ID: 1153521954

View in Genome Browser
Species Human (GRCh38)
Location 18:5962163-5962185
Sequence CATGCTAACACCCTTGAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 105}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153521953_1153521954 -5 Left 1153521953 18:5962145-5962167 CCACAACATGTGTTCAAACATGC 0: 1
1: 0
2: 0
3: 11
4: 150
Right 1153521954 18:5962163-5962185 CATGCTAACACCCTTGAGAGAGG 0: 1
1: 0
2: 1
3: 5
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153521954 Original CRISPR CATGCTAACACCCTTGAGAG AGG Intronic
900485548 1:2921007-2921029 CATGCTGCCACCCCTGAGTGTGG + Intergenic
900767364 1:4514233-4514255 CATGGGAACACCCTTAATAGAGG - Intergenic
911238842 1:95442271-95442293 CTTGCTAAGTCCCTAGAGAGAGG + Intergenic
912502179 1:110129954-110129976 CATGCACACACTCCTGAGAGTGG - Intergenic
921374932 1:214463986-214464008 CATGCTATCACTCTTTAGAAGGG - Intronic
923023457 1:230185707-230185729 CATGCTTACAACAGTGAGAGGGG - Intronic
923148739 1:231215710-231215732 AATGCTGACTCCCTTGAGAAAGG - Exonic
923460970 1:234209107-234209129 CATGCTAACACCCTCAAAAGAGG + Intronic
1064565776 10:16637398-16637420 CATCCTGACTCCCTTAAGAGTGG + Intronic
1064867085 10:19893080-19893102 TATGCTAACCCCCTTGAAACAGG - Intronic
1066003725 10:31128330-31128352 CATGTTAACACCCACAAGAGAGG - Intergenic
1067372549 10:45698984-45699006 CATGCTGACACCATCGGGAGCGG + Intergenic
1067387230 10:45827140-45827162 CATGCTGACACCATCGGGAGCGG - Exonic
1067418899 10:46130111-46130133 CATGCTGACACCATCGGGAGCGG + Intergenic
1067504251 10:46836700-46836722 CATGCTGACACCATCGGGAGCGG + Intergenic
1067590335 10:47503293-47503315 CATGCTGACACCATCGGGAGCGG - Exonic
1067637457 10:48011395-48011417 CATGCTGACACCATCGGGAGCGG - Intergenic
1067876033 10:50008939-50008961 CATGCTGACACCATCGGGAGCGG + Exonic
1067893777 10:50158274-50158296 CATTCTTAAACCCTTGAGTGTGG + Intergenic
1067955069 10:50781994-50782016 CATTCTTAAACCCTTGAGTGTGG - Intronic
1070134054 10:73675824-73675846 CATGCTGACACCATCGGGAGCGG - Exonic
1071881880 10:89908221-89908243 CATGCCAATACTCTTGAGAAAGG - Intergenic
1081179716 11:39970338-39970360 AATGCTAAAAACCTTGACAGGGG - Intergenic
1084668280 11:70589206-70589228 CAGGCTGACTCCCTTGTGAGGGG + Intronic
1086504656 11:87492763-87492785 CATACTAACACTATTGAGAGAGG + Intergenic
1089317444 11:117601592-117601614 AATGCAAATACCCCTGAGAGAGG + Intronic
1090256876 11:125290796-125290818 TGTGGTAACAGCCTTGAGAGTGG + Intronic
1091640351 12:2231472-2231494 CCTGCTAACCCTTTTGAGAGTGG + Intronic
1092618587 12:10237788-10237810 CATGCTCCGCCCCTTGAGAGAGG - Intergenic
1097670069 12:62525552-62525574 CATGTTAACCCCTTTAAGAGAGG - Intronic
1100422932 12:94455270-94455292 AATGCAATCACACTTGAGAGAGG + Intronic
1102896805 12:116604760-116604782 CAAGCCTGCACCCTTGAGAGTGG + Intergenic
