ID: 1153521091

View in Genome Browser
Species Human (GRCh38)
Location 18:5954541-5954563
Sequence ATATATTTCCCAAGGGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 195}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153521091_1153521099 30 Left 1153521091 18:5954541-5954563 CCTGCTTCCCTTGGGAAATATAT 0: 1
1: 0
2: 1
3: 17
4: 195
Right 1153521099 18:5954594-5954616 ACTTCCTTGCTAGCTAATGTGGG 0: 1
1: 0
2: 1
3: 5
4: 94
1153521091_1153521096 4 Left 1153521091 18:5954541-5954563 CCTGCTTCCCTTGGGAAATATAT 0: 1
1: 0
2: 1
3: 17
4: 195
Right 1153521096 18:5954568-5954590 AGAAAGACAGCACTCCAAAATGG 0: 1
1: 0
2: 2
3: 33
4: 314
1153521091_1153521098 29 Left 1153521091 18:5954541-5954563 CCTGCTTCCCTTGGGAAATATAT 0: 1
1: 0
2: 1
3: 17
4: 195
Right 1153521098 18:5954593-5954615 GACTTCCTTGCTAGCTAATGTGG 0: 1
1: 0
2: 0
3: 10
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153521091 Original CRISPR ATATATTTCCCAAGGGAAGC AGG (reversed) Intergenic
900767863 1:4517533-4517555 ATCTATTTCCCAGGGGACCCAGG - Intergenic
902470701 1:16646186-16646208 AAAAATTTCCCCTGGGAAGCAGG - Intergenic
902488103 1:16761274-16761296 AAAAATTTCCCCTGGGAAGCAGG + Intronic
902890741 1:19441625-19441647 ACATCTTTCCCAAGTGATGCTGG + Intronic
903057234 1:20644707-20644729 ATACATCTCCCAAGGGGAGCTGG + Intronic
906119429 1:43378798-43378820 ATAAATATCCCTAGGGAATCTGG + Intergenic
908020495 1:59893273-59893295 ACATATCTCACAAAGGAAGCAGG + Intergenic
908034986 1:60042100-60042122 TTTCATTTCCCAAGAGAAGCAGG - Intronic
909397164 1:75182988-75183010 ATCTGTTCCCCAAGGGCAGCTGG - Intergenic
909825616 1:80122897-80122919 ATCTCTTTCCCTAGTGAAGCGGG - Intergenic
911779553 1:101858978-101859000 ATAAATTTCCCAAGAAAATCAGG + Intronic
912171582 1:107107200-107107222 ATATTTTTGCCAAGGAAAGCTGG - Intergenic
914785349 1:150824298-150824320 ATGGATTTCCCAAGGGAAGTAGG - Intronic
915333754 1:155129008-155129030 ACATATTTCTCAAGGGGAGTGGG - Intronic
915463762 1:156083989-156084011 GGATCTTTCCCAAGGGAAGAAGG + Intronic
916310482 1:163393519-163393541 ACACATATCTCAAGGGAAGCCGG + Intergenic
919535198 1:198778683-198778705 AAAGATTTCACATGGGAAGCTGG - Intergenic
920727253 1:208447840-208447862 ATAAATTTCCCAGGGGTACCAGG + Intergenic
921553985 1:216574918-216574940 TTCTCTTTCCCAAGGGAAGGAGG - Intronic
922199545 1:223390242-223390264 ACAGATTTCCCAGGGGAAGGTGG - Intergenic
922342969 1:224672240-224672262 ATACACCTCCCCAGGGAAGCAGG - Intronic
1063367678 10:5500936-5500958 ACACATTCTCCAAGGGAAGCCGG + Intergenic
1063645112 10:7872881-7872903 AAATATTTCCCAAGGCAGCCAGG - Intronic
1064284873 10:13983561-13983583 ATATAATTCCCTAGAGAAGAAGG + Intronic
