG + Intergenic
1153480769 18:5543929-5543951 GCCCGGGCGCGCCGCGGCGTGGG + Exonic
1153514481 18:5891335-5891357 CCCGGGGGGCGCCGCGGCGGGGG + Exonic
1154954587 18:21242104-21242126 CGCGGGGGTCCCCGCTGCGGAGG + Intergenic
1155007509 18:21741526-21741548 CCCGGCGGCAGCGGCGGCGGCGG + Exonic
1155054550 18:22171978-22172000 GCCGGGAGGCTACGCGGCGGCGG + Exonic
1155257868 18:24014478-24014500 CCCGGGAGGGGCCGGGGCGCGGG + Intronic
1156008475 18:32470561-32470583 CCGGGGGGGCGCGGCGACTGGGG + Intergenic
1156350431 18:36297659-36297681 CGCGGGGGGCGGGGCGGGGGCGG - Intergenic
1156350546 18:36298041-36298063 CCCGGCGCGCACCGCGGCAGGGG - Intronic
1157095101 18:44680206-44680228 CCCCGGGCGCGCGGAGGCGGCGG - Intronic
1157353989 18:46917117-46917139 CGCGGGCGGCGCGGGGGCGGCGG - Intronic
1157849026 18:51030419-51030441 CCCGGGCCGCCCTGCGGCGGGGG - Exonic
1157867331 18:51197634-51197656 CCCGGCGCGCGCGGCGGCGGCGG + Intronic
1158190964 18:54828433-54828455 CTCGGAGTCCGCCGCGGCGGCGG - Exonic
1158435949 18:57435680-57435702 CCCGGGGGCGGCGGGGGCGGCGG - Exonic
1158954143 18:62523557-62523579 CCCGCGGGCGGCGGCGGCGGCGG - Exonic
1158954160 18:62523599-62523621 CCCCGGGGCGGCGGCGGCGGCGG - Exonic
1158954701 18:62526617-62526639 CCCCGGGTGCGCGGCGGCGGCGG - Intronic
1159045746 18:63367245-63367267 GCCGGGGCGGGCCGCGGCGGAGG + Exonic
1159511213 18:69400699-69400721 CTCGGGGCGCCCGGCGGCGGAGG + Intergenic
1160453446 18:78980162-78980184 CGCGGGGCGCGGGGCGGCGGCGG - Intergenic
1160453598 18:78980679-78980701 CCTGGGGGGCGGCGCGGCGGCGG - Intronic
1160635422 19:71329-71351 CCCGGGGTGCGCCCCGGGGCAGG + Intergenic
1160691020 19:460771-460793 CCCGGGGGGCGTCCCGGCGCTGG - Exonic
1160719185 19:590060-590082 CCCGGGGGGGGCGCGGGCGGCGG - Exonic
1160738808 19:676601-676623 GTCGGGGGGCGCGGCGGCGGCGG + Intronic
1160742860 19:695335-695357 CCCGGGGGGCTCCTCACCGGGGG + Exonic
1160775529 19:853418-853440 GGCGGGGGGCGCAGGGGCGGAGG + Intronic
1160827352 19:1086771-1086793 CTCGCGGGGCCCCGTGGCGGGGG - Exonic
1160853547 19:1206052-1206074 GCGGGGCGGCGCGGCGGCGGGGG - Intronic
1160853551 19:1206055-1206077 TCCGCGGGGCGGCGCGGCGGCGG - Intronic
1160873104 19:1285889-1285911 CCCGGCGGGTGCGGCGGCGGCGG + Intergenic
1160887053 19:1354975-1354997 CCCGCGGGGAGCGGCGGCGGCGG + Intronic
1160930663 19:1568186-1568208 CCGGGCGGGCGGGGCGGCGGCGG + Intergenic
1160983834 19:1828396-1828418 GCCGCGGGGCGCCAGGGCGGGGG + Exonic
1160996743 19:1885458-1885480 CGTGGGGGGAGCTGCGGCGGTGG - Intronic
1161022139 19:2015536-2015558 CCCAGGGGCGGCGGCGGCGGCGG + Exonic
1161063598 19:2227153-2227175 TCCGGCGGGGGCCGGGGCGGGGG - Intronic
1161175933 19:2842010-2842032 CCCAGGAGGCACCGCGGCGTCGG - Intronic
1161337561 19:3722558-3722580 GCTGGGGTGCGCCGTGGCGGGGG + Intronic
1161397831 19:4054227-4054249 CCGGGCGGGGGCCGCGGCGGGGG - Exonic
1161471146 19:4457365-4457387 ACCCGGGGGCGCGGCGGGGGAGG - Intronic
1161487639 19:4544262-4544284 CCCGGGGGCCGGGGCGGAGGCGG - Exonic
1161513290 19:4683354-4683376 CCGGGGAGGCGCCTCGGCAGGGG - Intronic
1161692550 19:5745193-5745215 ACTGGGGGAGGCCGCGGCGGCGG - Intronic
1161816339 19:6502096-6502118 CCCGGGGAGCACCGCGGGGTCGG - Intronic
1162044013 19:7987104-7987126 ACCGGGGGGTGCCGGGGGGGGGG + Intronic
1162128250 19:8510890-8510912 CCGCGGGGGCGCCGGGGCGGTGG + Exonic
1162128505 19:8511817-8511839 TCCGGGGGGCGCTCCGGCGCGGG + Exonic
1162235909 19:9309605-9309627 CTGAGGAGGCGCCGCGGCGGCGG + Intronic
1162374426 19:10296355-10296377 CGCCGTGGGCGGCGCGGCGGGGG + Exonic
1162470923 19:10871657-10871679 CCCGGGCGCAGCGGCGGCGGCGG + Exonic
1162751762 19:12833860-12833882 CGCGGGGACCGCGGCGGCGGCGG - Intronic
1162802336 19:13118405-13118427 CCCGGCGGGCTCCGCAGCGGCGG - Exonic
1162911593 19:13850658-13850680 CCGGAGGGGCCCGGCGGCGGGGG + Intergenic
1162954450 19:14090512-14090534 CCCGGGGGGGGAGGCGGAGGAGG - Exonic
1162959624 19:14118096-14118118 CCGGCGGGGCGGGGCGGCGGAGG + Intergenic
1163158148 19:15449961-15449983 CCGGGGGGGCGGGGCGGCGGGGG - Intergenic
1163390280 19:17026652-17026674 CCTGGGGGGCGCCGCGCCTGGGG + Exonic
1163453720 19:17393979-17394001 CCCGGGCGGCGCCGTGGCATTGG + Intergenic
1163606981 19:18280984-18281006 CCCGGCGGCGGCGGCGGCGGCGG + Exonic
1163607102 19:18281494-18281516 CCCCCGGGCCGGCGCGGCGGGGG - Exonic
1163807085 19:19405932-19405954 CCCGCGGGGCCGGGCGGCGGAGG - Intronic
1164492445 19:28727497-28727519 CTCGGGGGGCGCCCGGGCCGGGG - Intergenic
1164594976 19:29526557-29526579 CGCGGGGGGCGCGGTGGCGGCGG - Exonic
1165070194 19:33251223-33251245 CCCGGGGGGCAGGGCTGCGGTGG + Intergenic
1165157742 19:33798062-33798084 GCCGGCTGGCTCCGCGGCGGAGG + Intronic
1165446835 19:35861214-35861236 CCTGCGGGGCGGCGCCGCGGAGG + Exonic
