ID: 1153527284

View in Genome Browser
Species Human (GRCh38)
Location 18:6009224-6009246
Sequence AGTCCAGGAGTTGGGGCCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 418
Summary {0: 1, 1: 0, 2: 0, 3: 40, 4: 377}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153527278_1153527284 1 Left 1153527278 18:6009200-6009222 CCTAAACGTAAGGGCCAGAGAGT 0: 1
1: 0
2: 0
3: 8
4: 66
Right 1153527284 18:6009224-6009246 AGTCCAGGAGTTGGGGCCTCAGG 0: 1
1: 0
2: 0
3: 40
4: 377

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153527284 Original CRISPR AGTCCAGGAGTTGGGGCCTC AGG Intronic
900422185 1:2560453-2560475 AGTCTTGGAGGTGGGGCCTGGGG - Intronic
901088189 1:6624975-6624997 AGGCTAGGAGTTGGGGTTTCGGG + Intronic
901624613 1:10616901-10616923 AGTCCAGGAGTTCCGGGCTACGG + Intronic
901883029 1:12205067-12205089 ACCCCAGGAGCTGGGGGCTCTGG + Intronic
904221374 1:28972675-28972697 AGCCCAGGAGTTGGAGGCTGCGG - Intronic
904578796 1:31524280-31524302 AGTCCGGGAGTTGGGAGCTGAGG - Intergenic
904653444 1:32024386-32024408 AGCCCAGGAGTTGGAGGCTGTGG - Intronic
905629510 1:39510903-39510925 AGTTCAGGATTTGGAGCCTGGGG + Intronic
908354555 1:63317533-63317555 AGCCCAGGTGTCGGGTCCTCGGG - Intergenic
909309628 1:74129890-74129912 GGTCCTGGAATAGGGGCCTCAGG + Intronic
910309825 1:85810568-85810590 AGTGCAGGAGGTGGGGGCTGGGG + Intronic
912693736 1:111824349-111824371 AGTCCAGAACTTTGGGCATCTGG - Intronic
912906525 1:113713965-113713987 GGTCCTGGAATGGGGGCCTCAGG - Intronic
914198462 1:145463487-145463509 AGTCCCTGAGTGGGGGCCACAGG - Intergenic
914477568 1:148036615-148036637 AGTCCCTGAGTGGGGGCCACAGG - Intergenic
914513971 1:148357902-148357924 AGTCCCTGAGTGGGGGCCACAGG - Intergenic
915162665 1:153931048-153931070 AGCCAAGGAGATGGGGCCTGGGG + Exonic
915719828 1:157976746-157976768 AGTACAGGAGATGTGGTCTCTGG - Intergenic
915936919 1:160095084-160095106 AGTGCAGTATCTGGGGCCTCGGG + Exonic
917749176 1:178038603-178038625 AGTGCAGGAGTTGGAGGCTGCGG + Intergenic
918907100 1:190510753-190510775 AGTCCAGGAGTTCGAGATTCTGG + Intergenic
918968358 1:191379863-191379885 GGTCCAGGACTTGGGTCTTCTGG + Intergenic
919373599 1:196763506-196763528 AGTCCAGGAACTGGGGACCCTGG + Intergenic
919380039 1:196848183-196848205 AGTCCAGGAACTGGGGACCCTGG + Intronic
919455850 1:197818761-197818783 AGTCCTGGAATGGGGGCCTCAGG - Intergenic
919704482 1:200663247-200663269 GGTGCAGGAGCTGGGTCCTCGGG - Intronic
919858944 1:201725562-201725584 AGCCCAGGAGTTGGGGCGGGGGG + Intronic
920249613 1:204614831-204614853 AGTCCAGGACCTGGGGATTCAGG + Intergenic
922565765 1:226600731-226600753 TGTGCAGGAGTGGGGGTCTCGGG - Intronic
923797880 1:237176148-237176170 AGTCCAGGAGTTAGAGGCTACGG + Intronic
924447730 1:244149608-244149630 AGTCCAGGAGTTCGAGGCTGCGG - Intergenic
1063042708 10:2359388-2359410 AGACCAGGAGTTGGAGACGCAGG - Intergenic
1063626811 10:7698018-7698040 AGTCCAGGAGGTGGGGGCAAAGG - Intergenic
1063842456 10:10088179-10088201 AGGCCAGTCCTTGGGGCCTCAGG + Intergenic
1063976726 10:11423542-11423564 AGCCCTGGAGTTGGGCCTTCTGG + Intergenic
1064450024 10:15433636-15433658 AGTCCAGGAGTTGGAGGCTGTGG - Intergenic
1064456951 10:15496628-15496650 AGTCCAGAAGTTGGAGGCTATGG - Intergenic
1064730143 10:18322076-18322098 AGCCCAGGAGTTGGAGGCTGTGG + Intronic
1067474610 10:46557234-46557256 GGTCCAGGATTTGGGACCTGGGG - Intergenic
1068129933 10:52884739-52884761 CGTCCAGGAGATGGGGGCTTAGG + Intergenic
1068655833 10:59575607-59575629 AGTGGAGGACTTGGGGACTCTGG + Intergenic
1069026739 10:63550593-63550615 AGTCTAGGAGTTGGCACTTCTGG + Intronic
1069533072 10:69233156-69233178 AGTGCAGGAATTGGGGCTTGGGG + Intronic
1070614961 10:77962541-77962563 GGGCCAGGAGTGGAGGCCTCAGG + Intergenic
1071291814 10:84194427-84194449 TGTCCAGGACTGGGGGCCGCCGG + Intergenic