1068645843 10:59466379-59466401 ATATCTTTAGCAAGGGAAGGGGG + Intergenic
1069840469 10:71336448-71336470 AAATGTTTCCCCAGGGCAGCCGG + Intronic
1071444723 10:85735480-85735502 ATATATTTCCCAAGTCAACCAGG + Intronic
1074840176 10:117343618-117343640 TTATATTTGACAAGGAAAGCTGG - Intronic
1076328478 10:129646703-129646725 ATATATTTCTGATGGGCAGCAGG - Intronic
1079464205 11:20713427-20713449 ATATAGTTCACCAGGGAAGTGGG + Intronic
1081237927 11:40668476-40668498 ATAAAGTTCGCAAGGGAAGAAGG + Intronic
1082624487 11:55466571-55466593 ATAGATTTGTCAAGGGAAGATGG + Intergenic
1083474066 11:62904300-62904322 ATACATTTCCCAGGTGAAGTAGG + Intergenic
1083892833 11:65605394-65605416 ATTTGGTACCCAAGGGAAGCTGG - Intronic
1083925790 11:65805240-65805262 AAATATGTACCATGGGAAGCTGG + Intergenic
1084758662 11:71254340-71254362 AAATACTTCCCTAGGGACGCAGG + Intergenic
1085070494 11:73539877-73539899 CTGAATTTCCCAAGGCAAGCAGG + Intronic
1087304167 11:96469603-96469625 AAATAATTCCCAAGGGCATCTGG - Intronic
1089260242 11:117219290-117219312 ATGGATTCCCCAAGGCAAGCTGG + Intronic
1090494010 11:127192165-127192187 ATATTTTTCCCAAGGTAAATAGG + Intergenic
1093469217 12:19482845-19482867 ATATAGTTCACCAGGGAAGTGGG + Intronic
1099002517 12:77196114-77196136 ATATAATTCCCAAAGGAATTTGG + Intergenic
1099285669 12:80711457-80711479 ATTAATTTCCCAAGGCAAGCTGG - Intergenic
1104178699 12:126357349-126357371 ATATATGTACCAAGGGAAGAGGG + Intergenic
1104369055 12:128206364-128206386 AGATCTTTTCCAAGGGGAGCAGG + Intergenic
1104756542 12:131273227-131273249 CTTGATTTCCCAAAGGAAGCTGG + Intergenic
1105658377 13:22465366-22465388 TTTTATTTCCCAAGGGAATTTGG + Intergenic
1106587003 13:31066382-31066404 ACATGTTTCTCAAGGGTAGCTGG + Intergenic
1107007945 13:35636036-35636058 ATATTTTACTCAAGGGAAGAAGG + Intronic
1107731806 13:43356268-43356290 ATACATTTCCCATAGGAAGCGGG + Intronic
1108936497 13:55888057-55888079 ATAGTTATCCCAAGGGAAGATGG - Intergenic
1109922711 13:69089903-69089925 ATATCATTCCCAAGGGAAGCAGG + Intergenic
1109955265 13:69557489-69557511 ATAGATTACCCAAGGGAAACTGG + Intergenic
1110534857 13:76639266-76639288 ATATATTTACCAAGGTTAGGTGG + Intergenic
1110788347 13:79560129-79560151 AAAACTTTGCCAAGGGAAGCAGG + Intergenic
1111142403 13:84136856-84136878 AATTAGTTCCCAAGGGAAGAAGG - Intergenic
1111218581 13:85176629-85176651 ATGTATTTCCCCACAGAAGCAGG - Intergenic
1112403815 13:99100087-99100109 AAATATTTTCCAAAGGAAACTGG - Intergenic
1113213059 13:108004461-108004483 ATATATATCACTAGGAAAGCAGG - Intergenic
1113311453 13:109137216-109137238 ACATGTGTCCCAAGGGAAGGAGG + Intronic
1113554720 13:111223538-111223560 CTACACTTCCCCAGGGAAGCAGG - Intronic
1114307991 14:21440967-21440989 CTATATTTTCCATGGAAAGCTGG + Intronic
