ID: 1153514564

View in Genome Browser
Species Human (GRCh38)
Location 18:5891743-5891765
Sequence ACTGCTACTGCTGTTGGCCG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 174}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153514555_1153514564 18 Left 1153514555 18:5891702-5891724 CCTGGAGCCCTAGGGTGGCTCCT 0: 1
1: 0
2: 1
3: 19
4: 218
Right 1153514564 18:5891743-5891765 ACTGCTACTGCTGTTGGCCGTGG 0: 1
1: 0
2: 0
3: 12
4: 174
1153514553_1153514564 20 Left 1153514553 18:5891700-5891722 CCCCTGGAGCCCTAGGGTGGCTC 0: 1
1: 0
2: 1
3: 21
4: 141
Right 1153514564 18:5891743-5891765 ACTGCTACTGCTGTTGGCCGTGG 0: 1
1: 0
2: 0
3: 12
4: 174
1153514554_1153514564 19 Left 1153514554 18:5891701-5891723 CCCTGGAGCCCTAGGGTGGCTCC 0: 1
1: 0
2: 1
3: 20
4: 164
Right 1153514564 18:5891743-5891765 ACTGCTACTGCTGTTGGCCGTGG 0: 1
1: 0
2: 0
3: 12
4: 174
1153514557_1153514564 11 Left 1153514557 18:5891709-5891731 CCCTAGGGTGGCTCCTGGACCGG 0: 1
1: 0
2: 0
3: 8
4: 79
Right 1153514564 18:5891743-5891765 ACTGCTACTGCTGTTGGCCGTGG 0: 1
1: 0
2: 0
3: 12
4: 174
1153514561_1153514564 -8 Left 1153514561 18:5891728-5891750 CCGGTTTTTGCTGCCACTGCTAC 0: 1
1: 0
2: 4
3: 119
4: 226
Right 1153514564 18:5891743-5891765 ACTGCTACTGCTGTTGGCCGTGG 0: 1
1: 0
2: 0
3: 12
4: 174
1153514560_1153514564 -2 Left 1153514560 18:5891722-5891744 CCTGGACCGGTTTTTGCTGCCAC 0: 1
1: 0
2: 1
3: 4
4: 71
Right 1153514564 18:5891743-5891765 ACTGCTACTGCTGTTGGCCGTGG 0: 1
1: 0
2: 0
3: 12
4: 174
1153514552_1153514564 21 Left 1153514552 18:5891699-5891721 CCCCCTGGAGCCCTAGGGTGGCT 0: 1
1: 0
2: 4
3: 23
4: 242
Right 1153514564 18:5891743-5891765 ACTGCTACTGCTGTTGGCCGTGG 0: 1
1: 0
2: 0
3: 12
4: 174
1153514559_1153514564 10 Left 1153514559 18:5891710-5891732 CCTAGGGTGGCTCCTGGACCGGT 0: 1
1: 1
2: 1
3: 13
4: 106
Right 1153514564 18:5891743-5891765 ACTGCTACTGCTGTTGGCCGTGG 0: 1
1: 0
2: 0
3: 12
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153514564 Original CRISPR ACTGCTACTGCTGTTGGCCG TGG Exonic
900504877 1:3024963-3024985 ACTGCTGCTGCTGGGGGCGGTGG + Intergenic
901188626 1:7390454-7390476 ACTGGTACTGGCGTTGGCAGTGG - Intronic
901194054 1:7430307-7430329 GCTGCTGCTGCTGATGGCAGTGG + Intronic
902412213 1:16218087-16218109 ACTGCTCCTGCTGGAGGCCATGG - Intergenic
902775908 1:18674845-18674867 GCTGCCACTGCTGTTGGTGGGGG - Intronic
902796102 1:18801188-18801210 ACTGTTACTGATGTTGGTGGTGG - Intergenic
903729830 1:25484319-25484341 ACTGCTTCTCCTGTTGCCAGGGG + Intronic