1072330988 10:94351603-94351625 AGTCCAGAAGTTTGAGCCTGCGG - Intronic
1072482145 10:95819374-95819396 AGTCCAGGAGTTTGAGACTGGGG - Intronic
1072644072 10:97238282-97238304 AGCCCAGGAGTTTGGGGCTGCGG - Intronic
1073241644 10:102062872-102062894 AGGCCAGGAGTTGGAGTCTGTGG - Intergenic
1073473782 10:103739877-103739899 AGCGAAGGAGTGGGGGCCTCCGG + Intronic
1075606204 10:123812561-123812583 GGTCCAGGGGTTGGGGACCCCGG - Intronic
1075729232 10:124626413-124626435 AGTGCAAAAGGTGGGGCCTCTGG + Intronic
1075992503 10:126849833-126849855 AGGGCAGCAGTTGGGGCCACTGG + Intergenic
1076599414 10:131647259-131647281 CCACTAGGAGTTGGGGCCTCTGG + Intergenic
1076752165 10:132548872-132548894 AGTCCAGGAGTTTGAGGCTTCGG - Intronic
1076884340 10:133254757-133254779 TGGCCAGGAGCTGGGGCCACCGG + Intergenic
1077507825 11:2940321-2940343 ACGCCTGGAGATGGGGCCTCAGG - Intergenic
1077711670 11:4543402-4543424 ACTTCAGGAGCTGGGGCCTTTGG + Intergenic
1078154248 11:8785221-8785243 AATTCAGGATTTGGGGCCTGGGG - Intronic
1079173439 11:18117537-18117559 AGCCCAGGAGTTGGAGGCTATGG + Intronic
1083747528 11:64744242-64744264 AGTCAGGGAGCTGGGGCCGCAGG - Intronic
1083756157 11:64792638-64792660 AGGCCAGGGGTTTGGGTCTCAGG + Intronic
1083923888 11:65794486-65794508 CATCCAGAAGTTGGGGCCACAGG - Intronic
1084138158 11:67202915-67202937 AGTCCAGGAGTTTGTGGCTGTGG + Intronic
1085096288 11:73762647-73762669 AGTCCAGGAGTTGGAGGCTGAGG + Intergenic
1085232854 11:74988245-74988267 AGCCCAGGAGTTGGAGGCTGTGG - Exonic
1085442572 11:76577872-76577894 AGGCCAGGAATCCGGGCCTCCGG + Intergenic
1085760620 11:79238207-79238229 TGTCCTGGACTTGGGGACTCAGG + Intronic
1087750849 11:102005512-102005534 AGTGCTGGAGGTGGGGCCTAGGG - Intergenic
1088991560 11:114958166-114958188 AGTCCAGGAGTTCTAGGCTCAGG - Intergenic
1091073579 11:132592461-132592483 ATTCCAGCAGTTGAGGCCCCTGG - Intronic
1091618624 12:2068603-2068625 AGGCAAGGACTTGGGGCCACTGG - Intronic
1091749527 12:3013794-3013816 AGGCCAGGAGTTGGAGGCTGCGG + Intronic
1092151717 12:6253510-6253532 AGGCCAGGAGCTGGGTCTTCAGG + Intergenic
1092460090 12:8678699-8678721 ATTCCAGAAGTTAGGGCCTCTGG - Intergenic
1093868093 12:24252722-24252744 TCTGCAGGAGCTGGGGCCTCGGG - Intergenic
1098888597 12:75984676-75984698 AGTCCAGGAGTTTGAGGCTGTGG + Intergenic
1100284877 12:93155798-93155820 AGCCCAGGAGTTGGAGGCTGCGG - Intergenic
1100831013 12:98516322-98516344 AGGCCAGAAGTTGGGGCCGCGGG + Intronic
1101464957 12:104939273-104939295 AGTCCAGGAGTTTGAGGCTTTGG - Intronic
1101698612 12:107150833-107150855 TGTCCAGGTGTTAGGGACTCAGG - Intergenic
1102032827 12:109752909-109752931 GGTCCAGGAGTTGGGGCGGCAGG + Intronic
1103374443 12:120444820-120444842 AGTCCAGAAATTGAGGACTCTGG - Exonic
1104967989 12:132517987-132518009 AGCTCTGGAGTTGGGGCCACTGG - Intronic
1106170926 13:27287316-27287338 AGTCCAGGAGTTTGAGGCTGCGG - Intergenic
1107135986 13:36944776-36944798 AGCCCAGGAGTTTGGGGCTGTGG - Intergenic
1107878968 13:44816492-44816514 AGTCTGGGAGTTGAGGCATCTGG + Intergenic
1109252002 13:60031338-60031360 AGTGCTGGAGGTGGGGCCTGGGG - Intronic
1110283409 13:73721628-73721650 AGTCCAGGAGTTTGAGGCTCCGG - Intronic
1111060784 13:83016174-83016196 ATTCCAGGAGTTGGAGGCTGCGG - Intergenic
1112076801 13:95922743-95922765 AGCCCAGGAGTTGGGTGCTGTGG + Intronic
1113709427 13:112453993-112454015 AGTGCAGGAACTGGGGGCTCTGG + Intergenic
1113761803 13:112853140-112853162 AGCCCAGGAGTTGGAGGCTGCGG + Intronic
1114007562 14:18331621-18331643 GATCCAGGAGTTGGGCCCTGGGG + Intergenic
1115951382 14:38726247-38726269 AGCCCAGGAGTTGGAGACTAGGG - Intergenic
1118203910 14:63703901-63703923 AGTCCAGGAGTTGGAGGCTATGG - Intronic
1118405806 14:65422574-65422596 AGTCCAGGAGTTTGAGACTGCGG - Intronic