1114477722 14:23009552-23009574 ATTCATTTCCCTAGGGAAGGGGG - Intronic
1114754211 14:25240655-25240677 ACATTTTTCCCAAATGAAGCAGG + Intergenic
1117280212 14:54233443-54233465 TTATTTTTCCCAAGGGAAAAAGG - Intergenic
1117713974 14:58561975-58561997 AGATAATTCCCAAGGAAAGTTGG - Intergenic
1118338478 14:64875419-64875441 AAATATTTACCAAGGGGAGTTGG + Intronic
1119614518 14:76090232-76090254 AGTTATTTTCCAAGAGAAGCTGG - Intergenic
1120736373 14:88057560-88057582 ATACAGATCCCCAGGGAAGCGGG + Intergenic
1121881700 14:97506733-97506755 TTACATTTCCCAAGAGAAGGAGG + Intergenic
1124102731 15:26711133-26711155 ATATCATTCCAAAGGGAAGATGG - Intronic
1125323705 15:38515017-38515039 AGTTATTTCCAAATGGAAGCTGG + Intronic
1125405882 15:39352313-39352335 ATATATATCCCAAGCCCAGCCGG + Intergenic
1127691915 15:61404915-61404937 ATAACTTTCCCGAGGGCAGCTGG + Intergenic
1129125944 15:73441533-73441555 AAAAATTTCCCGAGGGAAGATGG - Intergenic
1129487742 15:75892364-75892386 ATATGTTTCCCAAGGACAGTAGG + Intronic
1129617688 15:77112739-77112761 AAATATGTGCCAAGGGAAGAAGG + Exonic
1129939185 15:79479032-79479054 ATATAGTTTCCAAGAGAAGGGGG + Intergenic
1130267865 15:82424953-82424975 AAATATTTCTCAAATGAAGCCGG + Intergenic
1130504159 15:84521881-84521903 AAATATTTCTCAAATGAAGCCGG - Intergenic
1130782982 15:87064651-87064673 ATATATGTACCAAGGCAGGCAGG + Intergenic
1133567632 16:7009784-7009806 TTATTTTTCACAAGGCAAGCAGG - Intronic
1134208770 16:12258871-12258893 GGAAATTTCCCAAGGGAGGCTGG - Intronic
1137769768 16:51006671-51006693 ATATAAAGCCCAAGGAAAGCGGG - Intergenic
1138739753 16:59294393-59294415 CAATATTTCACAAGGGAACCTGG + Intergenic
1140456664 16:75109721-75109743 AGATATTTCACATGTGAAGCGGG + Exonic
1142088479 16:88197476-88197498 ATGTCTTTCCCAAGGGAATGTGG + Intergenic
1146823193 17:36000894-36000916 TTACATTTCCCAAGAGAAGGAGG - Intronic
1148056206 17:44797619-44797641 AGATATCTCCCATTGGAAGCAGG - Intergenic
1153521091 18:5954541-5954563 ATATATTTCCCAAGGGAAGCAGG - Intergenic
1157872747 18:51245699-51245721 ATAAATTTCCCGAGGGCAGATGG + Intergenic
1158089941 18:53699112-53699134 TTACATTCCCCAGGGGAAGCAGG - Intergenic
1158304016 18:56084583-56084605 ATATCTACCCCAAGGGATGCTGG + Intergenic
1159470595 18:68850446-68850468 ATATATTTCCCAAAGAAATTGGG + Intronic
1159646894 18:70929835-70929857 ATATAATTCCCACCAGAAGCCGG + Intergenic
1160364335 18:78311633-78311655 CTCGGTTTCCCAAGGGAAGCGGG - Intergenic
1161021258 19:2012823-2012845 ATACATGTCCCAAGGTCAGCCGG + Intronic
1161511133 19:4671740-4671762 ATAAATTTCCTAACGCAAGCAGG - Intergenic
1162719904 19:12656210-12656232 ATAAATTTTCCTGGGGAAGCGGG + Intronic
