ID: 1153522159

View in Genome Browser
Species Human (GRCh38)
Location 18:5963441-5963463
Sequence GGTGGAGGCCACCACGGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 318
Summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 287}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153522159_1153522172 23 Left 1153522159 18:5963441-5963463 CCTGCCCCGTGGTGGCCTCCACC 0: 1
1: 0
2: 3
3: 27
4: 287
Right 1153522172 18:5963487-5963509 CCTCCACCTCATCCTCCACCTGG 0: 1
1: 0
2: 15
3: 118
4: 717

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153522159 Original CRISPR GGTGGAGGCCACCACGGGGC AGG (reversed) Intronic
900213533 1:1468779-1468801 GGTGGCTGCCACGGCGGGGCCGG + Exonic
900245452 1:1634208-1634230 GGTGGTGGCCACCGTGGGGAAGG - Exonic
900256683 1:1701367-1701389 GGTGGTGGCCACCGTGGGGAAGG - Intronic
900327161 1:2113975-2113997 GGTCAAGGGCTCCACGGGGCTGG + Intronic
900556929 1:3285246-3285268 GGCAGGGGCCTCCACGGGGCTGG - Intronic
900634876 1:3658061-3658083 ACTGGAGGCCACCACTGGGACGG - Intronic
901506737 1:9689841-9689863 GGTGGAGGCGATCAGGGGTCCGG + Intronic
902392097 1:16112796-16112818 AGAGGAGCCCACCACAGGGCTGG + Intergenic
903360339 1:22773043-22773065 GGTGGAGGCCACCTAGGGGCAGG - Intronic
904006234 1:27364733-27364755 GGTGGAGGCAGGCACAGGGCTGG - Intronic
905416463 1:37807923-37807945 GGGGACGGCCACCACGGCGCCGG + Exonic
906683038 1:47743528-47743550 GGTGGTGGCCATGACGGGGGTGG + Intergenic
908492353 1:64658830-64658852 AGTGGAGGCAAGCACTGGGCTGG - Exonic
910657406 1:89632986-89633008 GGCGGTGGCGACCCCGGGGCCGG + Intergenic
911950919 1:104172608-104172630 GCGGGAGCCCACCACGGGGTGGG - Intergenic
912948422 1:114104042-114104064 GGAAGAGGCCACAAAGGGGCTGG - Intronic
914702844 1:150150006-150150028 GATGGAGGGCGCCAAGGGGCGGG + Exonic
914899658 1:151705002-151705024 GAGGGAGGCCACAACGGAGCGGG + Intronic
915625068 1:157109429-157109451 GGTGGAGGTGAGCAAGGGGCAGG - Intergenic
915735669 1:158083349-158083371 GGTGGGGGCCACCATGGTGGGGG + Intronic
920496863 1:206461149-206461171 CGTGGGGGCCACCACTGGGGAGG - Exonic
924606621 1:245540923-245540945 GGTGAAGGACACCCCGGGGCTGG + Exonic
1064192808 10:13222281-13222303 AGTGCAGGTCACCACAGGGCAGG - Intronic
1067037051 10:42928348-42928370 AGAGGAGGGCAGCACGGGGCAGG - Intergenic
1067480834 10:46596657-46596679 GAAGGAGGTCACCAAGGGGCAGG - Intergenic
1067613905 10:47745144-47745166 GAAGGAGGTCACCAAGGGGCAGG + Intergenic
1071352630 10:84762364-84762386 GGTGGAGCCCACCACAGTTCAGG - Intergenic
1071459322 10:85877117-85877139 GGTGGAGCCCACCACAGCTCAGG + Intronic
1071527340 10:86366260-86366282 GGCGGGGGCCCCAACGGGGCAGG - Intronic
1071602392 10:86964714-86964736 GGAGGAGGCCACCTGGGGCCTGG + Intronic
1071629311 10:87205121-87205143 GAAGGAGGTCACCAAGGGGCAGG + Intergenic
1073321620 10:102619490-102619512 AGTGTGGTCCACCACGGGGCCGG + Intronic