1118728785 14:68652068-68652090 AGACCAAGGGTTGAGGCCTCAGG + Intronic
1118978547 14:70698213-70698235 AGTCCAGGGGAAGGGGCCTTGGG - Intergenic
1119026470 14:71156718-71156740 AGACTGTGAGTTGGGGCCTCAGG - Intergenic
1119129911 14:72162508-72162530 AGTCCAGGAGATGGTCCCTGAGG + Intronic
1120592382 14:86391077-86391099 AGCCCAGAACTTGGGGCTTCCGG + Intergenic
1120864703 14:89285942-89285964 AGTCCAGGAGCTGGAGGCTGCGG - Intronic
1121249562 14:92489527-92489549 AGGCCAGGATATGGTGCCTCGGG - Intronic
1122137783 14:99644849-99644871 AGCCCAGGAGTCCAGGCCTCTGG + Intergenic
1122251621 14:100444079-100444101 AGACCAGCAGCTGTGGCCTCAGG + Intronic
1122427555 14:101620638-101620660 AGACCTGGAGTTGGGGTCCCAGG + Intergenic
1122628415 14:103096274-103096296 AGTCCAGGAGTTTGAGGCTGTGG + Intergenic
1122822183 14:104353247-104353269 AGTCCAGGGGTTGGGGGCTGGGG + Intergenic
1123035725 14:105471154-105471176 TGGCCAGGAGGTTGGGCCTCTGG - Intergenic
1127501736 15:59560112-59560134 AGTCTAGGAGTTGGTGACCCTGG - Intergenic
1127790264 15:62392168-62392190 TTTCCAGAAGTTGGGGCTTCAGG + Intronic
1128088074 15:64899369-64899391 AGTCCAGGAGTTGTAGGCTTGGG + Intronic
1128259624 15:66223881-66223903 CGTACAGGAGTTCGGGCCACTGG - Intronic
1128745791 15:70113407-70113429 CAGCCAGGAGCTGGGGCCTCAGG - Intergenic
1128891003 15:71331713-71331735 AGTCCTGGAGATGGGCCCTGAGG - Intronic
1129033134 15:72632536-72632558 AGCCCAGGAGTTGGAGGCTATGG - Intergenic
1129116488 15:73368052-73368074 AGTCCCGGAGCTCGGCCCTCGGG - Exonic
1129216749 15:74104694-74104716 AGCCCAGGAGTTGGAGGCTATGG + Intronic
1129407926 15:75331391-75331413 AGCCCAGGAGTTGGAGGCTATGG - Intergenic
1129841667 15:78746996-78747018 AGCCCAGGAGTTGGAGGCTACGG - Intergenic
1130339368 15:82986290-82986312 AGCCCAGGAGAGGTGGCCTCTGG - Exonic
1130556445 15:84926274-84926296 AGTCCAGGAGTTTGAGGCTATGG - Intronic
1130836620 15:87656050-87656072 AGTCCAGGAGCTGGGTCAACAGG + Intergenic
1131237149 15:90706546-90706568 AGCCCAGGAATCAGGGCCTCAGG - Intergenic
1131272479 15:90955498-90955520 AGCCCAGGAACTGGGGTCTCAGG + Intronic
1132744132 16:1429700-1429722 GGCCCAGGAGCTGGGGGCTCGGG + Intergenic
1133017302 16:2949981-2950003 ACACCTGGGGTTGGGGCCTCTGG + Exonic
1133185877 16:4098103-4098125 ATTCCTGGAGTTGGGCCTTCTGG + Intronic
1133611540 16:7438341-7438363 AGTCCATGGTTTGGGTCCTCTGG + Intronic
1133774360 16:8885767-8885789 AGCCCAGGAGATGGGGTCTTTGG - Intergenic
1134118812 16:11569316-11569338 GGCCCAGGAGTTGGAGCCTGTGG - Intronic
1134668668 16:16038412-16038434 ACTCCAGGATTTCTGGCCTCTGG - Intronic
1135486807 16:22872771-22872793 AGTCCAGGTTTTGGGTTCTCTGG - Intronic
1135545226 16:23361274-23361296 AGTCCAGGAGTTGGAGGCTGTGG - Intronic
1135555696 16:23434656-23434678 AGGCCAGGAGCTGGGGCATCCGG + Exonic
1135591108 16:23705834-23705856 AGCCCAGGAGTTGGAGGCTACGG + Intronic
1135632546 16:24047451-24047473 AGCCCAGGAGTTGGTGGCTGCGG + Intronic
1136189999 16:28609848-28609870 ATTCCAGAAGCTGAGGCCTCTGG - Intronic
1136239110 16:28933297-28933319 GGTCCAGGAGAGGGGGCCCCTGG - Exonic
1136478365 16:30526729-30526751 GGTCCAGAAGGTGGGGGCTCGGG - Intronic
1137584704 16:49657490-49657512 ACACCTGGAGGTGGGGCCTCAGG - Intronic
1138199216 16:55076672-55076694 AATGTAAGAGTTGGGGCCTCTGG + Intergenic
1139552199 16:67680321-67680343 AGTCCAGGAGTTAGAGGCTGCGG + Intronic
1139798930 16:69505429-69505451 AGCCCAGGAGTTGAGGCTACAGG + Intergenic
1139955468 16:70691067-70691089 AGCCAAGGGGTTGAGGCCTCTGG - Intronic
1141754385 16:85981767-85981789 AGCCCAGGAGTTGGAGGCTGCGG + Intergenic
1142364059 16:89640451-89640473 AGTCGAGGAGCAGGGGGCTCCGG + Intergenic
1142749357 17:1978077-1978099 AGTGCAGGAGGCGGGGCCGCGGG - Intronic
1144068215 17:11642752-11642774 AGACCCGGGGTTGGGGCCTGTGG + Intronic