1164400747 19:27900569-27900591 CTGTAATTCCCAAGGGAGGCAGG + Intergenic
1164563914 19:29312434-29312456 ATATATTTCCCATGGGGTCCAGG - Intergenic
1166238959 19:41476597-41476619 AGGTCTTTTCCAAGGGAAGCTGG + Intergenic
1202703096 1_KI270713v1_random:2966-2988 AAAAATTTCCCCTGGGAAGCAGG - Intergenic
927583314 2:24275140-24275162 ATAGATTTACCAAGGAAAGATGG + Intronic
927992540 2:27458255-27458277 ATCCAATTCCCCAGGGAAGCAGG + Intronic
928472709 2:31589998-31590020 ATACATGTCACCAGGGAAGCGGG - Intergenic
930691520 2:54370693-54370715 ATGCATGTCACAAGGGAAGCAGG - Intronic
932078995 2:68694345-68694367 ATATATTTCCCAGGGGGATTAGG + Intronic
936416375 2:112317747-112317769 ATATATTTCCCAAGGGAGAGTGG - Intronic
937321368 2:120962735-120962757 ACATATTTCCCATGAGAGGCGGG + Intronic
938599400 2:132821752-132821774 ATATAGTTCACCAGGGAAGTGGG - Intronic
939029480 2:137054512-137054534 ATATACATCCCCAGAGAAGCAGG - Intronic
939062791 2:137444233-137444255 ATACATTCACCAAGGCAAGCTGG + Intronic
940601135 2:155862079-155862101 ATATATTTCGGCAGGGGAGCTGG + Intergenic
942435428 2:175968324-175968346 ACAGATTTCCCAAGGAATGCTGG + Intronic
943793852 2:191967480-191967502 CTATTTTTCACAAGGGAAGGAGG - Intronic
946662074 2:222012165-222012187 ATATATATCCAAAGGAAACCAGG - Intergenic
946729987 2:222699792-222699814 AAATATCTCCCAACAGAAGCTGG - Intronic
1168894497 20:1313752-1313774 CTTCATTTCCCAAGGGAAACTGG + Intronic
1170366485 20:15603617-15603639 AAATATTTCATAAGGGATGCAGG + Intronic
1170414175 20:16122381-16122403 CTCTATTTCCTAAGAGAAGCAGG + Intergenic
1170522186 20:17198283-17198305 ACATATTTTCGGAGGGAAGCAGG - Intergenic
1170637263 20:18118324-18118346 ATATATTTACCATGAGAACCTGG + Intergenic
1172361411 20:34315222-34315244 ATAATTTTCTCAAGAGAAGCTGG - Intergenic
1176150813 20:63589847-63589869 ATATATTTCCCAAGAAAAAAGGG + Exonic
1177584802 21:23077021-23077043 ATATATGGCCAAAGGGAAGGAGG + Intergenic
1178144142 21:29718439-29718461 ATGTATTTTCCAAGGAAACCAGG - Intronic
1180606881 22:17065681-17065703 AAATATTTCCCCAGAGAATCAGG + Intergenic
1183178704 22:36244119-36244141 ATATAGTTCGCCAGGGAAGTGGG + Intergenic
1183893090 22:40947098-40947120 ACATTTTTCCCAACAGAAGCTGG - Intergenic
949459605 3:4276101-4276123 ATAAATTTCCCCAGGGAAGATGG - Intronic
950023394 3:9804776-9804798 AATTAAATCCCAAGGGAAGCGGG - Intronic
954298730 3:49688068-49688090 AAAAATTTCCCCTGGGAAGCAGG + Intronic
955441747 3:58963515-58963537 TTATCTTTCCCAAGGGTAGTAGG - Intronic
957894479 3:86403534-86403556 ATATATTTCTCCAGTGAAACTGG - Intergenic
960554042 3:119007904-119007926 ATATATTTTCTGAGGGAAGAAGG - Intronic
960743977 3:120865914-120865936 AGATATGTGCCAATGGAAGCAGG + Intergenic
963885431 3:150576692-150576714 ATGTATTTACTAAGAGAAGCTGG + Intronic