1165493944 19:36141117-36141139 GCCGGGGGCGGCGGCGGCGGCGG + Exonic
1166039036 19:40191394-40191416 CCCAGGAGGCACCGCGGCGGCGG + Intergenic
1166073041 19:40397707-40397729 CCTGGGGGGAGGAGCGGCGGCGG + Exonic
1166305707 19:41935877-41935899 CCCGGCGGGCTGCCCGGCGGAGG + Intergenic
1166358676 19:42242525-42242547 CCCGGGGGAGGCGGCGGCAGCGG - Exonic
1166361251 19:42253867-42253889 CCCGGCGGCGGCGGCGGCGGCGG - Intronic
1166367247 19:42284016-42284038 GGCGGGGGGAGGCGCGGCGGGGG + Intronic
1167269368 19:48498876-48498898 CTCGGGGGGGGCCGAGGCGGGGG + Exonic
1167311294 19:48739345-48739367 CCCCGGAGGCGCCGTGGCGCGGG + Exonic
1167643781 19:50695247-50695269 GCCGGGGGGCGCGGGGGCGCGGG + Intronic
1167738684 19:51311714-51311736 CCCGGGGGGCGGCGGGGGCGGGG - Intergenic
1168401538 19:56088345-56088367 GCCGGGGCGCGCCGCGACCGGGG + Exonic
1168719107 19:58545063-58545085 CTCGGGGGACGGCGGGGCGGCGG + Exonic
926095772 2:10080067-10080089 CCCGGGGGCAGCCGCGGAGGAGG - Exonic
926217060 2:10912244-10912266 GCGGGGGCGCGCCGCGGGGGAGG - Exonic
927215829 2:20667357-20667379 CCAGGGGGCGGCGGCGGCGGCGG + Exonic
927472269 2:23385399-23385421 CCCCGCGGCCGCCGCGGCTGCGG + Exonic
927567173 2:24123445-24123467 CGCGGGCGGTGCCGGGGCGGCGG - Exonic
927900629 2:26815774-26815796 GGTGGGGGGCGCCGGGGCGGGGG + Intergenic
928606108 2:32946758-32946780 CCCGTGGGTCGCCGAGGCGGAGG - Intergenic
929787236 2:45001580-45001602 CCCGATGAGCGCCGAGGCGGCGG - Intergenic
930011422 2:46941035-46941057 CGCGGCGGGGGCGGCGGCGGGGG + Intronic
930358224 2:50346885-50346907 CCCGGGGGCGGCGGCGGCGGCGG - Intronic
930641695 2:53859931-53859953 CCCGGGATGCGCGGAGGCGGTGG - Exonic
930700786 2:54456569-54456591 CCGGGTGGGCTCCGCGGCGGCGG + Intronic
931253787 2:60553885-60553907 CGCAGCGAGCGCCGCGGCGGTGG + Intergenic
931348867 2:61470922-61470944 CCGGAGGGGCGCCGAGGCGCCGG + Intergenic
931355837 2:61537472-61537494 GGCGTGGGGCGCGGCGGCGGCGG - Intronic
931748878 2:65313858-65313880 CCCGGGGCAAGTCGCGGCGGCGG - Exonic
932180745 2:69643819-69643841 CCCTCGGGGCGGCGCGGCGAGGG + Intronic
932316940 2:70790697-70790719 CCCGGGCGGGGGCGGGGCGGGGG + Intergenic
932342999 2:70978577-70978599 CCCCGGGGGCGGGGCGCCGGCGG + Intronic
932567684 2:72919976-72919998 CCCGCGGGCCGCCGCGGCCGAGG + Intronic
933858495 2:86441628-86441650 CCCGGGCGGCCCCACGGGGGAGG - Intronic
934079054 2:88452279-88452301 CCGGGGGGCGGCGGCGGCGGCGG + Exonic
934296834 2:91749089-91749111 CCGGGGCGCCGCCGCGGCGCTGG - Intergenic
934566978 2:95346603-95346625 GCGCGGGGGCGCGGCGGCGGCGG - Intronic
934566987 2:95346619-95346641 CCCCGCGGGCGCCGGGGCGCGGG - Intronic
934567042 2:95346837-95346859 CCCGTGGAGGGCGGCGGCGGCGG - Intronic
934763843 2:96869745-96869767 GGCGCGGGGAGCCGCGGCGGCGG - Intronic
935592437 2:104855284-104855306 GCCGGGGGCCGCGGCGGCGGCGG + Intergenic
935592498 2:104855411-104855433 GGCGGGGGGCGCGGCGGCGGCGG + Intergenic
936122698 2:109760436-109760458 GCCGGGGGCGGCGGCGGCGGCGG + Intergenic
936126698 2:109794579-109794601 CCGGGGGGCGGCGGCGGCGGCGG + Intronic
936126711 2:109794606-109794628 GGCGGGGGGGGCGGCGGCGGCGG + Intronic
936433182 2:112482009-112482031 CCCGGGGGCGGCGGCGGCGCAGG - Intergenic
937042637 2:118834071-118834093 CCCGGGCGGCGCCCTGGCAGCGG - Intergenic
937221285 2:120344496-120344518 GCCGGGGGCGGCCACGGCGGCGG + Intergenic
938018314 2:127885727-127885749 CCCGGCGGGCAAGGCGGCGGCGG + Intronic
938035098 2:128028415-128028437 CCCGCGGGGAGGCGCGGCGCGGG + Intergenic
938073180 2:128318902-128318924 CCGGGGCGGGGCGGCGGCGGCGG - Intergenic
941930011 2:170929574-170929596 CCCAGGGCGCTCCGCGGAGGTGG - Intronic
942047697 2:172109318-172109340 CTTGGGGGGCGGCGGGGCGGGGG + Intergenic
942241117 2:173964683-173964705 CCCGGCGGCGGCGGCGGCGGCGG + Intronic
942451085 2:176108167-176108189 CCCGGGGGCCGCGGGGGAGGGGG + Intronic
942702541 2:178730022-178730044 CCTGGGGTGGGCCGGGGCGGGGG - Intronic
943033794 2:182716167-182716189 CCCAGCGGGCGCTGCGGCGGTGG - Intronic
943624221 2:190180789-190180811 CGCGGCGGGCGCGGCGGCGACGG + Intronic
944104809 2:196068646-196068668 CCTGGGAAGCGTCGCGGCGGCGG + Intronic
944412442 2:199457721-199457743 CCCGGAGGCGGCGGCGGCGGCGG + Exonic
944495852 2:200306838-200306860 CAGGGGAGGCGCCGCGGCGGTGG - Intronic
944547500 2:200812203-200812225 CCGGGTGTGCGCCGCGGCGCTGG + Intronic
945274256 2:207972343-207972365 GCCGGGGGGCGGGGGGGCGGTGG + Intronic
945296392 2:208175209-208175231 CCCGGGGGGGGGGGGGGCGGAGG + Intronic
946321967 2:218959732-218959754 CCCGGGGGACCCGGCGGTGGGGG - Exonic
946431020 2:219627526-219627548 CCCGGCGGCGGCGGCGGCGGCGG + Intronic
946921422 2:224585150-224585172 CCCCTGGGCAGCCGCGGCGGCGG + Exonic