1144760383 17:17703881-17703903 AGACAAGGACTTGGGCCCTCTGG - Intronic
1146796051 17:35781947-35781969 AGTCCAGGAGTTTGAGGCTGTGG - Intronic
1147238703 17:39076431-39076453 AGCCCAGGAGTTGCGGGCTGTGG + Intronic
1147440692 17:40445544-40445566 ACTCCAGGGGTCTGGGCCTCGGG + Intronic
1147813795 17:43193506-43193528 AGGCCAGCAATTTGGGCCTCGGG + Exonic
1148081601 17:44970117-44970139 AGCCCAGGGGTAGGGGGCTCAGG + Intergenic
1148126136 17:45237935-45237957 CCTCCAGGAGTTGCGGACTCTGG + Intronic
1148805024 17:50259652-50259674 GGTCCTGGGGTGGGGGCCTCTGG + Intergenic
1150049135 17:61941629-61941651 AGGCCAGGAGTTTGAGACTCGGG + Intergenic
1152376644 17:79921983-79922005 AGCCCAGGAGTTGGGGCTGGGGG + Intergenic
1152884253 17:82840053-82840075 AGTGTAGGAGTTGAGCCCTCGGG + Exonic
1153527284 18:6009224-6009246 AGTCCAGGAGTTGGGGCCTCAGG + Intronic
1153533864 18:6079149-6079171 AGCCTAGGTGTTGGGGACTCCGG + Intronic
1153783551 18:8514979-8515001 AGGCCAGGAGTTGGAGGCTGTGG + Intergenic
1154529908 18:15332341-15332363 GATCCAGGAGTTGGGCCCTGGGG - Intergenic
1156395005 18:36691400-36691422 AGTCCAGGAGTTGTGAGCACAGG - Intronic
1157230345 18:45909866-45909888 AGCCCAGGAGTTTGGGGCTGAGG + Intronic
1157720024 18:49916472-49916494 AGTTCAGGAGATGGGGCGTATGG + Intronic
1157774668 18:50383150-50383172 AAGCCAGGTGTTAGGGCCTCGGG - Intronic
1158239659 18:55362236-55362258 AGTTCAGGAGTTGGAGGCTGCGG + Intronic
1159781785 18:72668255-72668277 AGTCCAGGAGATGGGACCCGGGG + Intergenic
1159781801 18:72668313-72668335 TGTCCAGGAGGTGGGACCCCGGG + Intergenic
1160147839 18:76379074-76379096 AGCCCAGGAGCTGAGGACTCTGG - Exonic
1161122341 19:2536045-2536067 AGTCCAGGAGTTGGAGGCTGCGG + Intronic
1161206563 19:3044341-3044363 AGGCCAGGAGCTGGGGCATAGGG - Intronic
1161216414 19:3097025-3097047 GGTCCAGGGGCTGGGGCCTCAGG + Intronic
1161263636 19:3352252-3352274 AGCCCAGGAGTTGGAGGCTGCGG + Intergenic
1161291268 19:3494559-3494581 ACTCCAGAATTTGGGGCCACTGG + Intronic
1161459345 19:4387374-4387396 AGTCCAGGAGTTTGAGGCTGCGG - Intronic
1161586172 19:5107047-5107069 AGACCAGGAGGTGGGGACTCAGG - Intronic
1161833030 19:6623652-6623674 AGGCCAGGAGTTGGAGACCCAGG + Intergenic
1161863931 19:6820311-6820333 AGCCCAGGAGTTCGAGCCTGCGG - Intronic
1162012280 19:7824772-7824794 AGCCCAGGAGTTTGAGGCTCTGG - Intergenic
1162323823 19:9986624-9986646 AGGCCAGAAGTGAGGGCCTCGGG + Intronic
1162536673 19:11266564-11266586 AGTCCCAGAGTTGGGGACTGAGG - Intergenic
1162601506 19:11673685-11673707 AGGCCAGGAGATGGCGCCACTGG + Intergenic
1162828049 19:13266282-13266304 AGCCCAGGAGTTGGAGGCTGCGG - Intronic
1163177507 19:15574705-15574727 AATCCAGGAGATGGAGACTCAGG + Intergenic
1163212605 19:15852294-15852316 AGGGCAGGAGTTGGGGCTTCAGG - Intergenic
1163272739 19:16263831-16263853 CAACCAGGATTTGGGGCCTCCGG - Intergenic
1163274366 19:16273886-16273908 AGCCCAGGAGTTGGAGGCTGTGG - Intergenic
1163672898 19:18638776-18638798 AGTCCAGGAGTTTGAGGCTGCGG - Intronic
1163800000 19:19358912-19358934 AGTGGAGGAGATGGGGACTCAGG - Intergenic
1164119518 19:22253580-22253602 AGTCCTGGGTTTGGGGCCACAGG - Intergenic
1165327994 19:35125315-35125337 ACTGCAGGAGCTGGGGCCTCCGG - Exonic
1165838402 19:38772927-38772949 AGTCCAGAAGTAGGGGCCCGAGG - Intronic
1165841157 19:38789770-38789792 AGTCCAGAAGTAGGGGCCCGAGG + Intronic
1165846164 19:38819026-38819048 AGCCCAGGAGTTGGAGGCTGCGG + Intronic
1166113001 19:40634540-40634562 AGACCTGGCGTTGGGGCTTCTGG + Intergenic
1166670087 19:44704358-44704380 AGGCCAGGAGAGGGGGCCTAAGG + Intronic
1167298676 19:48666759-48666781 AGCCCAGGAGTTGGAGGCTGTGG - Intronic
925288818 2:2732965-2732987 GGGGCAGGAGTGGGGGCCTCAGG - Intergenic
926030203 2:9579892-9579914 AGCCCAGGAGTTTGGGGCTGTGG - Intergenic
926185171 2:10684910-10684932 AGCCCAGGAGTTTGAGCCTTCGG - Intronic