1104367753 12:128193225-128193247 GATGCTGACACCCCTGAGTGTGG + Intergenic
1104520695 12:129472218-129472240 CATGCTGACTCCCTTGTTAGGGG + Intronic
1109421055 13:62113225-62113247 CATACAAACACTCTAGAGAGTGG - Intergenic
1110500393 13:76220966-76220988 CAAGCTAACACGCTTTAGAAAGG + Intergenic
1115899005 14:38124482-38124504 AATGCCAACAACCTTGAGAATGG - Intergenic
1118779545 14:68997990-68998012 CATCATAAGTCCCTTGAGAGAGG + Intergenic
1119183715 14:72621526-72621548 CATGCTAAAACCCGTCAGTGGGG + Intronic
1124661074 15:31551460-31551482 CAGGTGAACACCATTGAGAGAGG + Intronic
1128078487 15:64842528-64842550 CATGGTCACATCCTTGAGACAGG - Intronic
1128901506 15:71426626-71426648 CATGATTTCACCCTTGAAAGAGG + Intronic
1131876312 15:96810227-96810249 CATTCTAACACAGTTGAGAAGGG - Intergenic
1138518299 16:57552234-57552256 CAGGCTAACTCCCTTGTTAGCGG - Intronic
1145122032 17:20268872-20268894 CATGCACACACCACTGAGAGTGG - Intronic
1152973021 18:183919-183941 CTGGCTAGCACCCTTGGGAGTGG + Intronic
1153521954 18:5962163-5962185 CATGCTAACACCCTTGAGAGAGG + Intronic
1153852893 18:9112979-9113001 CATTCTAACACCTCTGAAAGTGG + Intronic
1154317507 18:13316638-13316660 GATGGTAACAGCCTTGAGGGTGG + Intronic
1156411626 18:36834008-36834030 CAGGGTAACCCACTTGAGAGTGG + Intronic
1156946850 18:42844072-42844094 CATGCTCAACCCCTTGTGAGAGG + Intronic
1159094367 18:63885862-63885884 CATGCTAAAACTCTCTAGAGAGG - Intronic
1159656920 18:71041010-71041032 CAGGCTAACACTCTTGCTAGGGG + Intergenic
1161726321 19:5931351-5931373 CATGCTAGGCCCCTTGGGAGCGG - Intronic
1162157125 19:8685902-8685924 TCTGCTCAAACCCTTGAGAGAGG + Intergenic
1163515972 19:17764012-17764034 CTTTCAGACACCCTTGAGAGAGG - Intronic
1164049209 19:21569448-21569470 CATGCAAACACCCTCTAGGGTGG - Intergenic
926967689 2:18433196-18433218 CAGGCCAACCTCCTTGAGAGCGG + Intergenic
926983738 2:18598708-18598730 CATGCTCACCTCCTTGAGACAGG + Intergenic
929861325 2:45680362-45680384 CATTCTCACACCCTGCAGAGGGG - Intronic
938565112 2:132512075-132512097 CAGCCTAACACCCTTGGAAGAGG - Intronic
940118017 2:150231459-150231481 CATAGCAAGACCCTTGAGAGAGG - Intergenic
940910101 2:159202994-159203016 CAGGCTCACACACTTGAGTGTGG - Intronic
943353193 2:186819823-186819845 TATGGTAACATCCCTGAGAGGGG - Intergenic
947043428 2:225949855-225949877 CATGCTCAGGCCCTTGGGAGGGG - Intergenic
1172912611 20:38421155-38421177 CAAGCTGACACCACTGAGAGGGG + Intergenic
1177769778 21:25501592-25501614 CATGTTAACATATTTGAGAGAGG + Intergenic
1182235738 22:28874973-28874995 AATGGTAACACCCTTGGGAGTGG - Intergenic
1183234090 22:36603562-36603584 CAGGCTAACTCTCTTGATAGGGG + Intronic
1185213553 22:49585865-49585887 GATGCAAACACCCTTGAGAGGGG + Intronic
949371469 3:3339117-3339139 CATGCTAACACCTGGCAGAGTGG + Intergenic
950500278 3:13359248-13359270 CATTCTTACAGCCCTGAGAGGGG + Intronic
