ID: 1153518750

View in Genome Browser
Species Human (GRCh38)
Location 18:5931843-5931865
Sequence TGGCAAAACAAGGATCTCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153518746_1153518750 4 Left 1153518746 18:5931816-5931838 CCATTTCTTCAGATGTTCTTGAG No data
Right 1153518750 18:5931843-5931865 TGGCAAAACAAGGATCTCATGGG No data
1153518745_1153518750 5 Left 1153518745 18:5931815-5931837 CCCATTTCTTCAGATGTTCTTGA No data
Right 1153518750 18:5931843-5931865 TGGCAAAACAAGGATCTCATGGG No data
1153518744_1153518750 25 Left 1153518744 18:5931795-5931817 CCTCATGTGAGCTCTGTGTTCCC No data
Right 1153518750 18:5931843-5931865 TGGCAAAACAAGGATCTCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153518750 Original CRISPR TGGCAAAACAAGGATCTCAT GGG Intergenic
No off target data available for this crispr