947418568 2:229921952-229921974 CCCCAGCGGCGCGGCGGCGGCGG + Exonic
947549751 2:231037760-231037782 GCCGGGCGGCGCGGCGGCAGAGG + Exonic
947593078 2:231395966-231395988 GCGGGCGGGCGCGGCGGCGGCGG + Intronic
947723254 2:232381698-232381720 CCCCGGGTGCGCGGCGTCGGTGG - Exonic
947727598 2:232409775-232409797 CCCCGGGTGCGCGGCGTCGGTGG - Exonic
947800948 2:232928237-232928259 GCCGGGCGGCGGCGGGGCGGGGG + Intronic
948116032 2:235494628-235494650 CCCGGGGCGCGGGGCGGCGGCGG + Exonic
948140478 2:235669508-235669530 TCCCGGGAGCGCGGCGGCGGCGG - Intronic
948140793 2:235670530-235670552 CCCGGGCCGCGCCCCTGCGGCGG + Intronic
948953755 2:241272236-241272258 CCCAGGTGGCGGCGGGGCGGGGG - Intronic
1168965228 20:1894688-1894710 CCCGGGCGCCGGCGCGGGGGAGG + Intronic
1169065563 20:2692798-2692820 CCCGGGAGCGGCGGCGGCGGCGG + Intergenic
1169164122 20:3407692-3407714 CCCGGCGGGGGCGGGGGCGGGGG + Intergenic
1170204692 20:13785296-13785318 CCCGCGGGGCGGCGGGGCGGCGG + Intronic
1170617809 20:17968492-17968514 CCCGAGAGGCGCCCAGGCGGCGG - Intronic
1170630022 20:18057767-18057789 CCTGGGCCGCGCCGCGGCGGGGG - Exonic
1170756808 20:19212494-19212516 CTGGGGCGGCGGCGCGGCGGGGG - Intergenic
1170890036 20:20368679-20368701 CTCGGAGGGGGCGGCGGCGGCGG + Exonic
1170999357 20:21397153-21397175 CGCGGCGGCCGCGGCGGCGGCGG - Exonic
1171123709 20:22584900-22584922 AGTGCGGGGCGCCGCGGCGGTGG - Intronic
1171521073 20:25774586-25774608 CCCTGCGAGCTCCGCGGCGGTGG + Exonic
1171555853 20:26081893-26081915 CCCTGCGAGCTCCGCGGCGGTGG - Intergenic
1171972507 20:31573124-31573146 CCCAGGTGTGGCCGCGGCGGGGG - Intronic
1172118375 20:32584342-32584364 CCCGGGCAGCGGCGCGGAGGGGG + Intronic
1172155318 20:32820046-32820068 CCCGGGGGGTGCGGCTGGGGGGG + Intronic
1172474492 20:35226778-35226800 CCCGGCGGCGGCGGCGGCGGCGG - Exonic
1173548168 20:43914872-43914894 CATGGCGGGCGCGGCGGCGGCGG - Exonic
1173803737 20:45911103-45911125 CCGGGGCGGGGCCTCGGCGGTGG - Intronic
1174246817 20:49188058-49188080 CCTCGCGGGCGCCGCCGCGGTGG - Intronic
1174317519 20:49713904-49713926 CCGAGCGGGCGCAGCGGCGGGGG + Intergenic
1174607005 20:51768387-51768409 CGCGGGGGGCGCGGCGGCCAAGG - Exonic
1174607030 20:51768450-51768472 CCGGGGCGGCGCGGCGCCGGCGG - Exonic
1174607034 20:51768453-51768475 CCCCCGGGGCGGCGCGGCGCCGG - Exonic
1175338100 20:58209657-58209679 CCCGGTGGGGGCGGGGGCGGGGG - Intergenic
1175429750 20:58892390-58892412 GCTGGGGGGCGCCGTGGTGGCGG + Intronic
1175521232 20:59604053-59604075 GCCGGGGGGCGGGGGGGCGGGGG - Intronic
1175859718 20:62143687-62143709 CGCGGGGGGCGCCGCGTCGTGGG - Intergenic
1176081055 20:63273148-63273170 GGCGGGGGGCGGCACGGCGGAGG - Intronic
1176157007 20:63626984-63627006 CCCGGCGGGGGCGGCGGCGTCGG + Intronic
1176180377 20:63746964-63746986 CCTGGGGGGCTGCGCGGCCGCGG + Exonic
1176221114 20:63969757-63969779 CGCGGTGGGCGCCGGGGCTGCGG + Intronic
1176548601 21:8212241-8212263 CCCGACGGCCGCCGCGGCGGCGG - Intergenic
1176550181 21:8217406-8217428 CCCGGGGGCGGACCCGGCGGGGG - Intergenic
1176556495 21:8256449-8256471 CCCGACGGCCGCCGCGGCGGCGG - Intergenic
1176567532 21:8395276-8395298 CCCGACGGCCGCCGCGGCGGCGG - Intergenic
1176569109 21:8400444-8400466 CCCGGGGGCGGACCCGGCGGGGG - Intergenic
1176575434 21:8439491-8439513 CCCGACGGCCGCCGCGGCGGCGG - Intergenic
1176577023 21:8444676-8444698 CCCGGGGGCGGACCCGGCGGGGG - Intergenic
1176952537 21:15064539-15064561 CTCGCGGGGGGCCGGGGCGGCGG - Intronic
1176952562 21:15064619-15064641 CCGCGGGGGCGTCGGGGCGGCGG - Intronic
1178534969 21:33403596-33403618 ACCTGGCGGGGCCGCGGCGGCGG - Exonic
1178839866 21:36130043-36130065 TGCGGGGAGCCCCGCGGCGGGGG + Intergenic
1179053873 21:37914399-37914421 CCTGGGGGCCGCCGAGGTGGTGG - Intronic
1179561593 21:42219238-42219260 CCCGGGGGCGGCGGCGGCGGCGG - Exonic
1179603359 21:42496083-42496105 CCCAGGGTGCGCAGCGGCGGGGG - Intronic
1179605619 21:42513744-42513766 GCCGGGGGTCGCGGCGGCCGGGG + Intronic
1179730049 21:43362567-43362589 CCCTGGGGGCGAGGCGGCCGTGG + Intergenic
1180187244 21:46145835-46145857 CCCCGGGGGCGGCTCGGTGGCGG - Exonic
1180614759 22:17120203-17120225 CCTGGGGGCGGCCGCGGCAGCGG - Exonic
1180614905 22:17120695-17120717 CGGCGGGGGCGCCGCGGCCGGGG - Exonic
1180733810 22:18001198-18001220 GCCGGGAGCCGCCGCGGCGCGGG - Intronic
1181024044 22:20117631-20117653 CCATGGGGGCGCGGCGGCGGCGG - Exonic
1181051022 22:20238312-20238334 CCCGGGGCGGGCCACTGCGGCGG - Intergenic
1181334679 22:22118350-22118372 CCGTGGGGGAGCTGCGGCGGTGG - Intergenic
1181934619 22:26429609-26429631 CTCGGCGGGGGCGGCGGCGGCGG - Intronic
1182094069 22:27614473-27614495 CACGGCGGGCGCCGTGGCGGTGG + Intergenic