1076139112 10:128065383-128065405 GATGGAGGACACCACCGGGCAGG + Intronic
1076236289 10:128865676-128865698 GGTGGCGTCTACCCCGGGGCTGG + Intergenic
1076554367 10:131311989-131312011 GCCAGAGGCCACCAGGGGGCCGG - Intergenic
1076610580 10:131723537-131723559 GGTGGGGGCCACCACCAGGTGGG - Intergenic
1076852966 10:133102158-133102180 GGATGAGCCCCCCACGGGGCCGG - Intronic
1078546171 11:12248549-12248571 GGTGGGGGCCTTCACTGGGCTGG + Intronic
1080576729 11:33606758-33606780 GGTGGGGGGCACCATGGGGAGGG - Exonic
1083459255 11:62799830-62799852 GGTTGAGGCCTCCTAGGGGCTGG - Intronic
1083829265 11:65221002-65221024 AGTGGATGCCCACACGGGGCCGG + Intergenic
1084557911 11:69885769-69885791 GGGGGAGGCCACTCCGGGACAGG + Intergenic
1084640439 11:70422884-70422906 GGTGGAGGCGAGCATGGGGGTGG - Intronic
1084658972 11:70536096-70536118 GGTGAGGGCCCCCAGGGGGCAGG - Intronic
1084731177 11:71074672-71074694 GGTGAGGGCCACTAAGGGGCAGG + Intronic
1085162453 11:74360913-74360935 GGTGGAGCCCACCACTGCTCAGG + Intronic
1088457818 11:110050565-110050587 GGTGGGGGCCACCACGCATCAGG - Intergenic
1088579205 11:111299572-111299594 GGTAGGGGCCGCCCCGGGGCTGG - Exonic
1089053704 11:115567062-115567084 GGTGGAGGGTCCCACGGGCCGGG + Intergenic
1090085352 11:123645625-123645647 GGTGGAGGCCACCACGGTGGTGG - Exonic
1202828158 11_KI270721v1_random:99791-99813 GGTGGAGCTCGCCACGGGGGGGG + Intergenic
1097435537 12:59549082-59549104 GGTGGAGCCCACCACAGGGCAGG - Intergenic
1099806914 12:87531456-87531478 GGTGGAGCCCACCACAGCTCAGG + Intergenic
1101326717 12:103722159-103722181 GGTAGAGGCAAAGACGGGGCAGG + Intronic
1101646320 12:106633921-106633943 GGAGGAGGCCACCAAGGGAGAGG - Intronic
1102470828 12:113158978-113159000 GCTTGAGGCCACCACGCTGCAGG + Exonic
1103085721 12:118060950-118060972 GGGGGAGGCGACCCCGGGGCGGG - Intronic
1104759205 12:131287036-131287058 GGTGGAGGCCAGGGAGGGGCAGG - Intergenic
1104821406 12:131679460-131679482 GGTGGAGGCCAGGGAGGGGCAGG + Intergenic
1105214904 13:18278337-18278359 GGTGGGTGCCCCCACAGGGCTGG + Intergenic
1109073809 13:57806588-57806610 GGTGGAAGCCATCACTGGACTGG - Intergenic
1109829919 13:67773020-67773042 GCGGGAGCCCACCGCGGGGCGGG + Intergenic
1111220949 13:85205192-85205214 GCGGGAGCCCACCACGGGGCGGG - Intergenic
1111783003 13:92752975-92752997 GGTGGAGCCCACCACAGCTCAGG + Intronic
1113483881 13:110640809-110640831 GGTGGCGGCCAGCACACGGCAGG - Intergenic
1117414696 14:55484047-55484069 GGTGGAGGACAGCACAGGGTCGG + Intergenic
1117721418 14:58632143-58632165 CTTGGAGGCCAACACGGGCCAGG + Intergenic
1118185554 14:63534504-63534526 GGGGGAGGCCGACAGGGGGCGGG - Intronic
1119329362 14:73782742-73782764 GGTGTAGGGCATCACAGGGCAGG + Intronic
1121097061 14:91224806-91224828 GGTGGACGTCACCACGGCACAGG + Exonic
1121145431 14:91578253-91578275 GCCGGAGCCCACCATGGGGCGGG - Intergenic
1122569207 14:102683493-102683515 CGTGGAGGCCACCTGGGCGCAGG + Intronic