926651877 2:15355566-15355588 AGTGCTGGAGGTGGGGCCTTGGG + Intronic
927247169 2:20966590-20966612 AGTCCAAGAGTGGGGGCAGCTGG + Intergenic
927846370 2:26474450-26474472 AGGCTGGGAGTTGGGGCCTAGGG - Intronic
928975699 2:37084329-37084351 AGTGCGGGAGGTGGGGCATCCGG - Exonic
931057903 2:58493343-58493365 AGCCCAGGAGTTTGGGGCTGCGG + Intergenic
931306080 2:61029732-61029754 AGGCCAGGAGTTGGAGGCTGCGG + Intronic
932705186 2:74019177-74019199 AGCCCAGGAGTTGGAGGCTGCGG + Intronic
933283868 2:80362905-80362927 AGTCCAGGAGTTTGAGGCTTAGG + Intronic
934861706 2:97769052-97769074 AGCCCAGGAGTTAGAGACTCAGG - Intronic
936017440 2:108970502-108970524 GGTCTGGGAGCTGGGGCCTCTGG + Intronic
937028429 2:118718297-118718319 TGTCCAGGAGATGTGTCCTCTGG + Intergenic
937064750 2:119009415-119009437 AATCCAGGTGTTTGAGCCTCAGG - Intergenic
938017025 2:127875869-127875891 AGTCCAGGAGTTGGAGGCTGTGG - Intronic
938529006 2:132163781-132163803 GATCCAGGAGTTGGGCCCTGGGG - Intronic
944164323 2:196702169-196702191 AGTCCAGGAGTTGGAGGCTATGG + Intronic
945713658 2:213331225-213331247 AGGCCTGGAATGGGGGCCTCAGG - Intronic
945714530 2:213341607-213341629 AACCCAGGAGTTGGGGCTACAGG - Intronic
946352826 2:219166610-219166632 AGCCCAGGAGTTGGAGGCTGCGG - Intronic
947641715 2:231710707-231710729 AGGCCGGGAGTTGGTGGCTCCGG + Intronic
947679740 2:232019468-232019490 AGTCCTGGAGTTGGAGGCTATGG + Intronic
948678375 2:239612316-239612338 AGCCCAGCAGCTGGGTCCTCAGG - Intergenic
1168997512 20:2144295-2144317 AGTCCAGGAGTTCCTGCATCTGG - Exonic
1170343720 20:15358887-15358909 AGTACTGGAGGTGGGGCCTTCGG - Intronic
1172162941 20:32880917-32880939 AAACCAGGAGTGGGGGCCTGTGG - Intronic
1172887437 20:38240719-38240741 AGCCCAGGAGTGGGGGGCTCAGG + Exonic
1172936809 20:38626405-38626427 GTTCCAGGAGTTCAGGCCTCGGG - Intronic
1172957361 20:38770699-38770721 AAGCCAGGGGGTGGGGCCTCTGG + Intronic
1173732895 20:45340792-45340814 GGTCCAGGTGTTGGAGCCCCAGG - Intronic
1175297446 20:57918735-57918757 AGTGCAGGAGTTTGGGGCCCAGG - Intergenic
1176000179 20:62828158-62828180 TGTGCAGGAGTAGGGGCCTCAGG + Intronic
1176767503 21:13036135-13036157 GATCCAGGAGTTGGGCCCTGGGG + Intergenic
1178426183 21:32480221-32480243 AGCCCAGGAGTTGGAGGCTGTGG + Intronic
1178463449 21:32824485-32824507 AGACCAGGAAGTGGGTCCTCTGG + Intergenic
1178597516 21:33968130-33968152 AGTCCCTGAGCTGGGGCCACAGG + Intergenic
1178673213 21:34610384-34610406 AGACCAGGAGATGGGGCATTTGG - Intronic
1179880707 21:44292338-44292360 AGTCCAGGAGGTGCAGCCCCGGG + Exonic
1180432069 22:15262431-15262453 GATCCAGGAGTTGGGCCCTGGGG + Intergenic
1180514631 22:16130367-16130389 GATCCAGCAGTTGGGGCCTGGGG + Intergenic
1181028968 22:20140925-20140947 GGTCCAGGAGTTCAGGCCTAAGG - Exonic
1181458326 22:23071697-23071719 AGTGCAGGTGCAGGGGCCTCGGG + Intronic
1181523747 22:23466337-23466359 AGGGCAGGAGATGGGGGCTCCGG + Intergenic
1181980613 22:26763402-26763424 AGCCCAGGTGTTGGCACCTCGGG + Intergenic
1182364155 22:29766722-29766744 AGGCCAGGAGCTGGAGCCTGCGG - Intronic
1182663773 22:31943437-31943459 AGTGCAGGAGAGGGGGCCTTGGG - Intronic
1183543174 22:38441512-38441534 ACTCCAGGAGTTGGGGCTGCCGG + Intronic
1183779223 22:39988222-39988244 AGCCCAGGGGTTAGGGCCTAAGG + Intergenic
1183789733 22:40056718-40056740 AGCCCAGGAGTTGGAGGCTGCGG + Intronic
1184102467 22:42348011-42348033 AGTCCAGCACTTGGGGCCCAGGG + Intergenic
1184480350 22:44743119-44743141 AGTCCTGGAGTTGGGGACCACGG - Intronic
1184594150 22:45503825-45503847 AGTCCCAGAGTTGGGGCCTAAGG - Intronic
1184709537 22:46240440-46240462 AGTCCAGGAGATGGGAGCTGAGG - Exonic
949349924 3:3114945-3114967 AGCCCAGGAGTTTGAGGCTCTGG + Intronic
950311861 3:11965912-11965934 AGCCCAGGAGTTGGAGGCTGCGG - Intergenic