1182355495 22:29720699-29720721 ACCCCGGGGCGCCGCGGTGGGGG + Intronic
1182429058 22:30289544-30289566 CACGGGAGGCGGGGCGGCGGGGG + Exonic
1182576521 22:31276707-31276729 CGCGGGGGGCGCGGCGTTGGCGG + Intronic
1182804470 22:33058426-33058448 CCAATGGGGCGCCGCGGCGCGGG - Intergenic
1182903849 22:33920440-33920462 CCCGGGCTCCGGCGCGGCGGCGG + Intronic
1183452754 22:37905907-37905929 CCCGGTGGGTGGCGCGGCGGCGG + Intronic
1183683770 22:39350209-39350231 CCCCGGCGGCGGCGCGGCGGCGG + Intronic
1184101509 22:42343753-42343775 CGCGGGCGGCGCCGCTGCGGTGG + Intergenic
1184472133 22:44702139-44702161 CCCGGGGGGCGGGGCGGGGAAGG - Intronic
1184759786 22:46537703-46537725 CCCGGGGGGAGCCGGCTCGGAGG + Intergenic
1184915075 22:47563598-47563620 CCCAGGGGGAGCCGGGGAGGAGG + Intergenic
1185037934 22:48489463-48489485 CCCGGGCGCGGCGGCGGCGGCGG + Exonic
1185055402 22:48576254-48576276 GGAGGGGGGCGCCGCGGAGGGGG - Intronic
1185148731 22:49152628-49152650 CCCTGCGGGCACAGCGGCGGGGG - Intergenic
1185255108 22:49827496-49827518 CCTTCGGGGCGCCGCGGCCGCGG + Intronic
1185255125 22:49827539-49827561 CGCGGGGGCCGGCGCGGCCGAGG + Intergenic
1185315875 22:50178875-50178897 CGCTGGGGGCGGCGCAGCGGAGG + Intronic
1185395219 22:50583192-50583214 CCGGCGGGGCGGCGGGGCGGCGG + Intronic
1185409412 22:50674362-50674384 CCCGGGGGCGGGGGCGGCGGGGG - Intergenic
1185409462 22:50674491-50674513 GCCGGGGGGGGCCGGGGCCGGGG - Intergenic
1203238465 22_KI270732v1_random:30912-30934 CCCGGCGGCGGCGGCGGCGGCGG - Intergenic
1203253485 22_KI270733v1_random:128546-128568 CCCGACGGCCGCCGCGGCGTCGG - Intergenic
1203255076 22_KI270733v1_random:133744-133766 CCCGGGGGCGGACCCGGCGGGGG - Intergenic
1203261539 22_KI270733v1_random:173624-173646 CCCGACGGCCGCCGCGGCGGCGG - Intergenic
1203263132 22_KI270733v1_random:178823-178845 CCCGGGGGCGGACCCGGCGGGGG - Intergenic
950316308 3:12004651-12004673 CCGGGGGGCGGCGGCGGCGGCGG - Exonic
950487755 3:13282956-13282978 GCCGGGGGGCTCGGCGGCGCTGG + Intergenic
950487807 3:13283115-13283137 CCCGGGGGCGGCGCCGGCGGAGG - Intergenic
950729901 3:14947971-14947993 ACATGGAGGCGCCGCGGCGGCGG + Intronic
950940370 3:16885054-16885076 CCGGGGGGGCGCCGCCGGCGGGG + Intronic
951881404 3:27484201-27484223 CGCCGGGGGCTCGGCGGCGGCGG - Intronic
951981970 3:28575978-28576000 CCCGGCGGCGGCGGCGGCGGCGG - Intergenic
952889264 3:38029859-38029881 CCCGTGGGTGGCGGCGGCGGAGG - Intergenic
953326111 3:42013719-42013741 CCGGGTGGGCCCCGGGGCGGCGG - Intergenic
953326121 3:42013742-42013764 CTCGGGGCGCGCGGGGGCGGCGG - Intergenic
953705069 3:45225200-45225222 CCCTGCGGGCACTGCGGCGGGGG + Exonic
953705140 3:45225503-45225525 CGCGGTGGGCGCCCCGGCGGTGG + Exonic
953705208 3:45225817-45225839 CCCGGAGGAGGCGGCGGCGGCGG - Exonic
953886660 3:46717947-46717969 CCTGGGGGGCGCCACGCAGGCGG - Exonic
953925339 3:46979796-46979818 ACCGGCGGGCGGCGCGGAGGAGG + Exonic
954176233 3:48847814-48847836 CCCGTCGGTCCCCGCGGCGGCGG - Exonic
954256577 3:49411716-49411738 CCGGTGGGGCGCGGCCGCGGCGG + Intronic
954544365 3:51420157-51420179 CCCTGGGGGGGCCGTGGCTGAGG + Exonic
954632914 3:52056604-52056626 TCCGGGGGGCGGGGCCGCGGGGG + Intergenic
954669063 3:52278448-52278470 CGGGGCGGGCGCCGCGCCGGCGG + Exonic
954669105 3:52278659-52278681 CCCGGCGTGCGCCGCGGCTGAGG - Intronic
954778871 3:53045331-53045353 CCCGGGGGGCGGGTCCGCGGGGG + Intronic
954838896 3:53494524-53494546 GCCGGGGCGCGGCGCGGCGCGGG + Intergenic
954864688 3:53718577-53718599 GCCGGGGGGCGGGGGGGCGGGGG - Intronic
956675046 3:71725335-71725357 GGCGGGGGGCGCGGCGGCCGGGG + Exonic
960110313 3:113838876-113838898 GCGGGGCGGTGCCGCGGCGGCGG + Exonic
961013427 3:123449879-123449901 CCCGCGGGGCGCCGAGGCTGGGG - Intergenic
961446302 3:126983258-126983280 CCCGGGGCGCGCCCCGCCGCCGG - Intergenic
961779938 3:129315480-129315502 CGCGGTGGGGGCCGGGGCGGTGG + Exonic
963236738 3:142963696-142963718 TCCGGGGGCGGCGGCGGCGGAGG - Intergenic
963253283 3:143120782-143120804 CCGGGCCGGCGGCGCGGCGGAGG - Exonic
963503915 3:146161274-146161296 CACCGGGCGCGCAGCGGCGGCGG - Intronic
963827511 3:149970938-149970960 CGCGGGGGGAGGCGGGGCGGGGG + Exonic
963904468 3:150762690-150762712 CGCGGTGCCCGCCGCGGCGGCGG - Exonic
964482799 3:157159635-157159657 GCCGGGGCGTGCCGGGGCGGGGG - Intronic
965757540 3:172040638-172040660 CCCGAGGGGCGCCTCGGCCGGGG + Intronic
966696334 3:182793714-182793736 CCCGCGGGGCGCGGGGGCCGCGG - Exonic
966712033 3:182980728-182980750 GGCGGGGGGCGCGGCGGGGGAGG + Intronic
966808660 3:183825273-183825295 CCCGGTCCGCGCCCCGGCGGCGG + Exonic
966808754 3:183825620-183825642 CGCGGGGCGGGCCGCGGGGGCGG - Intergenic
966808765 3:183825643-183825665 GCCGGGGGGCGGTGCTGCGGCGG - Intergenic