1122781779 14:104146819-104146841 CGTGGAGACCGCCACGGGGCAGG + Intronic
1123068905 14:105631545-105631567 GATGGAGGCCTCGGCGGGGCTGG + Intergenic
1123877736 15:24640729-24640751 GGTTGAGCCCACCATGGTGCTGG + Intergenic
1124567898 15:30833328-30833350 GGTGGAGGCAGCCACGTGTCCGG + Intergenic
1124830608 15:33145595-33145617 GGTAGCGGCTACCACGGGGAGGG - Intronic
1126787183 15:52186789-52186811 TGTGGAGCCCACCCTGGGGCTGG + Intronic
1128160651 15:65421443-65421465 GCTGGAGGCCGCCGCGAGGCTGG - Intronic
1128555275 15:68627527-68627549 GGTGGAGGTAACCACGTGCCTGG + Intronic
1128742940 15:70096130-70096152 GGTGGGGGCCGCCCCGGGGCTGG - Intronic
1129167008 15:73784437-73784459 GGTGGGGGCCAGCCCTGGGCTGG + Intergenic
1131151212 15:90048521-90048543 GGTCGGGGCCAGCACGGGGCAGG + Intronic
1131622185 15:94080090-94080112 GGTGGAAGCCAGCCCTGGGCAGG + Intergenic
1132584626 16:700827-700849 GGTGGAAGCCAGCCCGGGCCTGG - Intronic
1132651683 16:1024068-1024090 GGTGGGGGCCAGCCCGGGGCAGG - Intergenic
1132939914 16:2501481-2501503 GGTGGGGTCCGCCAGGGGGCAGG - Exonic
1133110621 16:3545974-3545996 GGTGGAGGCTACCACAGGGATGG + Intronic
1134222051 16:12362612-12362634 GGTGGGGGGCAGCACAGGGCAGG - Intronic
1134530003 16:14975446-14975468 GGTGGGGGCCGCGACGGGCCCGG + Intronic
1135420408 16:22302074-22302096 GCTGTAGGTCTCCACGGGGCAGG - Intronic
1137666472 16:50252421-50252443 GGTGGAGGCAGCCACTGGGTAGG + Intronic
1137808553 16:51330310-51330332 GGTGGAGCCCACCACAGCTCAGG + Intergenic
1138418051 16:56882523-56882545 GGAGGAGGCACCCAGGGGGCAGG + Intronic
1138554667 16:57764529-57764551 GGTGGAGGCCAGCACATGCCTGG + Intronic
1139593679 16:67946561-67946583 GGTGGTGGCCAGCAAGGTGCGGG - Exonic
1141760154 16:86022866-86022888 GATGCAGGCCACCACCTGGCTGG - Intergenic
1143007459 17:3846166-3846188 GGCGGAGGCCCCGGCGGGGCCGG - Exonic
1143114667 17:4575865-4575887 GGAGGAGGGCACCACGAGGCCGG - Intergenic
1143479653 17:7220962-7220984 GGTGGAGGAGACCACTTGGCAGG + Exonic
1144480012 17:15621479-15621501 GGTGCAGGCCAGCAGGAGGCAGG - Intronic
1144673093 17:17143912-17143934 GGAGGAGGCCACCTCGGGCTAGG + Intronic
1144918291 17:18742267-18742289 GGTGCAGGCCAGCAGGAGGCAGG + Intergenic
1144955119 17:19015207-19015229 GGTGGGGGCCAGTACGGGGGTGG + Intronic
1145275791 17:21429444-21429466 CGTGGAGGCCACCATGGGTGAGG + Intergenic
1145900452 17:28487608-28487630 GGTGGAGGACACCAGGGTCCAGG + Intronic
1146163349 17:30571414-30571436 GGAGGAGGCCAACACTGAGCTGG - Intergenic
1146940966 17:36844287-36844309 GATGGAGGCCACCAGGAGGTGGG - Intergenic
1147448393 17:40488853-40488875 GGAGGAGGCCACCACTGCGAAGG + Exonic
1147580322 17:41624173-41624195 GGAGGAGGCCAACACTGAGCTGG - Exonic
1151662437 17:75525857-75525879 GGTGGAAGCCCCGAGGGGGCGGG - Intronic
1152049051 17:77958626-77958648 GTTGGAGGCCAACGCGGGGCGGG + Intergenic
1152409934 17:80118124-80118146 GGTGGAGGCCTCCAGGGCCCGGG - Intergenic