950826631 3:15830305-15830327 AGTCCAGGGGTTAGGGACCCTGG - Intronic
950948665 3:16976899-16976921 GGACCAGGAGTTTGGGACTCTGG - Intronic
951871085 3:27363130-27363152 AGTCCAGGAGTAAAGGCCTGGGG - Intronic
952109286 3:30104073-30104095 AATCCAGGGCTTGTGGCCTCTGG - Intergenic
953843126 3:46405951-46405973 AGCCCAGGAGTTGGAGGCTGCGG - Intergenic
954450456 3:50568870-50568892 CCTCCAGGTGTTGGGACCTCTGG - Intronic
957896946 3:86433297-86433319 AGTATAGGAGGTGGGGCCTTTGG - Intergenic
961965684 3:130900138-130900160 AGTCCAGGAGTTAGGGGCTTTGG - Intronic
963022153 3:140882784-140882806 TGTCCAGGAGTGGGGGGCTAGGG + Intergenic
963739901 3:149067578-149067600 AGCCCAGGAGTTTGAGCCTATGG - Intronic
963867619 3:150379407-150379429 AGTCCAGGAGTTCGAGACCCTGG - Intergenic
964225970 3:154402336-154402358 AGTCCAGGAGTTGGAGGCTATGG + Intronic
964728676 3:159842288-159842310 AGTCCATGAATGGGGGCTTCAGG + Intronic
966290007 3:178344018-178344040 AGTCCAGGAGTTGGGAGCTAAGG + Intergenic
968831592 4:2935011-2935033 AGGCCAGGAGTCTCGGCCTCGGG - Intergenic
969341476 4:6544418-6544440 AGCCCAGGAGTTTGGGGCTGCGG - Intronic
970043809 4:11827021-11827043 AGTCCAGGAGTTTGAGGCTGCGG - Intergenic
970180308 4:13384585-13384607 AGTCCAGGAGCTGGGAGCTGAGG + Intronic
973342378 4:49018304-49018326 AGTGTTGGAGTTGGGGCCTGGGG - Intronic
973826240 4:54710096-54710118 AGTGCAGGACTTGGGTGCTCAGG - Intronic
975684346 4:76904810-76904832 AGTGTTGGAGGTGGGGCCTCTGG + Intergenic
975743736 4:77455676-77455698 TGTCCAGGAGTCGGGGGCTAGGG - Intergenic
976336612 4:83895150-83895172 TGTCCAGGAGATGGGGATTCAGG - Intergenic
978239819 4:106502150-106502172 TGTCCAGGAGTTGATGGCTCGGG + Intergenic
978384464 4:108166913-108166935 AGCCCAGGCGCTGGGGCCGCAGG + Intronic
980494561 4:133574765-133574787 ATTCCAGGTTCTGGGGCCTCAGG + Intergenic
981724572 4:147834092-147834114 AGTCCAAGAGTGGGGGACCCAGG + Intronic
982630061 4:157820232-157820254 AGTCCAGGAGTTTGGAGCTGAGG + Intergenic
983575889 4:169261206-169261228 AGGTCAGAAGTTGTGGCCTCTGG - Intronic
985110813 4:186544984-186545006 CATCCATAAGTTGGGGCCTCTGG - Intronic
985129627 4:186726659-186726681 AGTTGAGGAGTTGCGGCCGCCGG + Intronic
985490159 5:174357-174379 AGTCCAGGGGTCGGGGGCTAAGG + Intronic
985550865 5:532951-532973 AGCCCATGAATGGGGGCCTCCGG - Intergenic
985711636 5:1432796-1432818 TGTCCAGGAGTTGTGGGCTCAGG - Intronic
987325485 5:16808393-16808415 AGCCCAGGAGTTGGAGGCTGTGG + Intronic
988565293 5:32315883-32315905 AGTCAAGGAGTTTGGGGCTAGGG - Intergenic
988810311 5:34778480-34778502 AGTCCAGGAGTTGGAGAATCTGG + Intronic
988877922 5:35468888-35468910 AGTCCAGGAGTTGAGGCTGATGG - Intergenic
989589965 5:43104197-43104219 AGTCCAGAAATGGGGGCATCAGG + Intronic
990431269 5:55737600-55737622 AGTCCATGGGTTGGCCCCTCGGG - Intronic
991119675 5:62997244-62997266 TTACCAGGAGGTGGGGCCTCTGG - Intergenic
992179303 5:74181174-74181196 AGTGCAGGAGCTGGGGCCTTTGG + Intergenic
992546334 5:77817543-77817565 AGCACAGCAGTTGGGGCCTTTGG - Intronic
992713966 5:79490875-79490897 AGCCCAGGAGTTGAGGCTGCAGG + Intronic
995436070 5:112137022-112137044 AGACCAGGAAGTGGGTCCTCTGG + Intergenic
996338833 5:122413985-122414007 AGTCCAGGAGTTGGAGGCTGTGG - Intronic
996517898 5:124394001-124394023 AGTCCAGGTGCTGGGGCATGAGG - Intergenic
997880047 5:137581362-137581384 GGACCAGAATTTGGGGCCTCTGG - Intronic
998514815 5:142743315-142743337 AGTCCAGGAGTTCGAGGCTACGG + Intergenic
999877774 5:155827277-155827299 AGTTCAGGAGTGGGGACATCAGG + Intergenic
1000047219 5:157531587-157531609 AGTCCAGGAGATGGAGGCTGCGG + Intronic
1001513669 5:172340138-172340160 AGTCCATGAGATGTGGCCTTGGG + Intronic
1001910848 5:175516190-175516212 GGCCCAGGGGTTGGGGCCCCTGG + Intronic
1002641366 5:180632153-180632175 AGTTCAGGAGGGAGGGCCTCAGG - Intronic