966982729 3:185153034-185153056 CGCGGCGCGCGCCGCGCCGGAGG - Intergenic
967867814 3:194204414-194204436 GCCAGGTAGCGCCGCGGCGGGGG - Intergenic
968372780 4:11126-11148 CCGGCGCGGCGCCGGGGCGGGGG + Intergenic
968372795 4:11175-11197 CCGGCGCGGCGCCGGGGCGGGGG + Intergenic
968467092 4:758235-758257 CCCGGTGAGAGCCGCGGTGGGGG - Intronic
968515009 4:1012108-1012130 CACGTGGGGCGCGGGGGCGGGGG - Intronic
968555344 4:1244090-1244112 CCCGGGGGGCTGCACGGTGGCGG + Intronic
968603335 4:1520614-1520636 CCCCGGGGTCGCCGCCGCGTAGG - Intergenic
968775476 4:2537086-2537108 CCTGGTGGGCGGCGCGGCGGCGG + Intronic
969330600 4:6471902-6471924 CCCGGAGGGCGGCGCGGAGGAGG + Intronic
969436633 4:7192719-7192741 CGCGGCGAGCGCGGCGGCGGCGG - Exonic
970593349 4:17577865-17577887 CCCGGGGAAAGACGCGGCGGTGG + Intronic
971257939 4:25030915-25030937 TGCGGCGGGCGCAGCGGCGGCGG - Intergenic
971272160 4:25160212-25160234 CCCCGGGGTCGCGGCGGCTGGGG + Intronic
971288443 4:25312678-25312700 GGCGGGGGCTGCCGCGGCGGAGG - Intergenic
972321551 4:37977359-37977381 CCCGGCGGCGGCGGCGGCGGCGG - Intronic
972675594 4:41257161-41257183 CCCCGCGAGCGCCGAGGCGGGGG + Intronic
972740334 4:41881662-41881684 CCCTGGGGGAGCCGGGGCGCGGG - Intergenic
973754815 4:54064359-54064381 ACCGGCGGGCGAGGCGGCGGAGG + Exonic
975710590 4:77157285-77157307 CCGGCGTTGCGCCGCGGCGGAGG + Exonic
975985958 4:80202066-80202088 CACGGGGGCGGCGGCGGCGGTGG + Exonic
976431415 4:84966528-84966550 CCCGAGGAGCGCCGAGGCTGAGG - Intergenic
978072625 4:104491557-104491579 CGCGGCGGCCGCGGCGGCGGCGG + Exonic
978795755 4:112706021-112706043 TCCGCGGGGCGCGGCGGCTGCGG + Intergenic
979785575 4:124712431-124712453 CCGGGGGGCGGCGGCGGCGGTGG - Intronic
981688514 4:147481252-147481274 CCCGGGCTCCGGCGCGGCGGCGG - Exonic
982042404 4:151409126-151409148 CGCGGGGGGGGCGGGGGCGGGGG - Intergenic
984206488 4:176792837-176792859 GCCCGGGAGCGCCGCGGCGCAGG + Intergenic
985003320 4:185506625-185506647 CTCGGGGGGCACCGAGGCTGTGG + Exonic
985462614 4:190121440-190121462 CCGGCGCGGCGCCGGGGCGGGGG - Intergenic
985537536 5:473486-473508 CCTGGGGTGCGCCGCGGGAGGGG - Intronic
985896264 5:2751488-2751510 GCCGGGGCGCGGCGCGGCGGCGG + Exonic
985896294 5:2751562-2751584 CCCGCGGGCCGGGGCGGCGGCGG + Exonic
986297119 5:6448809-6448831 CCCGGCGGTGGCGGCGGCGGCGG + Exonic
986330518 5:6713649-6713671 CGCGGGGGCCGCGGCGGCGGCGG - Intergenic
986451441 5:7869342-7869364 TCCGGGGGTCGCCGCGGGCGCGG + Intronic
987050701 5:14144582-14144604 CCGGGGGGGCGGCGCGGGGCTGG + Intronic
987084641 5:14457380-14457402 ACCGGGGGGCGGGGCGGGGGGGG - Intronic
988825300 5:34929660-34929682 CCCGGCGGCGGCGGCGGCGGCGG - Exonic
990955053 5:61332413-61332435 GGCGGGTGGCGCGGCGGCGGCGG + Exonic
991298164 5:65103019-65103041 CCCGGCGGCCGCCGAGGCGAGGG - Intergenic
992105726 5:73448043-73448065 GCCGGTGGGGGCGGCGGCGGCGG - Exonic
992105863 5:73448455-73448477 GCCGGGGGGCGCCACGCTGGGGG + Intergenic
992431360 5:76714889-76714911 CCCCAGGGGCGTCGCGGCTGGGG - Intergenic
992550155 5:77852032-77852054 CCCGGCGGTGCCCGCGGCGGCGG - Intronic
992837410 5:80654608-80654630 CCCTGCGTGCGCCGGGGCGGGGG - Exonic
992939652 5:81750491-81750513 CGCGGGGAGCGCGGCGGCGGGGG - Intronic
996379037 5:122845509-122845531 CCCGCGGGGCCCCGAGGCTGCGG - Exonic
996442952 5:123512482-123512504 GCCGGCGGGGGCAGCGGCGGCGG - Intronic
997302082 5:132813638-132813660 CCCGGCAGCCGCAGCGGCGGCGG - Exonic
997584091 5:135034441-135034463 CGCGGGGGGCGGGGAGGCGGCGG - Intronic
997732657 5:136192479-136192501 CACGGGCGGCCCCGAGGCGGCGG - Intergenic
997975378 5:138438968-138438990 CCGGGAGGCCGCCGCGGCGGCGG - Intergenic
998130286 5:139648331-139648353 CCCGGGCGGGCGCGCGGCGGCGG + Exonic
1000345844 5:160312627-160312649 CCCGCGGGGCGCGGGGGCGCCGG - Intronic
1002180040 5:177426646-177426668 CCCGGGGGCCACCCCGGCGCTGG - Intronic
1002209850 5:177592142-177592164 CCCGGCAGGCACCGCGGCGGCGG + Exonic
1002559574 5:180072133-180072155 GCGGGGGGGCGGGGCGGCGGCGG - Intergenic
1002645558 5:180651433-180651455 CCCGGGGGGTGCTGAGGCTGCGG - Intergenic
1002895565 6:1378318-1378340 CCCGGCGGCCGCCGCTGCCGGGG + Intergenic
1003049414 6:2766048-2766070 GCCGGCGGCCGCCGCCGCGGCGG + Exonic
1003948216 6:11094159-11094181 CCCTGGGGGCGCTGCCGAGGGGG + Exonic
1004216791 6:13711273-13711295 GCCGGGGGCGGCGGCGGCGGAGG + Exonic
1004615041 6:17281430-17281452 CGAGGGCGGCGGCGCGGCGGGGG - Exonic
1004690338 6:17987671-17987693 CGCGGGGCGGGGCGCGGCGGCGG + Intergenic
1005076135 6:21909868-21909890 CCCGGGGGGTGGGGCGGCGGAGG - Intergenic
1005832394 6:29681148-29681170 CCGGGGTGGGGCCGCGGCGCCGG - Intergenic
1006137142 6:31902036-31902058 CCCCGCGCGCGCGGCGGCGGCGG + Intronic