964390146 3:156188164-156188186 ATAAACTTACCAAGGGAAGCTGG - Intronic
964707926 3:159640458-159640480 CCTTATTTCTCAAGGGAAGCAGG + Intronic
965615399 3:170586861-170586883 ATAAATTTCACAAGGCAAGAAGG + Intronic
965832574 3:172810082-172810104 ATATATTGCCTAAGATAAGCTGG + Intronic
966296900 3:178434426-178434448 TTGTATTTCCCAACGGAAGCAGG + Intronic
966502150 3:180655261-180655283 ATATTTTTCACATGGAAAGCGGG + Intronic
966557201 3:181276030-181276052 ATATAGTTCATAAGGGAAGGAGG - Intergenic
967833240 3:193940357-193940379 ACATATTTCCCAAAGGAAAATGG + Intergenic
968507835 4:979984-980006 TTACATTTCCCAAGAGAAGGGGG + Intronic
970369751 4:15395022-15395044 TTATATTTCCCAAGAGGAGGGGG + Intronic
975635114 4:76440604-76440626 ATATATTTGCCAAGAACAGCAGG - Intronic
976191920 4:82495614-82495636 ATATATAGACCAAGGAAAGCTGG - Intronic
976918128 4:90404198-90404220 ATATAATTTGCCAGGGAAGCTGG - Intronic
977762734 4:100759076-100759098 ATATAGTTCACCAGGGAAGTGGG - Intronic
978741420 4:112142417-112142439 TTATATTTCCCATGGGAAACTGG + Intergenic
979674222 4:123393893-123393915 CTATACTTCCCAAGAAAAGCTGG - Intergenic
980239523 4:130155688-130155710 ATATATTTCCTAACTGTAGCAGG - Intergenic
980317836 4:131227546-131227568 ACATATTTCCCATTGGAGGCAGG - Intergenic
980410237 4:132408110-132408132 AAACATTACCCAAAGGAAGCTGG - Intergenic
980496245 4:133589804-133589826 ATTTTTCTCCCAGGGGAAGCTGG + Intergenic
982436932 4:155390489-155390511 AAATATTTACAAAGAGAAGCTGG + Intergenic
982705732 4:158706971-158706993 GTATGTTTCCTAAAGGAAGCTGG - Intronic
984744568 4:183201943-183201965 TTATAGTTCTCAAGGGAAGGGGG + Intronic
986447519 5:7835576-7835598 AGTTCTTTCCCAAGGGAGGCTGG + Intronic
986565129 5:9105296-9105318 AGAAATTTCACAAGTGAAGCTGG + Intronic
986617906 5:9638880-9638902 ATATAGTTCACCAGGGAAGTGGG + Intronic
989365176 5:40647841-40647863 AGAGATATCCCAAGGGAAGGTGG - Intergenic
991023623 5:62007091-62007113 ATTTATTTCCCCAGGCAGGCTGG + Intergenic
993855021 5:93063673-93063695 ATAGATTTCCCCAGAGAAACTGG - Intergenic
993908790 5:93654930-93654952 AGATATTTTCAAAGGGAACCAGG - Intronic
1002099258 5:176849270-176849292 TTTTTTTCCCCAAGGGAAGCTGG - Intronic
1005668538 6:28081378-28081400 TTACTCTTCCCAAGGGAAGCAGG - Exonic
1008338420 6:50335026-50335048 AATTATTTCCCAAGAAAAGCTGG + Intergenic
1010729729 6:79378117-79378139 AAATATTGTCCAAGGGAAGCTGG - Intergenic
1014571676 6:123016475-123016497 AAATATGTCTCAAGGGCAGCAGG - Intronic
1018560046 6:165092796-165092818 ATAAATTTCCTAAGAGAAACAGG + Intergenic
1021113294 7:16720635-16720657 ATACATTTCACGTGGGAAGCGGG - Intergenic
1023082325 7:36537131-36537153 ATTTATTTCCCATGGCAACCAGG + Intronic