1004207545 6:13606311-13606333 AGTAATGGAGTTGGGGGCTCTGG + Intronic
1004643768 6:17540002-17540024 AGCCCAGGAGGTGGGGGCTGCGG + Intronic
1004648946 6:17589905-17589927 AGACCAGGATGTGGGTCCTCTGG - Intergenic
1004714381 6:18203197-18203219 AGTCCAGGAGTTAGAGACTGTGG + Intronic
1004928096 6:20435188-20435210 AGCCCAGGAGTTGGAGACTTGGG - Intronic
1005960231 6:30688555-30688577 AGTCCATGGATTTGGGCCTCTGG + Exonic
1006155272 6:32010155-32010177 ATTCCAGGAGGTGCTGCCTCTGG - Intergenic
1006161578 6:32042889-32042911 ATTCCAGGAGGTGCTGCCTCTGG - Intronic
1006519485 6:34563100-34563122 AGCTCAGGAGCTGGGCCCTCCGG + Intergenic
1007472367 6:42099262-42099284 AGCCCTGCTGTTGGGGCCTCTGG - Intergenic
1007609376 6:43139358-43139380 AGACGAGGAATTGGGGCCGCTGG - Intronic
1007636431 6:43302477-43302499 TGGCCAGGAGGTGGGGTCTCCGG - Intronic
1007665942 6:43512978-43513000 ATTCCAGGCTTTGGGGCCCCAGG + Intronic
1007949716 6:45860513-45860535 AGTCCAGGTGCTGTGGCGTCTGG - Intergenic
1009978669 6:70700938-70700960 GGTCCTGGAATGGGGGCCTCAGG + Intronic
1010211171 6:73363689-73363711 AGTCCAGGAGGTCGGGACACAGG + Exonic
1010365835 6:75050146-75050168 AATCCAGGAGTAGGGCCTTCTGG - Intergenic
1010798621 6:80147628-80147650 AGTCCAGGCGTTGTGACCTTCGG + Intronic
1012892074 6:104908078-104908100 AGGCCTGGAATGGGGGCCTCGGG - Intergenic
1013853891 6:114548528-114548550 AGTCCTGGATTTGGGGCCGAGGG - Intergenic
1017831707 6:158136571-158136593 AGTCCAGGAGTTCGAGGCTGCGG - Intronic
1017865287 6:158437863-158437885 AGCCCAGGAGTTGTGGGCTGTGG + Intronic
1018722797 6:166586593-166586615 AGCCCAGGAGAGGTGGCCTCTGG + Intronic
1018909258 6:168092518-168092540 AGTCATGGGGGTGGGGCCTCAGG + Intergenic
1019973086 7:4557892-4557914 AGGCCAGGATTTGGAGCCTGCGG + Intergenic
1019984449 7:4645074-4645096 AGCCCAGGAGTTGGAGGCTGTGG + Intergenic
1020135888 7:5587658-5587680 AGTCCAGGAGTTTGTGGCTGGGG + Intergenic
1020136273 7:5589890-5589912 AGACCAGGATTTGGGGCCTGGGG - Intergenic
1020217849 7:6208619-6208641 AGTCCAGGAGTTGGAGGCTGTGG - Intronic
1021280699 7:18714346-18714368 ATTCCAGGAGTTTGGGCCTGAGG - Intronic
1022467348 7:30660737-30660759 AGTCCTGGAGATTGGGTCTCAGG - Intronic
1022474260 7:30699903-30699925 AGTCCACGAGGTGGGGCGCCAGG - Intronic
1023121874 7:36917721-36917743 TGTCCAGGAGTTGGATCCTGGGG - Intronic
1023187781 7:37549527-37549549 AGTCCAGGAACTGGGAACTCAGG + Intergenic
1024414568 7:49089664-49089686 AGTCAAAAAGTTGGGACCTCAGG + Intergenic
1025160447 7:56654797-56654819 AGTCCTAGAATGGGGGCCTCAGG - Intergenic
1025263442 7:57438014-57438036 TGGCCAGGAACTGGGGCCTCGGG - Intergenic
1026492825 7:70877732-70877754 AGCCCAGGAGTTGGAGGCTGCGG - Intergenic
1026831450 7:73612713-73612735 AGTCCAGAGGATGGGGTCTCTGG - Intronic
1027132482 7:75600836-75600858 AGCCCAGGAGTTGGAGGCTGTGG - Intronic
1027374386 7:77536661-77536683 AGTCCAGGAGTGGGGGCGGGCGG - Intergenic
1027804509 7:82799997-82800019 ATTCCAGGAGTTTGGGCAGCAGG + Intronic
1028022373 7:85792574-85792596 GGGCCTGGAATTGGGGCCTCAGG - Intergenic
1029259697 7:99293471-99293493 AGCCCAGGAGTGGGAGCCTTGGG - Intergenic
1029448212 7:100626694-100626716 GGTCCAGGAGGTGGAGCCCCAGG + Intronic
1029736139 7:102466986-102467008 AGGCCAGGAGTTGGAGCCTGGGG - Intronic
1030017879 7:105243077-105243099 AGGCCAGGAGTTGGAGTCTACGG - Intronic
1030771936 7:113485776-113485798 ATATCAGGAGGTGGGGCCTCTGG + Intergenic
1032787279 7:135211128-135211150 AGACCAGGAGCCGGGGCATCGGG + Intronic
1034553684 7:151836701-151836723 AGCCCAGGAGCTGTGGCCTGAGG - Intronic
1034893491 7:154860204-154860226 AGTCTAGGAGGGGGTGCCTCAGG - Intronic
1035830932 8:2693748-2693770 AGTCCAGGAGTTGAAGGCTGTGG - Intergenic
1036062474 8:5339578-5339600 AGTCCAGGAGTTCAGGTCACAGG - Intergenic
1036572807 8:9996841-9996863 AGGCCAGGAGTTGGAGGCTGTGG - Intergenic