952700206 3:36319725-36319747 AATGCACACACCCTAGAGAGGGG - Intergenic
953491807 3:43359357-43359379 AATGCTCTCACCCTTGAGAATGG + Intronic
953500216 3:43425940-43425962 GATGGTAGCACCCTTCAGAGGGG - Intronic
956447481 3:69339843-69339865 CATGCAAAGTCCCCTGAGAGGGG + Intronic
958433711 3:94072396-94072418 CATCACAACAACCTTGAGAGAGG - Intronic
958579863 3:96004364-96004386 CAGGATAACACCATAGAGAGGGG + Intergenic
960261972 3:115578484-115578506 CATTCTAAAACTCTGGAGAGAGG - Intergenic
961918953 3:130405909-130405931 CATGCTCACTCACTTTAGAGAGG + Intronic
962670136 3:137696610-137696632 CATGCCAAGACCCTTGAAAAGGG + Intergenic
963116205 3:141731542-141731564 GATCCTAAGACCCTGGAGAGTGG - Intergenic
963623728 3:147644995-147645017 GATGCCAACACCCTTGTGACTGG + Intergenic
969370274 4:6727485-6727507 GCTGCTCACTCCCTTGAGAGAGG + Intergenic
982565110 4:156976152-156976174 CATGCTAACAGCCTCGAAAGAGG + Intergenic
983336937 4:166407814-166407836 CATGGTAAAACCCTTGGGACAGG + Intergenic
983389395 4:167110019-167110041 CAAGCAAATACCCTAGAGAGAGG - Intronic
985929512 5:3046140-3046162 CATTCTAACAGCCTTCAGTGTGG + Intergenic
990632249 5:57683295-57683317 CATGCTGACTCTCTTGAGGGCGG - Intergenic
1006735719 6:36271054-36271076 AATGCAAATACCCTTGGGAGAGG + Intronic
1007388979 6:41538958-41538980 CTGCCTAACAACCTTGAGAGAGG + Intergenic
1013590477 6:111615631-111615653 CATGCAAGCACCCCTCAGAGAGG - Intergenic
1018018066 6:159730082-159730104 CATGTTACCACCCTTTTGAGGGG + Intronic
1022527268 7:31046409-31046431 TCTGCTAACAACCTTGGGAGGGG + Intergenic
1024173896 7:46818791-46818813 CATGGGAAGACCCTGGAGAGTGG + Intergenic
1024185615 7:46945579-46945601 CCTGGTCACACCCTGGAGAGGGG + Intergenic
1026654619 7:72246306-72246328 AATGCTGACACCATTGTGAGGGG + Intronic
1027846338 7:83381348-83381370 GATGCTAAGACTCTTGAGATAGG - Intronic
1029839309 7:103345255-103345277 CAATCTAACACACTAGAGAGAGG - Intronic
1030796904 7:113800060-113800082 CATGCTAACACCCCAAAGTGCGG - Intergenic
1037924963 8:22837161-22837183 CTTTCTGACACCCTTGAGCGAGG + Intronic
1038535141 8:28348397-28348419 CAAGCTAATCCCCTAGAGAGTGG + Exonic
1042501922 8:69517836-69517858 CATGCTAACACTGATGAAAGAGG + Intronic
1048474200 8:134728543-134728565 CATGCTCACACCCTCCAGAGTGG - Intergenic
1049314253 8:141952012-141952034 CAGGCTGACTCCCTTGTGAGGGG + Intergenic
1050237628 9:3598102-3598124 CATGCTTAGCCCCTTGTGAGAGG - Intergenic
1055250414 9:74296746-74296768 CAAGCAAACACACGTGAGAGGGG + Intergenic
1056329906 9:85512447-85512469 ACTGCTGACACCCTTGACAGGGG + Intergenic
1061643534 9:131979794-131979816 CATGCTAACTCCTTGTAGAGTGG + Intronic
1189792701 X:44618986-44619008 CATTCTAAGACACTGGAGAGAGG - Intergenic
1191676487 X:63796994-63797016 AATGCAAACAGCCTTGAAAGAGG + Intergenic
1199529773 X:148833237-148833259 CATGCGAATCACCTTGAGAGGGG - Intronic