1152459154 17:80432276-80432298 GGTGGAGTCCAGCACCTGGCTGG + Intronic
1152472412 17:80497388-80497410 GCTGGAGGCCTCCAAGGTGCTGG + Intergenic
1152596294 17:81239329-81239351 GATGGCGGCCTCCAGGGGGCTGG + Exonic
1152772631 17:82179609-82179631 GGTGGACCCAGCCACGGGGCGGG + Intronic
1153237311 18:3000424-3000446 GGTGGAGCCCACAACAGTGCAGG - Intronic
1153522159 18:5963441-5963463 GGTGGAGGCCACCACGGGGCAGG - Intronic
1154300008 18:13184596-13184618 GGCGGAGGCCACCATGGAGATGG - Intergenic
1155072332 18:22327475-22327497 GGTGGAGGCCATTACGGAGAGGG - Intergenic
1155819925 18:30362209-30362231 GCTGGAGTCCACCACGGGAGTGG + Intergenic
1156513925 18:37663849-37663871 GGTGGAGGGCAACACCGGGAAGG - Intergenic
1156987035 18:43360826-43360848 GGTGGCAGCCACAACGGGACAGG + Intergenic
1157472908 18:48003441-48003463 GGAGGAGGGCCCCACAGGGCAGG - Intergenic
1158389653 18:57034642-57034664 GCTGGAGGGTACCACGTGGCAGG + Exonic
1159022499 18:63155167-63155189 GGTGGAGGTCGGCACAGGGCGGG + Intronic
1160306860 18:77747990-77748012 GTGGAAGGCCACCAAGGGGCAGG + Intergenic
1160596100 18:79975502-79975524 AGTGGAGGCCAGCCTGGGGCTGG - Intronic
1160662587 19:308085-308107 GGTGGAGACCCACACGGGGAGGG - Intronic
1161039165 19:2100823-2100845 GACCGAGGCCACCACGGGGTGGG + Intergenic
1161055423 19:2188504-2188526 GGTGCAGGCCCCCTCGGCGCTGG + Intronic
1161153376 19:2720901-2720923 GGAGGAGCCCACCCCGGGGAGGG + Intronic
1161219985 19:3114006-3114028 GGTGGAGGCCCCCGCGTGGCAGG + Intronic
1161514400 19:4688719-4688741 GGCGGAGGCCTCCGTGGGGCGGG + Intronic
1161610204 19:5238106-5238128 GGTGGAGGCCACACCAGGGAAGG + Intronic
1161628018 19:5338330-5338352 GGCGGTGGCCCCCAGGGGGCTGG + Intronic
1162780229 19:13002812-13002834 GGTGGTGGCCAGCAGTGGGCAGG + Intronic
1162805532 19:13136239-13136261 GGTGGAGGCCCTCCCGGAGCAGG + Exonic
1163664871 19:18598477-18598499 GGTGGAGGCCACCAACCGCCTGG - Exonic
1164157576 19:22605849-22605871 GGTGGCTGTCACCACGTGGCTGG - Intergenic
1164577896 19:29416893-29416915 CGGGGAGGCCAGCCCGGGGCTGG - Intergenic
1165089203 19:33373857-33373879 AGTGGAGGCCGCCTGGGGGCAGG + Exonic
1165300162 19:34963692-34963714 GGTGCGGGAAACCACGGGGCGGG + Exonic
1165389338 19:35529425-35529447 GGTTGAGGCAGCCACGGGGAGGG + Intergenic
1165845670 19:38816381-38816403 GGCGGCTGCCACCCCGGGGCTGG + Intronic
1166855513 19:45781059-45781081 GGTGGAGGCCAAGAAGGGCCAGG - Intronic
1166916567 19:46199424-46199446 GGTTGGGGACTCCACGGGGCTGG + Intergenic
1167216836 19:48170689-48170711 GGTGGACGCCGCTCCGGGGCGGG + Exonic
1167300171 19:48673335-48673357 GATGGCGGCCACCACAAGGCGGG - Intergenic
1168145999 19:54420478-54420500 GGTGGAGGCCCAGCCGGGGCTGG + Intronic
1168246944 19:55117253-55117275 GGTGGAGTCCAGCACGGCGCGGG + Exonic
925190780 2:1881692-1881714 GGAGGTGGCCACCACTGGGCGGG + Intronic
927090084 2:19704008-19704030 GGTGGAGGCAGACACAGGGCAGG - Intergenic