1006171547 6:32096153-32096175 CCCGGGGGCTGCCGAGGCCGCGG - Intronic
1006472656 6:34237328-34237350 CCCGGGGCCCGCGGCGGCGGCGG + Intronic
1006599698 6:35217236-35217258 GCGGGGGGGAGGCGCGGCGGGGG + Intronic
1007429942 6:41770903-41770925 CCCTTGGGGAGCCGCGGCGGCGG + Exonic
1007631396 6:43275322-43275344 CCCAGGGGAAGCCTCGGCGGCGG - Intronic
1007784082 6:44270520-44270542 GCCGGGGGGGGCCGGGGCCGGGG - Exonic
1007902062 6:45422091-45422113 CGCGCGGCGCGGCGCGGCGGTGG + Intronic
1007927658 6:45663283-45663305 GCCTGGGGGCGCCGAGGCTGCGG - Intronic
1009437612 6:63636045-63636067 CCCGGTGGGTGCCGCGGAGAGGG - Exonic
1010236682 6:73580490-73580512 CCCGGGCGGCGCAGCGGGTGAGG - Intergenic
1011517134 6:88166595-88166617 CTCCGGGAGCGCGGCGGCGGAGG - Intergenic
1013033666 6:106360551-106360573 CCGGGGGCGCGCGGCGGCCGTGG - Intergenic
1013170686 6:107634542-107634564 CCCTGGCGACTCCGCGGCGGCGG + Exonic
1013230563 6:108158011-108158033 GCGGGGGGGCGGCGCGGCCGCGG - Intronic
1013507478 6:110814893-110814915 CCCGAGGGGCGAGGCGGAGGGGG - Intronic
1014001540 6:116370978-116371000 CCCGGGGCATGGCGCGGCGGGGG + Exonic
1014137622 6:117907476-117907498 GCCGGGGCGGGCGGCGGCGGCGG + Intergenic
1014272315 6:119348989-119349011 GGCGGGGGGCTCGGCGGCGGCGG - Exonic
1015149040 6:130019143-130019165 CTCGGGGGGCGCGGGGGAGGGGG - Intronic
1015935600 6:138404062-138404084 CGCGGGCGGGGCCGCGGCAGAGG + Intronic
1016714114 6:147204128-147204150 CCGGGGGCGAGCCGGGGCGGCGG + Intergenic
1016728898 6:147406943-147406965 CCTGGGGGGCGCTGCGCCGGTGG - Intergenic
1016739156 6:147509411-147509433 CCCGGGGCGCGCGGCGGGAGGGG + Intronic
1016937256 6:149456618-149456640 CCTGGGGGGCGGCGGGGCGGGGG - Intronic
1017110239 6:150925247-150925269 CCCGGGAGACCACGCGGCGGGGG - Intronic
1017672095 6:156778153-156778175 CTGGTGGGGCGGCGCGGCGGGGG - Exonic
1017672246 6:156778741-156778763 GCCGGGGGCCCCGGCGGCGGCGG - Exonic
1017672280 6:156778839-156778861 CCCGGCGCGGGCGGCGGCGGCGG + Exonic
1017793624 6:157823033-157823055 CCCGGGGGCGGCGGCGGCGGCGG + Intronic
1017793637 6:157823069-157823091 CCGGGGCGGCGGCGCGGCGCGGG + Intronic
1018613051 6:165662147-165662169 CCAAGGGGGAGCCGGGGCGGCGG + Intronic
1019111962 6:169724080-169724102 CGCGGGGCGCGCGGCGGCAGGGG - Intronic
1019197376 6:170290387-170290409 CTCGGGGGACAGCGCGGCGGCGG + Exonic
1019298220 7:290102-290124 GCCGGCGGGCGGCGCGGAGGAGG + Intergenic
1019298330 7:290560-290582 GCCGTGGGGCGCAGAGGCGGAGG - Intergenic
1019343607 7:519591-519613 CCGAGGGCGCGCCGCGGAGGGGG - Intronic
1019343661 7:519755-519777 CCCGGCGGCGGCTGCGGCGGAGG - Intronic
1019379094 7:712161-712183 CTCCGGGGGCGGCGTGGCGGGGG - Intronic
1019446346 7:1073668-1073690 CGTGGGGGGCGTCACGGCGGCGG - Intronic
1019720828 7:2569534-2569556 CCAGGAGGGTGCCGCGGAGGTGG + Intronic
1019828225 7:3301269-3301291 CCGGGCGGGGGCGGCGGCGGCGG + Intergenic
1020278308 7:6637515-6637537 CTCGGGGGCGGCGGCGGCGGCGG + Intronic
1020383004 7:7566829-7566851 CCCGGGAGGCGCCTCGGGGCGGG - Intergenic
1020560569 7:9726209-9726231 CCTGGGGGGCGCCGCGCCTGGGG - Intergenic
1021451255 7:20785341-20785363 TCCGGGGGCAGCGGCGGCGGCGG - Exonic
1022207476 7:28179419-28179441 CCCGGGAGACGCCGGGGAGGGGG - Intronic
1022230532 7:28409144-28409166 CCCGGGAGCGGCAGCGGCGGGGG - Intronic
1022300189 7:29095666-29095688 CCCGGTGGGGGCTGAGGCGGAGG - Intronic
1022698047 7:32728795-32728817 CCTGGGGGGCGTGGCGTCGGGGG + Intergenic
1023177557 7:37448513-37448535 CCCTGGGGGCGCCGCGGCTCGGG - Intronic
1023638416 7:42236479-42236501 CGCGGGGGCCGCCGCCGCTGGGG - Intronic
1023875826 7:44285810-44285832 GCGGGGGGGAGGCGCGGCGGAGG + Intronic
1023881936 7:44325665-44325687 CGGGGCGGGCGCGGCGGCGGCGG - Intronic
1023937119 7:44748421-44748443 CTCGGGGCGGGCCCCGGCGGAGG - Intergenic
1023937293 7:44748948-44748970 GCCGGGGGCCGCCACGGCGAGGG + Exonic
1025281549 7:57629534-57629556 CCCTGCGAGCTCCGCGGCGGTGG + Intergenic
1025303181 7:57835981-57836003 CCCTGCGAGCTCCGCGGCGGTGG - Intergenic
1025916885 7:65873228-65873250 CCAATGGGGCGCGGCGGCGGCGG + Intergenic
1026968294 7:74453930-74453952 CCCGGCGCGGGCTGCGGCGGAGG - Intronic
1027177789 7:75915501-75915523 CCCGTGGGGGGCGGCGGCGCGGG - Intronic
1028477287 7:91265666-91265688 CCCGGGGGGCGCCGGCGCGTCGG + Exonic
1029123191 7:98281722-98281744 GGCGGGGGACGCGGCGGCGGCGG - Exonic
1029123193 7:98281725-98281747 CCCGGCGGGGGACGCGGCGGCGG - Exonic
1029123707 7:98283899-98283921 GCTGGGGGGCGCCGAGGTGGTGG + Intronic
1029491923 7:100875346-100875368 CCTGGGGGGCCCCGCTGGGGCGG + Intronic
1029640332 7:101816182-101816204 CGCCGGGGGGCCCGCGGCGGCGG + Intronic
1029715135 7:102321557-102321579 CTCCGGGGGCTCCTCGGCGGCGG - Exonic
