ID: 1153517513

View in Genome Browser
Species Human (GRCh38)
Location 18:5917807-5917829
Sequence GGATCTTTGCATCTGTTACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153517509_1153517513 8 Left 1153517509 18:5917776-5917798 CCTTCAACATCCTCATGTCTTTT No data
Right 1153517513 18:5917807-5917829 GGATCTTTGCATCTGTTACTTGG No data
1153517510_1153517513 -2 Left 1153517510 18:5917786-5917808 CCTCATGTCTTTTCTGCCTCAGG No data
Right 1153517513 18:5917807-5917829 GGATCTTTGCATCTGTTACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153517513 Original CRISPR GGATCTTTGCATCTGTTACT TGG Intergenic
No off target data available for this crispr