927213325 2:20651692-20651714 GGTGGAGGCCTCCCGGGGCCGGG + Intergenic
927464178 2:23324631-23324653 GGTGGCAGCCCCCACAGGGCAGG + Intergenic
928311393 2:30213445-30213467 GGTGGAGGTGGCCACAGGGCTGG + Intergenic
928691422 2:33803512-33803534 GGTGGAGGGCAACAGGGAGCTGG + Intergenic
928837842 2:35568681-35568703 GGTGGAGCCCACCACAGCTCAGG - Intergenic
929556899 2:42931264-42931286 GGTGGAAGTCACTGCGGGGCAGG + Intergenic
932343015 2:70978635-70978657 CGCGGAGGCCATCGCGGGGCTGG - Exonic
934299416 2:91768400-91768422 GGTGGGTGCCCCCACAGGGCTGG - Intergenic
936514575 2:113173775-113173797 GGTGGGGGCCTCCAAGGAGCAGG + Intronic
936600450 2:113890043-113890065 GGAGGAGGCCGCGGCGGGGCAGG + Exonic
937044068 2:118841852-118841874 GGAGGAGGCCGCCACTGGGCTGG + Intergenic
937368591 2:121282903-121282925 GGGGGAGGCCCACACAGGGCAGG - Intronic
937840691 2:126521380-126521402 TGTGGAGCCCACCACGTGCCAGG - Intergenic
938123782 2:128655784-128655806 GGTGGAGGCCACCTGGGAGGCGG - Intergenic
938419459 2:131132734-131132756 GGTGGGGGCCCCCACTGGACTGG + Intronic
945118859 2:206437839-206437861 GGTGGAGGGCAGCAGAGGGCAGG + Intergenic
945664192 2:212721149-212721171 GTGGGAGCCCACGACGGGGCGGG + Intergenic
946402488 2:219475895-219475917 GGGGGAGGCCATCCCGGGGGTGG - Intronic
946965263 2:225030483-225030505 GGTGGAGGCCACCCCGAGCAGGG - Intronic
947113988 2:226749593-226749615 GGAGGAGGCCACCATGGAGAAGG - Intronic
947563974 2:231181960-231181982 TGTCCAGGCCACCATGGGGCAGG - Intergenic
948667654 2:239546344-239546366 GCTAGTGGCCCCCACGGGGCAGG - Intergenic
1169405268 20:5316750-5316772 GGCGGAGTCCAGCGCGGGGCGGG - Intergenic
1170582716 20:17711237-17711259 GGGGGAGGCCATCTGGGGGCAGG - Intronic
1171355578 20:24543253-24543275 GGTGGGGGCCAGCACAGTGCCGG + Exonic
1171449788 20:25227214-25227236 GGTGGAGGCCTGCACAGAGCAGG + Intergenic
1172644891 20:36462817-36462839 TGTGGAGGGCACCACGGGCTGGG + Intronic
1172870804 20:38134478-38134500 GGTGGAGGCCAGGGCAGGGCTGG + Intronic
1173564615 20:44029950-44029972 GGTGGAGGACACCAGGAGCCTGG - Intronic
1174576680 20:51542344-51542366 GGTGGAGGCTACCCCTGGCCTGG - Intronic
1175264366 20:57693511-57693533 GGTGGCGGCCAGCAGGTGGCAGG + Intronic
1175862879 20:62159547-62159569 GGGGGAGGCCACGAGGAGGCAGG - Intronic
1176063487 20:63182422-63182444 GGTGGGGCCCAGCCCGGGGCTGG + Intergenic
1176414985 21:6468904-6468926 GCTGGCGGCCTCCACAGGGCTGG + Intergenic
1178488502 21:33033399-33033421 TGTGGAAGGCACAACGGGGCAGG - Intergenic
1178637538 21:34317917-34317939 GGTGGAGGCATCCATGGGGGAGG - Intergenic
1178741711 21:35207349-35207371 GGAGGAGACGACCCCGGGGCTGG + Intronic
1179690485 21:43077236-43077258 GCTGGCGGCCTCCACAGGGCTGG + Intergenic
1180162383 21:46003959-46003981 GGTGGAAGACACCGCGGAGCAGG - Exonic
1181026753 22:20131554-20131576 GGTGGTGGGCACCACGGCGAAGG - Intronic
1181066576 22:20309239-20309261 GGTGCAGGCGACCACAGGCCTGG + Intergenic