1036942951 8:13068907-13068929 AGTCCAGGAGTTTGAGCCTGCGG - Intergenic
1037506166 8:19531879-19531901 TTTCCAGCAGATGGGGCCTCTGG + Intronic
1037869347 8:22477714-22477736 AATCCAGGAGTTGGAGGCTGAGG - Intronic
1037909941 8:22738332-22738354 TGTCCAGGAGGTGGGGGCTCTGG + Intronic
1037952364 8:23027688-23027710 TCTCCAGGAGCTGGGGGCTCAGG - Intronic
1038115827 8:24554037-24554059 AGACCTGGAGTTGGGGACTGGGG + Intergenic
1038491853 8:27977208-27977230 GGACTAGGAGGTGGGGCCTCTGG - Intronic
1038596556 8:28890963-28890985 AATCCTGGAGGTGGGGTCTCCGG + Exonic
1039289449 8:36077903-36077925 AGTCCAGGAGTTGGGAGCTGAGG + Intergenic
1039549610 8:38433256-38433278 AGCCCAGGAGTTGGAGGCTACGG + Intronic
1039598002 8:38808488-38808510 AGTCCAGAAGTTGGAGGCTGCGG - Intronic
1040462113 8:47659180-47659202 AGCCCAGGAGTTGAGGCTGCAGG + Intronic
1043641235 8:82452562-82452584 GGTCCAGCAGCTGGGGCCCCGGG + Intergenic
1046295587 8:112215461-112215483 AGTGTTGGAGTTGGGGCCTGGGG + Intergenic
1046496549 8:115022207-115022229 TGTCAGGGAGTAGGGGCCTCGGG - Intergenic
1048853951 8:138670416-138670438 AGGCCGGGAGCTGGGGCCTGGGG + Intronic
1049426528 8:142540367-142540389 ACCCTAGGACTTGGGGCCTCAGG + Intronic
1049975128 9:854192-854214 AGTCCAGGAGTTTGAGGCTACGG - Intronic
1050191720 9:3033400-3033422 AGGCCAGGGTTTGGGGGCTCAGG + Intergenic
1050284739 9:4089739-4089761 AGTCCAGGAGTTTGAGGCTATGG + Intronic
1050303181 9:4280095-4280117 AGTCCAGGAGTTTGAGGCTGCGG - Intronic
1050618666 9:7429692-7429714 AGGCCTGGAGTGGGGGCCTCAGG + Intergenic
1051443833 9:17118497-17118519 AGGCCAAGTGTTGGGGCCTGTGG - Intergenic
1053707605 9:40770094-40770116 GATCCAGGAGTTGGGCCCTGGGG - Intergenic
1054417518 9:64890880-64890902 GATCCAGGAGTTGGGCCCTGGGG - Intergenic
1055581686 9:77712714-77712736 AAACCAGGAGTTGATGCCTCAGG - Intergenic
1056410520 9:86321649-86321671 AGTCCAGGAGTTAGAGGCTGTGG + Intronic
1056501060 9:87209838-87209860 AGTCCAGGAGTGTGGGCTTTGGG - Intergenic
1058294414 9:103287595-103287617 AATCCAGGGCTTGTGGCCTCTGG - Intergenic
1059170512 9:112120227-112120249 AGCCCAGGAGTTGGAGGCTGTGG + Intronic
1059395808 9:114033431-114033453 AGACCAGAACTTGGAGCCTCTGG - Intronic
1060135654 9:121150780-121150802 TGTACAGGAGTTAGGGTCTCAGG + Intronic
1060224310 9:121782024-121782046 AGACCAGGAGCTGTGACCTCTGG + Intronic
1060429276 9:123535366-123535388 AGTCCAGGAGTTTGAGGCTGTGG + Intronic
1061104984 9:128523099-128523121 AGTCCAGGAGTTTGAGGCTGTGG + Intronic
1061216216 9:129223546-129223568 ATCCTAGGAGTTGGGGACTCGGG + Intergenic
1185765352 X:2721371-2721393 AGCCCAGGAGTTGGAGGCTGTGG - Intronic
1185965328 X:4593949-4593971 AGCCCAGGAGTTGGAGGCTGAGG - Intergenic
1186085665 X:5987997-5988019 AGCCCAGGAGTTGGAGGCTGCGG + Intronic
1186091696 X:6055415-6055437 AGTCCAGGAGTTGGAGGCTGTGG + Intronic
1186115012 X:6296503-6296525 AGCCCAGGAGTTGGAGGCTGCGG - Intergenic
1189339221 X:40191966-40191988 AGTCTGGGAGCCGGGGCCTCAGG + Intergenic
1190240641 X:48655334-48655356 AGGGCAGGAGTTGTAGCCTCAGG + Intergenic
1192216003 X:69158537-69158559 AGTACAGGTCTTGGGGCCTGTGG + Intergenic
1194147196 X:90279353-90279375 AATCCAGCGGTTGGGGCCTCAGG - Intergenic
1196889054 X:120274959-120274981 AGTTGAGGAGATGGGACCTCAGG - Intronic
1197178468 X:123509486-123509508 AGCCCAGCAGCTGGGGCCTTTGG + Intergenic
1198320215 X:135512851-135512873 AGTCAGGGTGTTGGAGCCTCTGG - Intergenic
1199977225 X:152901328-152901350 AGCCCAGGAGTTGGAGGCTGCGG - Intergenic
1200110720 X:153739571-153739593 AGCCCAGGAGTTGGAGACTGCGG + Intronic
1200353401 X:155522560-155522582 TGTCCAGGAGTTAGGGATTCGGG - Intronic
1200493598 Y:3856121-3856143 AATCCAGAGGTTGGGGCCTCAGG - Intergenic
1201628984 Y:16047975-16047997 TGTCCAGGAGTAGGGGGCTAAGG + Intergenic