1024220292 7:47281784-47281806 ACATATCTTCCAAGGGCAGCAGG + Intronic
1024286166 7:47759465-47759487 TTATATTTACCAAGGAAAGGAGG + Intronic
1027851487 7:83458022-83458044 ATATATGTCACAAGAGAAACTGG - Intronic
1028630523 7:92928852-92928874 TTCTATTTCACAAGGGATGCTGG + Intergenic
1032480324 7:132240852-132240874 ATATATTTCTTAAGGGAATTTGG + Intronic
1033463350 7:141567685-141567707 ATAATCTTCCCCAGGGAAGCTGG - Intronic
1037323691 8:17667776-17667798 AGTAACTTCCCAAGGGAAGCTGG - Intronic
1037376429 8:18235025-18235047 ACACATTTCCCAAGTGATGCAGG + Intergenic
1038153247 8:24961307-24961329 ACATATTTCCCAAGAGATGAAGG - Intergenic
1039113493 8:34066026-34066048 ATATATTTCCTAAGAGAAACTGG - Intergenic
1039694160 8:39892688-39892710 ATACATTTCCCAAGGAAGGAAGG + Intergenic
1043537836 8:81225942-81225964 ATATAGTTCACTAGGGAAGTAGG + Intergenic
1044028309 8:87202062-87202084 ATATATAAGCCAAGAGAAGCTGG + Intronic
1045605113 8:103764144-103764166 AAATTTTTCACAAGGTAAGCAGG - Intronic
1045758246 8:105571317-105571339 ATAGATTTCCCTAGAGAGGCAGG - Intronic
1046093943 8:109536041-109536063 ATATATTAACAAAGGGAAACAGG - Intergenic
1048279871 8:133097255-133097277 ATATATTACCCAAAGGAAACAGG - Intronic
1049829883 8:144693698-144693720 ATTTGTTTCCCAATGAAAGCAGG + Intergenic
1050615575 9:7398487-7398509 ATGTATTTCCCCATGGAAACAGG - Intergenic
1052866199 9:33466031-33466053 AGATATGTCCCCAGGGAAGGGGG - Intronic
1053319337 9:37081119-37081141 ATATATATCCCAAGAAGAGCTGG + Intergenic
1053323650 9:37121759-37121781 ATATATATCCCAAGAAGAGCTGG + Intronic
1055994172 9:82139675-82139697 CTCTATTTCCTAAAGGAAGCAGG - Intergenic
1056549609 9:87641186-87641208 TCAGATTTCCCAAGAGAAGCTGG - Intronic
1059901526 9:118932640-118932662 ATATAATTCCCAAGTGAAACAGG - Intergenic
1059980628 9:119767784-119767806 ATTTATTCCCCAAGGAAAACAGG - Intergenic
1060433206 9:123568754-123568776 AGATATCTCCCAAGGGGATCCGG + Intronic
1061839451 9:133349075-133349097 ATGTTTTTCTCAAGGGAAGGTGG + Intronic
1186136900 X:6531116-6531138 ATATCTTTCCAAAGGGAAATTGG - Intergenic
1186325271 X:8469835-8469857 ATATCTTTCCAAAGGGAAATTGG + Intergenic
1189639347 X:43050994-43051016 ATATAGTTCACCAGGGAAGTGGG + Intergenic
1190946378 X:55097962-55097984 ATATATTCCACAATGGAAACTGG - Intronic
1192328014 X:70149840-70149862 ATATGTTTCCCTAGGGTGGCGGG + Intronic
1193169253 X:78316611-78316633 ATATAGTTCACAAGAGAAGTGGG - Intronic
1193924072 X:87464269-87464291 GTATAGTTCACCAGGGAAGCGGG - Intergenic
1195323416 X:103739336-103739358 AAATATTTGTCTAGGGAAGCAGG + Intergenic
1196639901 X:118046719-118046741 ATATATTCCCCATGAGAAGGTGG + Intronic
1202014974 Y:20394767-20394789 ATATATTTTTCAAGAAAAGCTGG + Intergenic