1181108940 22:20590316-20590338 GGTGGGGGCCACCATTGGGATGG + Intergenic
1182317718 22:29459068-29459090 GGAGGAGGCTACCAGGAGGCTGG - Intergenic
1182466566 22:30520465-30520487 GGTGGGGGCCACCACCAAGCTGG + Intergenic
1182549055 22:31091259-31091281 GGAGGAGGGCCCCAGGGGGCGGG + Exonic
1183315168 22:37133086-37133108 GGTGGAGGCCCTCAAGGGCCAGG + Intronic
1184288109 22:43483385-43483407 GGTGGAGCACGCCATGGGGCAGG - Intronic
1184334608 22:43845699-43845721 GGAGGAGGCGAGCACTGGGCGGG + Intronic
1184387734 22:44185924-44185946 GGCAGCGGCCTCCACGGGGCGGG + Intronic
1184748644 22:46471826-46471848 GCTGGAAGCCACCACGGTGCAGG - Intronic
950148283 3:10667140-10667162 GGTGGAGACCACCTCGGAGGTGG - Intronic
954521284 3:51228846-51228868 GGTGGAGGGCACCACCCTGCAGG - Intronic
954827965 3:53391631-53391653 GGTGGAGCCCACCACAGCTCAGG + Intergenic
957488825 3:80897152-80897174 GGTGGAGCCCACCACAGCTCAGG - Intergenic
959507742 3:107174849-107174871 TGTGGAAGCCACCAAGGGGTGGG + Intergenic
961715393 3:128853988-128854010 GGCAGAGGCCACCACTGGGCAGG - Intergenic
961811228 3:129523063-129523085 AGCAGAGGCCACCACTGGGCAGG + Intergenic
962407583 3:135113149-135113171 GGCGGGGGCCAGCATGGGGCGGG - Intronic
962751188 3:138435601-138435623 GGGGGAGGGCTCCGCGGGGCTGG + Intronic
965735068 3:171810617-171810639 GCTGGAGGCCCCAGCGGGGCAGG + Intronic
965796686 3:172447936-172447958 GGTGGTGGTCACCAAGGGGCGGG - Exonic
966008741 3:175050138-175050160 GGTGGAAACCACCACTGGACAGG - Intronic
967084153 3:186078971-186078993 TGTGGGGGCCACAATGGGGCGGG - Intronic
968090447 3:195895601-195895623 GGTGGGGGTCAGCCCGGGGCTGG - Intronic
968481750 4:836131-836153 GGGGGAGGCAGCCACGGGGGAGG + Intergenic
968746464 4:2362992-2363014 GGTTGAGGGGACCACGGGGATGG - Intronic
969875643 4:10133833-10133855 GGGGGATACCACCAAGGGGCAGG + Intergenic
971352011 4:25863174-25863196 GGTGGCGGCGGCCAAGGGGCGGG - Intronic
972511266 4:39770560-39770582 CGTGGGGGCCACCTCGGGCCTGG - Intronic
973704197 4:53565133-53565155 GGTGGAGCCCACCACAGCTCAGG + Intronic
974877594 4:67717284-67717306 GGTGGTGGCCACCATGGCGTGGG + Intergenic
975250185 4:72169404-72169426 GGTGGAGCCCACCACAGCTCAGG - Intergenic
977023930 4:91791536-91791558 GGTGGAGCCCACCACAGCTCAGG - Intergenic
977619164 4:99117301-99117323 GGTGGAGCCCACCACAGCTCAGG - Intergenic
978459485 4:108935296-108935318 GGTGGAGGCTACCTCTGGGATGG + Intronic
978600081 4:110418739-110418761 GGTGGAGGCCGCTGTGGGGCAGG + Intronic
982157387 4:152535766-152535788 GGAGGCGGCTACCACGGGCCGGG - Exonic
985517569 5:354774-354796 GGTGGGGGCCTCCCCTGGGCGGG + Intronic
985723095 5:1501018-1501040 GGGGGAGGCCACCATGGGCAGGG + Intronic
985728190 5:1526549-1526571 GGTGGAGACCACCACCCTGCAGG + Intergenic
986561031 5:9061070-9061092 GGTGAAATCCACCAAGGGGCTGG + Intronic
988263790 5:28926434-28926456 GGTGAAGGCCAAGAAGGGGCCGG + Intergenic