903818113 1:26079954-26079976 ACTGGCACTGCTCTTGGCCCTGG + Intergenic
906180219 1:43811524-43811546 CCTGTTGCTTCTGTTGGCCGAGG + Intronic
909050628 1:70763596-70763618 ACTTCTACGGCTGTAGGCAGTGG + Intergenic
909134840 1:71785179-71785201 GCTGCTGCTGCTGTTGCCTGAGG - Intronic
913963180 1:143354439-143354461 GCTGCTGCTGCTGCTGGCCTGGG + Intergenic
914057536 1:144180025-144180047 GCTGCTGCTGCTGCTGGCCTGGG + Intergenic
914121610 1:144786341-144786363 GCTGCTGCTGCTGCTGGCCTGGG - Intergenic
915214626 1:154331600-154331622 ACTGCTCCTGCTGGAGGCTGAGG - Exonic
916497939 1:165361961-165361983 ACTGCCACTGATGATGGCCTTGG + Intergenic
920920461 1:210293523-210293545 ACTGTGACTGCTGTTTGCAGAGG + Intergenic
1065884105 10:30061599-30061621 ACAGCTACTGCTGTTTGACTTGG + Intronic
1067478341 10:46580204-46580226 GCTGCTGCTGCTGTTGATCGGGG + Exonic
1067616397 10:47761583-47761605 GCTGCTGCTGCTGTTGATCGGGG - Intergenic
1070563740 10:77588172-77588194 ACAGTCACTCCTGTTGGCCGAGG + Intronic
1072015500 10:91342476-91342498 ACTGTTCCTGCTTTTGGCCATGG - Intergenic
1072788592 10:98301628-98301650 AATGGAACTGCTGTTTGCCGGGG - Intergenic
1072961939 10:99937270-99937292 GCTGCTGCTGCTGTTGGTTGAGG - Intronic
1073276092 10:102312745-102312767 ACTGCTCCTGGTGTTTGCCTCGG + Intronic
1073543376 10:104329827-104329849 AATGATACTGCTGTTGGCACTGG + Intronic
1073716706 10:106115475-106115497 AAGGCTGCTGCTGTTGGCTGGGG - Intergenic
1076409345 10:130234780-130234802 ACTGCTACTGGGGTGGGCCATGG + Intergenic
1076700422 10:132270030-132270052 CCTGGTACTGCTGTAGGCCTTGG + Intronic
1080173114 11:29329963-29329985 ACTGATACTGTTGTTGGCTGAGG + Intergenic
1082131611 11:48496763-48496785 TCTACTGCTGCTGTTGGCCTGGG + Intergenic
1082565111 11:54667716-54667738 TCTACTGCTGCTGTTGGCCTGGG + Intergenic
1082828529 11:57598300-57598322 CCTGCTGCTGCTGCTGGCTGGGG + Exonic
1082842926 11:57704047-57704069 GCTGCTGCTGCTGCTGGCCTGGG + Exonic
1087085895 11:94218701-94218723 ACTAGTAGTGCTGTAGGCCGGGG + Intergenic
1088659364 11:112030014-112030036 ACTGGGACCGCTGTTTGCCGTGG + Intronic
1088786610 11:113188055-113188077 ACTGTTGCTGCTGTTGGGTGTGG + Intronic
1089858346 11:121566985-121567007 GCTTCTACTGTTGTTGGCCTTGG - Exonic
1090839325 11:130474940-130474962 ACAGCTACTGCTGTCTGCCCTGG + Exonic
1091402927 12:191650-191672 ACTGCTACGACTGTTGGTGGTGG + Intronic
1101191384 12:102337227-102337249 ACTGCTATTGCTGGGGGCGGAGG - Intergenic
1103308930 12:119989377-119989399 GCTGCTGCTGCTGTTGCCGGCGG - Intergenic
1103724512 12:122991058-122991080 GCTGCTTCTGCTGTGGGCTGTGG - Intronic