1030033309 7:105388474-105388496 CCCGGGGGGAGGGGCGGCGGCGG - Intronic
1030138703 7:106284572-106284594 CTGGGGGCGCGCGGCGGCGGCGG - Intronic
1030739062 7:113086560-113086582 CGCAGGGGCCGCGGCGGCGGCGG + Intronic
1031134835 7:117873340-117873362 CGCGGCGGGGGCCGCGGCGGAGG - Exonic
1032074565 7:128830334-128830356 CCCGGGGGCCGCGGGCGCGGCGG + Intergenic
1032119315 7:129144954-129144976 CCCGGGGGCGGTGGCGGCGGCGG + Exonic
1033099956 7:138461008-138461030 CCCGGGGTGCGCGGCGGGGGAGG + Intronic
1033225445 7:139558912-139558934 CCAGGCTGGCGCGGCGGCGGAGG - Intergenic
1034254017 7:149714754-149714776 CCCAGAAGGCGCCGCGGCGCCGG - Intergenic
1034306286 7:150047676-150047698 CCCCGGGAGCGCGGCGGCGGCGG - Intergenic
1034349211 7:150405505-150405527 GCGGGGGGGCGCTGCGGCCGTGG + Intronic
1034441155 7:151086689-151086711 CCGGGGCGGCGCGGCGGAGGCGG - Intronic
1034466423 7:151232626-151232648 CCCGGGAGGGGGCGGGGCGGAGG - Exonic
1034800561 7:154052977-154052999 CCCCGGGAGCGCGGCGGCGGCGG + Intronic
1034997489 7:155587293-155587315 CCCGCAGGGCGACGCGGCTGCGG - Intergenic
1035020415 7:155797255-155797277 GCCGGGGGGAGCCGGGTCGGGGG - Intergenic
1035167464 7:157000091-157000113 CGCGGGGGGCGGAGCGGGGGAGG + Intronic
1035167541 7:157000461-157000483 CGCGTGGGGCGCGGCGGCGAAGG - Intronic
1035266548 7:157692848-157692870 GCTCGGGGGCGGCGCGGCGGCGG + Intronic
1035486641 7:159231306-159231328 CCCGCGGGGCGGCGGGGAGGTGG + Intergenic
1036390277 8:8318832-8318854 GCAGGGAGGCGCGGCGGCGGCGG + Exonic
1036454065 8:8892933-8892955 CCCGGGGCAGGCCCCGGCGGCGG + Exonic
1036723757 8:11201218-11201240 CCCGGGGGAGGCGGCTGCGGCGG - Exonic
1037273834 8:17156864-17156886 CGCTGGGGGCGCCGCGGCGGGGG - Intronic
1037828925 8:22176971-22176993 TACGTGGGTCGCCGCGGCGGGGG + Exonic
1039608529 8:38901520-38901542 TGCAGGGGGCGCCCCGGCGGAGG + Intronic
1039873564 8:41567195-41567217 CCCGAGGGGCGCCGCGGCCTCGG + Intergenic
1039903081 8:41767010-41767032 CCCTCGGGGCACCCCGGCGGCGG + Intronic
1040038832 8:42896739-42896761 CCCGGCGGCAGCGGCGGCGGCGG + Intronic
1041690003 8:60679109-60679131 CCCGGGAGGGGCGGCGGCGGCGG + Intronic
1042859080 8:73295142-73295164 CCCGGCGGGCACCTCGGGGGCGG + Exonic
1043463854 8:80486546-80486568 CCCGGAGCGCGGCGGGGCGGGGG + Exonic
1044306469 8:90645941-90645963 CCTAACGGGCGCCGCGGCGGAGG - Exonic
1045305041 8:100951369-100951391 CGCGCTGGGCGCTGCGGCGGCGG - Intronic
1045516295 8:102863627-102863649 CCCGGCGGCGGCGGCGGCGGCGG - Intronic
1045582959 8:103499879-103499901 CCCGGGAGGCGGAGGGGCGGAGG + Intergenic
1046547420 8:115669079-115669101 GCCGGGCGGGGCGGCGGCGGCGG - Intronic
1047381876 8:124372074-124372096 CGGGCGGGGCGCGGCGGCGGCGG + Exonic
1047732289 8:127737377-127737399 CCCGAGGGCGGCCGCGGCAGGGG - Intronic
1048981154 8:139703875-139703897 GCCGGGGGACGGCGCGGTGGCGG + Intergenic
1048981172 8:139703920-139703942 GGCGGCGGGCGCGGCGGCGGCGG + Intergenic
1049536132 8:143183338-143183360 CCCTGGGGGCCGAGCGGCGGTGG + Intergenic
1049565250 8:143334783-143334805 CCCGGGAGGCCGGGCGGCGGGGG + Exonic
1049637591 8:143697400-143697422 CCCGGGGGGTACCGCGACTGTGG - Intronic
1049767273 8:144360680-144360702 CCTGGTGGGCACCTCGGCGGGGG + Exonic
1049801124 8:144517960-144517982 ATCGCGGGGCGCCGCGGCGCCGG + Intergenic
1049886365 9:29500-29522 CCCGGGGTGCGCCCCGGGGCAGG + Intergenic
1050472619 9:6008213-6008235 CCCGGAGGGGGCCGCAGCGGCGG + Intergenic
1051876757 9:21802168-21802190 CGGGGCGGCCGCCGCGGCGGGGG - Intergenic
1051936474 9:22447617-22447639 CACGGGCGGCCCTGCGGCGGGGG + Exonic
1052362158 9:27573214-27573236 CCCGGCGGCGGCGGCGGCGGCGG - Intronic
1052494691 9:29212331-29212353 CCCAGCGGGCGCCGCGGAGCGGG - Intergenic
1052888824 9:33676951-33676973 CACGGGGGGTGCGGCGGCGGCGG + Intergenic
1053066316 9:35071989-35072011 GCCCCGGGGCGCCGCGCCGGCGG + Intronic
1053071208 9:35103098-35103120 TCCGGAGGTCGCTGCGGCGGTGG - Exonic
1053306156 9:36986140-36986162 CCCGGGGGGCGCGGGCGCGGCGG - Intronic
1053697398 9:40650737-40650759 CCGGGCGGGGGCCGCGGCGGCGG + Intergenic
1053697401 9:40650740-40650762 GGCGGGGGCCGCGGCGGCGGGGG + Intergenic
1054308703 9:63450183-63450205 CCGGGCGGGGGCCGCGGCGGCGG + Intergenic
1054308706 9:63450186-63450208 GGCGGGGGCCGCGGCGGCGGGGG + Intergenic
1054407367 9:64773876-64773898 CCAGGCGGGGGCCGCGGCGGCGG + Intergenic
1054407370 9:64773879-64773901 GGCGGGGGCCGCGGCGGCGGGGG + Intergenic
1054489440 9:65762644-65762666 CCGGGCGGGGGCCGCGGCGGTGG - Intergenic
1054835571 9:69672287-69672309 CCCGGCGGCGGCGGCGGCGGCGG - Exonic
1054842669 9:69760056-69760078 CTCGGCGGCGGCCGCGGCGGCGG - Intergenic
1055090865 9:72364383-72364405 CACGCCGGGCGCCGCCGCGGAGG + Intronic