989828389 5:45886740-45886762 GGTGGAGCCCACCACAGCTCAGG - Intergenic
991555445 5:67890104-67890126 GGTGGAGCCCACCACAGCTCAGG + Intergenic
992627257 5:78647639-78647661 GGTGGAGGCGAGGACGGGGGTGG + Intronic
993446211 5:88015098-88015120 GGTGGAGCCCACCACAGCTCAGG - Intergenic
994670244 5:102755093-102755115 GGAGGAGGCGAGCGCGGGGCTGG + Intronic
995108221 5:108399175-108399197 GGTGGAGCCCACCACAGCTCAGG + Intergenic
995531507 5:113096015-113096037 GGTGGAGTCCACCAGGGTACAGG - Intronic
996751713 5:126895818-126895840 GGTGGAGCCCACCACAGCTCAGG - Intronic
997231917 5:132251584-132251606 AGTGCTGGGCACCACGGGGCAGG + Intronic
999207441 5:149859643-149859665 GGTGTAGGCCACCCTGGGGAAGG + Exonic
999322641 5:150624809-150624831 GGTGGCGGGGACCTCGGGGCGGG + Intronic
1000354398 5:160379825-160379847 GATGGAGGGCCCCACGGAGCTGG - Intergenic
1001467237 5:171978342-171978364 TGTGGAGGGCACCACTGGACAGG - Intronic
1001764478 5:174234622-174234644 GGCGGAGGCCACAGCAGGGCTGG - Intronic
1002087100 5:176782787-176782809 TGCTGAGGCCACCACGGGGCAGG + Intergenic
1002585657 5:180245293-180245315 GGTGGAGGCCCCCAGCAGGCGGG - Intronic
1002640945 5:180630386-180630408 GGGGGAGGGCTCCACGGGGCTGG + Intronic
1004022031 6:11784788-11784810 AATGGAGGTCACCACGGGCCTGG + Intronic
1005391244 6:25335788-25335810 TCTGGATGCCAGCACGGGGCAGG - Intronic
1006136717 6:31900423-31900445 CGTGGGGGCCACCTCGGGCCTGG - Exonic
1006380211 6:33692914-33692936 TGTGGAGGCCGCAGCGGGGCTGG + Intronic
1007154132 6:39725481-39725503 GAAGGAGGCCACTACGGGGCGGG + Intergenic
1009695326 6:67095910-67095932 GGTGGAGCCCACCACAGCTCAGG + Intergenic
1011129296 6:84037558-84037580 GCGGGAGCCCACCACGGGGTGGG + Intronic
1016365132 6:143307837-143307859 GGTGGAGCCCACCACAGCTCAGG - Intronic
1017786996 6:157764661-157764683 GGCGGGGGCCATCACGTGGCCGG + Intronic
1018100195 6:160431282-160431304 AGTGGCGGCCGCCACGGCGCAGG + Intronic
1018399104 6:163404707-163404729 TGCGGTGGCCACCTCGGGGCAGG + Intergenic
1019055766 6:169222247-169222269 GGTGAACTCCACCACGGGGACGG - Exonic
1019174523 6:170153508-170153530 GGTGCAGGCCACCATGTGACAGG - Intergenic
1019452041 7:1104026-1104048 GGTGGGTGCTAGCACGGGGCTGG - Intronic
1019499979 7:1359980-1360002 AGAGGAGGCCCCCAAGGGGCTGG - Intergenic
1019637436 7:2083561-2083583 GGTGGAGGCCAGCGCAGGGCGGG + Intronic
1019992754 7:4703438-4703460 GGTGGCGTCCAGCACAGGGCAGG + Intronic
1023590426 7:41775294-41775316 TGTGGAGGCAAGCACGGAGCAGG + Intergenic
1024082149 7:45864560-45864582 GGAGGGGGCCATCACAGGGCTGG - Intergenic
1025176184 7:56803600-56803622 TGTGCAGGCCACCGCGAGGCAGG + Intergenic
1026045707 7:66904213-66904235 GGGGAAGGCCGCCACGAGGCAGG - Intergenic
1030152215 7:106419041-106419063 GGTGGAGGTTACCAGGGGGAGGG + Intergenic
1032097742 7:128947823-128947845 GCTGGAGGCCACCCAGGAGCAGG + Exonic
1033401821 7:141033096-141033118 GGTGGAGCCCACCACAGCTCAGG + Intergenic