1103896593 12:124277583-124277605 GCTTCTCCTGCTGTTGGCCCTGG + Intronic
1105793291 13:23824438-23824460 ACTCCTACTGCTGATGTCCCTGG + Intronic
1106884853 13:34173533-34173555 ACTGCTTCTGAAGTTGGCCTTGG + Intergenic
1107135575 13:36940575-36940597 ACTACTACTGGTGTTGGGCAGGG + Intergenic
1107405473 13:40108317-40108339 ACTGCTAATGCTGCTGGTCAGGG + Intergenic
1108002490 13:45916937-45916959 GCTGCTGCTGCTGCTGGCCTGGG - Intergenic
1110241022 13:73266945-73266967 ACTACAAGTGCTGTTGGCCTTGG + Intergenic
1110910488 13:80955940-80955962 ACTGCTAATGCAGTTTGCTGAGG - Intergenic
1112438417 13:99408104-99408126 GCTGCTGATGCTGGTGGCCGTGG - Intergenic
1113914798 13:113863845-113863867 GCTGCTGCTGCTGCTGGCCGCGG - Exonic
1114391100 14:22309501-22309523 ACTGCTCCTGCTGATGGAAGAGG + Intergenic
1119396601 14:74330729-74330751 TCTGATACTGCTGTTGGGCGCGG - Intronic
1120058567 14:79954436-79954458 AGTGCTGCTGCTGTTTGCTGGGG - Intergenic
1121614839 14:95306642-95306664 TCTGCTGTTGCTGTTGGTCGTGG - Intronic
1122636290 14:103131283-103131305 GCTGCTGCTGCTGCAGGCCGTGG - Intronic
1123663785 15:22590060-22590082 ACTGCTACTCCTGTGGGCACAGG + Intergenic
1124317616 15:28684509-28684531 ACTGCTACTCCTGTGGGCACAGG + Intergenic
1124565829 15:30813001-30813023 ACTGCTACTCCTGTGGGCACAGG - Intergenic
1124848583 15:33314253-33314275 CCTCCCACTGCTGTTGGCAGTGG + Intronic
1125133633 15:36314314-36314336 ACTGCCACTGCTGCAGGCCCTGG - Intergenic
1125776561 15:42221170-42221192 ACTGCAACTTCTGTTCCCCGGGG - Intronic
1129229564 15:74189250-74189272 CCTGCTGCTGCTGGTGGGCGTGG - Exonic
1130558935 15:84943971-84943993 TCTGCTGCTGCTGGTGGCCCAGG + Intronic
1132164397 15:99571451-99571473 ACTGCTATTGCTGTTAGTCATGG + Intronic
1132320922 15:100924564-100924586 ACTGCCACTGCCGCTGGCTGTGG - Exonic
1134790363 16:16984186-16984208 ACGGCGACTGCTGGTAGCCGCGG - Intergenic
1135875284 16:26193511-26193533 ACTGCTACTGCTGTGGGTACTGG - Intergenic
1135985619 16:27181555-27181577 ATTTTTACTGCTTTTGGCCGGGG + Intergenic
1137712244 16:50574498-50574520 CCTCCTGCTGCTGGTGGCCGAGG + Intronic
1142148316 16:88501846-88501868 CCTGCCACTGCTGTTTGCCATGG + Intronic
1142995200 17:3755916-3755938 AGTGAGACTGCTGTGGGCCGAGG + Intronic
1144180170 17:12744368-12744390 GCTGCTGCTGCTGCTGGCTGAGG - Exonic
1150190915 17:63238056-63238078 CCTGCTACTGAATTTGGCCGTGG - Exonic
1150231342 17:63552893-63552915 ACTGCTAATGCTGTTGATAGTGG - Intronic
1152090267 17:78242634-78242656 GCTGCTGCTGCTGTTGGCGGAGG - Intergenic
1153514564 18:5891743-5891765 ACTGCTACTGCTGTTGGCCGTGG + Exonic