1055091116 9:72365282-72365304 CCCGGCGGCGGCGGCGGCGGCGG + Intergenic
1056799500 9:89681412-89681434 CCCGGGGGGGGCGGGGGGGGCGG - Intergenic
1057337325 9:94166261-94166283 GCGGGCGGGCGCCGCCGCGGCGG - Intergenic
1057643783 9:96854187-96854209 CCCGGCGCGAGCGGCGGCGGGGG - Exonic
1057757183 9:97847950-97847972 CCCGGGGGGTGGGGGGGCGGGGG + Intergenic
1057881528 9:98796302-98796324 GCCCGGGGCCGCAGCGGCGGGGG - Exonic
1058753315 9:108060561-108060583 CTCGGGGGGCGGGGTGGCGGGGG + Intergenic
1058885943 9:109321022-109321044 CCCGGCGGCAGCGGCGGCGGCGG - Intergenic
1059123405 9:111661914-111661936 CCTGGGGGGCCCCGCGGTCGTGG + Intronic
1059470934 9:114504716-114504738 GCCGGGGCGGGCGGCGGCGGGGG - Exonic
1059633938 9:116154347-116154369 CCCGGCGGCGGCGGCGGCGGCGG - Exonic
1059769780 9:117414621-117414643 GCCCGGGGACGCGGCGGCGGCGG + Exonic
1060566772 9:124599577-124599599 CCATGAGGGCGCGGCGGCGGCGG + Intronic
1060700610 9:125746960-125746982 CCCGGGGGAGGCAGCGGCGGCGG - Intergenic
1060811204 9:126612505-126612527 TCCGCGGGGCCCCGCGGCGCAGG + Intergenic
1060831890 9:126722565-126722587 CCCGGGGAGCGCAGCGGGGTGGG - Intergenic
1061128213 9:128689744-128689766 CGCGGGGGGCGCCGGGCGGGGGG + Intronic
1061149102 9:128818847-128818869 CCCGGGGGACCCCGCGGCCCGGG + Exonic
1061610033 9:131740006-131740028 CGCGGGAGGCGGAGCGGCGGCGG - Intronic
1061727422 9:132589466-132589488 GCCAGGGGGGGCAGCGGCGGGGG - Exonic
1061796457 9:133088319-133088341 CCTGGGGGGCTCCGCGGTGGAGG + Intergenic
1061961675 9:133991985-133992007 CGCGGAGGTCGCAGCGGCGGCGG - Intronic
1061975832 9:134067726-134067748 GCCCGGGGTCGCGGCGGCGGTGG - Intronic
1061975963 9:134068159-134068181 CCCGGGGCGGGGCGCGGCGCCGG - Intronic
1061987148 9:134136335-134136357 CCCGGGCGGGGCCGCTGCAGCGG - Intronic
1062314797 9:135961343-135961365 CCCGGCGGCTGCTGCGGCGGCGG - Exonic
1062353017 9:136148396-136148418 CCCGGGGAGAGCAGCGGGGGAGG - Intergenic
1062556209 9:137114411-137114433 GCCGGGGGGCGGCGGGACGGCGG + Intronic
1062574637 9:137200494-137200516 GCCGAGCGGCGGCGCGGCGGGGG - Exonic
1062596613 9:137302524-137302546 CCCGGGGGGCGCGCGGACGGCGG - Intergenic
1062629910 9:137458945-137458967 CCCGGGGAGCACCGCGGGGCAGG + Intronic
1062659093 9:137619065-137619087 GGCGGGGGGCGGCGCGGGGGCGG + Intronic
1062708682 9:137960040-137960062 CCTGAGGGACGCCGGGGCGGGGG + Intronic
1202779766 9_KI270717v1_random:24095-24117 CCGGGCGGGGGCCACGGCGGCGG + Intergenic
1203469885 Un_GL000220v1:111693-111715 CCCGACGGCCGCCGCGGCGGCGG - Intergenic
1203471474 Un_GL000220v1:116881-116903 CCCGGGGGCGGACCCGGCGGGGG - Intergenic
1203477706 Un_GL000220v1:155665-155687 CCCGACGGCCGCCGCGGCGGCGG - Intergenic
1203479295 Un_GL000220v1:160853-160875 CCCGGGGGCGGACCCGGCGGGGG - Intergenic
1185610866 X:1392898-1392920 CCCGGCGGGGGCTGCGGCCGGGG + Intergenic
1185877632 X:3713326-3713348 CTCGGAGGGCGGCGCGGCGGCGG + Exonic
1185894324 X:3844070-3844092 CCCGAGGGGCGCCTCGGGCGCGG - Intergenic
1185899443 X:3882494-3882516 CCCGAGGGGCGCCTCGGGCGCGG - Intergenic
1185904560 X:3920923-3920945 CCCGAGGGGCGCCTCGGGCGCGG - Intergenic
1186426096 X:9465210-9465232 GCCTGAGGGCGCTGCGGCGGCGG - Exonic
1186768058 X:12791458-12791480 CGAGGGGCGCGCGGCGGCGGAGG - Exonic
1186768099 X:12791616-12791638 CCAGGTGGGGGCCGCGCCGGCGG + Exonic
1187332647 X:18354717-18354739 CGCGGGGGGCGGGGCGGCAGTGG - Exonic
1187915547 X:24149801-24149823 CCCGGGTGCCGCCGCGGCCGCGG + Intronic
1188005444 X:25013343-25013365 CCCGGGCAGCGCCCCGGCTGCGG - Exonic
1188064856 X:25646324-25646346 CCATGGGGGCGCGGCGGGGGCGG + Intergenic
1189323179 X:40098176-40098198 CCGCGGAGGCGCCGCAGCGGAGG - Intronic
1189407092 X:40735295-40735317 CCCGGGAGCCGCCGTGGCGGCGG - Exonic
1190220399 X:48509037-48509059 CCCGGAGGAGGCAGCGGCGGCGG + Intronic
1190285225 X:48957204-48957226 CGCGCTGGGCGCAGCGGCGGCGG - Exonic
1190881455 X:54495393-54495415 CCCGGGGGGCGCCGGGCCTTCGG - Exonic
1192361753 X:70445112-70445134 CCCGGCGGCGGCGGCGGCGGTGG + Exonic
1192561499 X:72130976-72130998 CCCCGGGGGCGCCGAGCGGGTGG - Exonic
1193654993 X:84187997-84188019 GCTGGGGGTCGCGGCGGCGGCGG - Intergenic
1195252668 X:103063837-103063859 CACGGGGGGCGAGGCGGCCGAGG - Intronic
1196734981 X:118975200-118975222 GACGGGGGCCGCCGCGGCTGCGG + Exonic
1198099900 X:133414715-133414737 CGCAGGGGGCGGCGGGGCGGGGG + Intronic
1200000190 X:153056250-153056272 CCCGGGGGCCCCCGTGGCGGGGG + Intergenic
1200092940 X:153644269-153644291 CCCGGGGCGCCCGGCGGGGGCGG + Intronic
1200155579 X:153972933-153972955 CCCGGGCGCGGCGGCGGCGGCGG + Intronic
1200249752 X:154546758-154546780 CCGGGCGGGCGCCGCGCAGGCGG - Intronic
1200787547 Y:7273748-7273770 CCCCGGGGGCGCCCCGGGCGCGG + Intergenic