1033660725 7:143399939-143399961 GGTAGAGGCCACGGCGGGTCAGG + Exonic
1034201716 7:149286935-149286957 GGTGGAGACCACCCTGGGGCTGG + Intronic
1034371099 7:150597601-150597623 GGTGGAGCCCACCACAGCTCAGG + Intergenic
1035301877 7:157902512-157902534 TCTCCAGGCCACCACGGGGCTGG - Intronic
1037393607 8:18419745-18419767 GGTGGAGATCGCCACGGGGTGGG + Intergenic
1039549016 8:38429947-38429969 GGCTGCAGCCACCACGGGGCCGG + Exonic
1044518989 8:93176218-93176240 GCTGGAGGCCACCAAGGAGCTGG + Intergenic
1044605197 8:94042047-94042069 GGAGGTGGACACCATGGGGCCGG + Intergenic
1048331837 8:133475917-133475939 GGTGGTGGCCACCATGGTGTGGG + Exonic
1049155160 8:141061827-141061849 GGTGGAGGCCAGGACAGGACAGG + Intergenic
1049425294 8:142535463-142535485 GGTGGAAGCCATCTCTGGGCAGG - Intronic
1049443885 8:142621405-142621427 TGTGGAGGCCAGCAGTGGGCAGG + Intergenic
1049541210 8:143210044-143210066 GGAGGAGGGCACCTTGGGGCTGG - Intergenic
1049621691 8:143601080-143601102 GCTGGAGGCCTGCACGGGGAAGG + Exonic
1049673607 8:143880214-143880236 GCTGGGGGCCACCACAGGGCAGG - Intergenic
1053144617 9:35704122-35704144 GGTGGAGGACACCAAGGTCCTGG - Exonic
1053307723 9:36995849-36995871 GGTGGAGGCCTCCAGGGTGGGGG - Intronic
1055308198 9:74952232-74952254 GGCGGTGGCGACGACGGGGCGGG - Exonic
1060658143 9:125387010-125387032 GGTGGAGGCCACCTCAGGAGGGG + Intergenic
1060928814 9:127474914-127474936 GGGGGAGGCCATCACTGGGCAGG + Intronic
1061253005 9:129437545-129437567 GGGGGAGGCCCCCACCGGGCCGG - Intergenic
1061638867 9:131935688-131935710 GGTGGAGATGACCACGGGTCGGG + Intronic
1062028806 9:134352721-134352743 TGTGGGGGCCAGCATGGGGCGGG + Intronic
1062181680 9:135194360-135194382 AGTTGTGGCCACCACGGTGCAGG + Intergenic
1062381806 9:136290390-136290412 CCTGGAGGACACCAGGGGGCTGG + Intronic
1062441611 9:136572218-136572240 GGCAGAGCCCACCAAGGGGCCGG - Intergenic
1062622936 9:137430776-137430798 GGCAGAGGCCACCACCTGGCGGG - Exonic
1062628955 9:137455121-137455143 GGTGGTGGCGACCACTGGCCTGG - Intronic
1203771803 EBV:53443-53465 GGTGGAGGCTGCCAGGGGCCTGG - Intergenic
1186466095 X:9785923-9785945 GTTGGAGGCCAGGACCGGGCAGG - Intronic
1186818724 X:13264459-13264481 GGAGGAAGCCACCAGGGTGCTGG - Intergenic
1187648291 X:21374025-21374047 GGTGGCGGCCACGGCGGGACGGG - Intergenic
1189172239 X:38920306-38920328 GGTGGAAGCCACAAGGAGGCAGG + Intergenic
1189534476 X:41923062-41923084 GGAGGAGGCGATCCCGGGGCTGG - Intronic
1191114857 X:56841801-56841823 GGTGGAGCCCACCACAGCTCAGG - Intergenic
1192577603 X:72255476-72255498 GGCCGAGGGCACCACGCGGCAGG - Intronic
1194302475 X:92204854-92204876 GGTGGAAGCCACCTGGTGGCAGG + Intronic
1198683588 X:139205360-139205382 GGTGGCGACCAGCACGGGCCTGG - Intronic
1200125119 X:153809815-153809837 GGAGGAGGCCATCGCGGGCCAGG + Intronic
1200148610 X:153940459-153940481 TATGGAGGCCACCAGGGAGCTGG - Intronic
1201898556 Y:19021206-19021228 GGGTGAGGACACCACTGGGCTGG + Intergenic