1155389068 18:25314277-25314299 ACAGCTAGTTCTGTTGGCAGTGG - Intronic
1160865676 19:1254918-1254940 ACTGGCACTGCTGCTGGCCGTGG - Exonic
1161260566 19:3335597-3335619 CCAGCTACTGCTGCTGGCCAAGG + Intergenic
1161746304 19:6062242-6062264 ACTGCCGCTGCTGTTGTCCTTGG - Intronic
1163175945 19:15564129-15564151 GCTGCTCCTGCTGCTGGTCGGGG + Intergenic
1163182743 19:15615673-15615695 GCTGCTCCTGCTGGTGGTCGGGG + Exonic
1163202652 19:15779833-15779855 GCTGCTCCTGCTGCTGGCTGGGG - Intergenic
1163676515 19:18658087-18658109 ACTGCAGCTGCTGGTGGCCAGGG + Intronic
1165266577 19:34666772-34666794 CCTGCTGCTGCTGTTGCTCGTGG + Intronic
1165329687 19:35134641-35134663 TCTGCTGCTGCTGCTGGCTGGGG - Exonic
1165861040 19:38909511-38909533 CAAGCTACTGCTGTTGGCTGTGG - Intronic
1167174817 19:47858629-47858651 ACTGCTACTGATGTATGCAGGGG - Intergenic
1167436230 19:49480377-49480399 CCTCCTACTGCTGCTGCCCGTGG + Exonic
1202697020 1_KI270712v1_random:132698-132720 GCTGCTGCTGCTGCTGGCCTGGG + Intergenic
926303172 2:11618432-11618454 ACTGTGCCTGCTGATGGCCGAGG - Exonic
927480649 2:23451412-23451434 ACTGCCACTGATGTTTGCTGTGG - Intronic
929454335 2:42055373-42055395 ACCGGTACTGCTGCTTGCCGTGG - Exonic
931802985 2:65776970-65776992 AATGCTGCTGCTGCTGGCCCAGG + Intergenic
932098162 2:68871038-68871060 ACTCCTAATGATGTTGGCAGAGG + Exonic
932119634 2:69086679-69086701 ACTGCTGCTACTTTTGGGCGTGG - Intronic
934278181 2:91589712-91589734 GCTGCTGCTGCTGCTGGCCTGGG + Intergenic
937007561 2:118531161-118531183 ACTGCTTCTGCTGTTCACCGTGG - Intergenic
937523488 2:122739230-122739252 ACTGCAACTGGTGTTGGAAGTGG + Intergenic
939244937 2:139610730-139610752 ACTGCTGCTGCTGCTGGGGGAGG + Intergenic
943342179 2:186694293-186694315 GCTGCTGCTGCTGTTGGATGAGG - Exonic
945326603 2:208489336-208489358 ACTGCTCCTGCTGTGAGCAGAGG - Intronic
947738465 2:232473174-232473196 ACTGCTACCTCTGTTTGCGGTGG + Intergenic
1169197193 20:3689619-3689641 CCTGCTCCTGCTGTTGGGCCTGG - Exonic
1169712681 20:8582291-8582313 ACGGCAACTCCTGTTGGCTGAGG - Intronic
1175362638 20:58425693-58425715 GCTGCTGCTGCTGCTGGCCCAGG - Intronic
1176447232 21:6830961-6830983 ACTACTACTGCTGTGCGCCATGG + Intergenic
1176825402 21:13695987-13696009 ACTACTACTGCTGTGCGCCATGG + Intergenic
951017399 3:17745461-17745483 ACAGCTAGGGCTGTTGGCCAGGG - Intronic
951962817 3:28348531-28348553 ACAGCTACGGAGGTTGGCCGCGG + Intronic
954297648 3:49683051-49683073 ACTGTTACTGATGTTGGGCCAGG + Exonic
954918456 3:54168632-54168654 ACTGTTACTGTGGTTGGCCTAGG + Intronic
955733504 3:62012066-62012088 ACTGATACTGGTGTTGGTAGTGG + Intronic
956897001 3:73672605-73672627 TCTGCTGCTTCTGTTTGCCGTGG + Intergenic
959222583 3:103540746-103540768 ACTGCCACTTCTGACGGCCGTGG - Intergenic
962040754 3:131705249-131705271 CTTGCTGCTGCTGTTGGACGGGG - Intronic
966715182 3:183007299-183007321 AGTGCTGCTGCTGCTGGCCCTGG + Intergenic
967281481 3:187827954-187827976 ACTGGGACTGCTGGTGGCCATGG - Intergenic
968914587 4:3491892-3491914 ACGGCTCCTGCACTTGGCCGTGG - Intronic
969032568 4:4226624-4226646 GCTGCTGCTGCTGCTGGCCTGGG - Exonic
971465685 4:26957386-26957408 ACTTCTACTGCTGTTGCTGGTGG + Intronic
972239164 4:37171232-37171254 ACTGCTGCTGCTTTTGGTCTAGG - Intergenic
972456428 4:39260451-39260473 TCAGCTACTGCTGGAGGCCGAGG - Intronic
975177075 4:71300782-71300804 ACTGCTGCTGCAGATGGCTGCGG - Intronic
975585059 4:75940883-75940905 GCTGCTGCTGCTGCTGGCCGGGG - Exonic
981352926 4:143752914-143752936 AGGGCTGCTGCTGTTGGCTGGGG - Intergenic
981938590 4:150258387-150258409 CCTGCTACAGCTGTGGGCCTAGG - Intergenic
984810956 4:183796536-183796558 ACTGCTGCTGCTGGTGGTCTCGG - Intergenic
985322899 4:188734443-188734465 ACTGCTGCTGCTGCTGGCTCGGG + Intergenic
986216556 5:5724843-5724865 ACAGCTCCTTCTGTTGGCTGCGG - Intergenic
986923450 5:12717035-12717057 ACTGCTGCAGCTGTGGGCCTGGG + Intergenic
987360319 5:17100451-17100473 AGTGCTACTCCTGGTGGCCTAGG + Intronic
988165165 5:27580017-27580039 AATGCCACTTCTGTTGGTCGTGG + Intergenic
992816135 5:80441117-80441139 ACTGCTGGTGCTGTTAGCCAAGG + Intronic
993005946 5:82428442-82428464 TCTGGTACTGCTGTTGGCAAAGG + Intergenic
993107996 5:83622151-83622173 GCTGCTGCTGCTGCTGGCAGAGG - Intergenic
998253429 5:140567604-140567626 GCTGCTGCTGCTGATGGCTGCGG + Exonic
999276734 5:150336258-150336280 AATGCTGGTGGTGTTGGCCGTGG - Intronic
1002435295 5:179227708-179227730 ACTGCTGGTCCTGTGGGCCGTGG - Intronic
1006449146 6:34096016-34096038 CCTGCTGCTGCTGTTGGGAGAGG - Intronic
1007091909 6:39190063-39190085 ACTGCTAGGGCTGGTGGCCAGGG - Exonic
1008063666 6:47025337-47025359 AATGCTGCTGCTGCTGGCCTGGG + Intronic
1008501462 6:52187605-52187627 ACTGCTACTGCTGCTGAGCCTGG + Exonic
1011648291 6:89481737-89481759 ACTGCTGCTGCTGCTGGTGGTGG + Intronic
1015184158 6:130394454-130394476 GCTGCTTCTGCTTTTGGCAGAGG + Intronic
1016863703 6:148746838-148746860 ACTGCTTCTGCTGGGGGCGGAGG - Intergenic
1017840910 6:158222302-158222324 ACTGCTTCTGCTGCTGGGCCAGG + Intergenic
1019667457 7:2258990-2259012 GCTGCTACTGGTGTAAGCCGGGG - Intronic
1019876021 7:3811618-3811640 TCTGCTGCTGCTGTTGGCCATGG + Intronic
1020345431 7:7157329-7157351 AGTTCTACTGCTGTTGTCTGTGG + Intronic
1022377846 7:29831280-29831302 ACTCCTAGTGCCGTTGGCCATGG + Intronic
1022458560 7:30581487-30581509 ACTGCGACTGCTGTTCCCTGTGG - Intergenic
1023418302 7:39951429-39951451 GCTGCTACTGCTGCTGGATGTGG - Exonic
1029316597 7:99721097-99721119 ACAGCTGCTGCAGTTGGCTGAGG + Intronic
1031113936 7:117646644-117646666 ACTGCTGCTGCTGATGGCATGGG + Intronic
1033486082 7:141790382-141790404 ACTGCTGATGCTGGTGGCAGTGG + Exonic
1034270975 7:149803311-149803333 ACTGCAGCTTCTGTTGGCCTTGG - Intergenic
1034900839 7:154907046-154907068 TCTGCTGCTGCTGCTGGCCCGGG - Intergenic
1038883608 8:31640089-31640111 ACTGCTGCTGCTGGGGACCGCGG + Intronic
1040531576 8:48270598-48270620 TCTGGCACTGCTGTTGGCCAAGG + Intergenic
1041167205 8:55102135-55102157 GCTGCTCCTGCTGCTGGCGGCGG + Intergenic
1041167438 8:55103162-55103184 GTTGCTGCCGCTGTTGGCCGCGG - Exonic
1042380150 8:68104179-68104201 ACCTCTACTGCTGGTGGCCTTGG + Intronic
1043617326 8:82143135-82143157 AGTGCTGCTGCTGATGGCTGTGG + Intergenic
1044721893 8:95159156-95159178 ACTGTTAGTGCTGCTGGCCCAGG + Intergenic
1045398852 8:101790906-101790928 GCTGCTACTGCTGTTTCCAGGGG - Intronic
1046352610 8:113034520-113034542 AGTGCTCCTGCTGTTGGTGGTGG + Intronic
1047154759 8:122304391-122304413 ATTGCTACTGCTTATGGCCACGG - Intergenic
1049183395 8:141235160-141235182 ACTGCTGCTGCTGTGGGTCGGGG - Intronic
1053188231 9:36037031-36037053 GCTGCTCCTTCTGCTGGCCGTGG + Exonic
1053531413 9:38885640-38885662 ACTGCTAATGCTGTTTGTAGTGG - Intergenic
1054203637 9:62110069-62110091 ACTGCTAATGCTGTTTGTAGTGG - Intergenic
1054634725 9:67478295-67478317 ACTGCTAATGCTGTTTGTAGTGG + Intergenic
1054813797 9:69455621-69455643 AGTGCTCCTGCTGTTTGCTGGGG + Intronic
1055590721 9:77810877-77810899 ACTGTTACTGGTGTTGGGCAAGG + Intronic
1055939269 9:81634292-81634314 ACTGCTGCTGCTGTTGGTGGTGG + Exonic
1057149633 9:92784759-92784781 ATTCCTACTGCTGTTGGGCGGGG + Intergenic
1062095543 9:134701391-134701413 ACTGTGACTGCTGTTGGAGGAGG + Intronic
1203521958 Un_GL000213v1:53570-53592 ACTACTACTGCTGTGCGCCATGG - Intergenic
1186276668 X:7946797-7946819 AGTGCTACTGCTGTGGGGCGTGG + Intergenic
1188437117 X:30173687-30173709 GCTGCTGCTGCTGCTGGCCTGGG - Intergenic
1193583654 X:83294506-83294528 ACTCCTACTGCCCTTGGCCTCGG + Intergenic
1195760034 X:108236124-108236146 AGTGTTGCTACTGTTGGCCGTGG - Intronic
1199358188 X:146885860-146885882 ACTGCTGCTGCTGGGGGTCGGGG - Intergenic