ID: 1153527655

View in Genome Browser
Species Human (GRCh38)
Location 18:6013105-6013127
Sequence CCTTCCAGTCACTCACTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 195}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153527648_1153527655 23 Left 1153527648 18:6013059-6013081 CCCTCAAACACAGGCTCACTCTT 0: 1
1: 0
2: 0
3: 17
4: 241
Right 1153527655 18:6013105-6013127 CCTTCCAGTCACTCACTGCAGGG 0: 1
1: 0
2: 0
3: 19
4: 195
1153527649_1153527655 22 Left 1153527649 18:6013060-6013082 CCTCAAACACAGGCTCACTCTTT 0: 1
1: 0
2: 0
3: 28
4: 341
Right 1153527655 18:6013105-6013127 CCTTCCAGTCACTCACTGCAGGG 0: 1
1: 0
2: 0
3: 19
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153527655 Original CRISPR CCTTCCAGTCACTCACTGCA GGG Intronic
900202423 1:1415862-1415884 CCTTCGTGTCTCTCACGGCAGGG - Intergenic
901081677 1:6587285-6587307 CCTCCCTGTCACTTACTGCATGG - Exonic
902228544 1:15012531-15012553 TCTTCCAGGCCCTCAATGCAGGG + Intronic
905517842 1:38575190-38575212 CCTTCCTGGCACCCTCTGCAGGG + Intergenic
906205300 1:43983407-43983429 CCTTCCTGACACTGACTGCCGGG - Intronic
906789893 1:48650043-48650065 CCTTCCCTTCTCACACTGCAGGG + Intronic
907500516 1:54876136-54876158 CTTCCCAAACACTCACTGCAGGG + Intronic
907525136 1:55049636-55049658 CTTTCCAGCCTCTCACTGGAAGG + Intronic
909477165 1:76094059-76094081 CCTCCCTGACAGTCACTGCAGGG + Intronic
909654064 1:78010975-78010997 CCTTCAAATCACTCACTGTTTGG + Intronic
910140782 1:84025297-84025319 ACTCCCAGTCACTCATAGCAGGG - Intergenic
911061416 1:93751274-93751296 TCTTCCTGTCACCCACTGCATGG - Intronic
911575190 1:99568166-99568188 CCTTCCAGTAACTCATAGGAAGG + Intergenic
912337138 1:108873857-108873879 CCTTCTTGTAACTCTCTGCATGG + Intronic
913321103 1:117589107-117589129 CTTTCCAGCCCCTCACTGCAAGG - Intergenic
915653314 1:157335816-157335838 CCTTCCAGTCACCTTCTGGATGG + Intergenic
916116697 1:161490934-161490956 CCTTCCAGTCTCCCATTCCATGG - Intergenic
916785841 1:168086539-168086561 CCTGCCACTCACTCATGGCAGGG + Intronic
918584525 1:186170553-186170575 CCTTCCAGTCTATCACTGATGGG - Intronic
919522367 1:198604239-198604261 CCTTCTCCACACTCACTGCAAGG + Intergenic
919602603 1:199641025-199641047 ACTTCCAGTGACCCACTGCCTGG - Intergenic
920033208 1:203049471-203049493 CCTTCCACTCACTCTCTGGTTGG + Intronic
920044424 1:203124342-203124364 ACTTCCAGGAAGTCACTGCAGGG + Intronic
923342972 1:233023091-233023113 CCTTCCAGCCACTTGCTTCACGG + Intronic
924131038 1:240908583-240908605 CCTTCCACTCCCTCCCTGCCAGG + Intronic
924438137 1:244063673-244063695 CCTTGCAGCTAGTCACTGCAGGG + Intergenic
1064793502 10:18986512-18986534 CTTTCCTGTCAATCAATGCATGG - Intergenic
1066706255 10:38182101-38182123 TCTTCCAGTCACTTTCTGTAGGG + Intergenic
1067414343 10:46092206-46092228 CCTCCCAGTTCCTCACTGCAGGG - Intergenic
1067434407 10:46266752-46266774 CTTCCCAGTTCCTCACTGCAGGG - Intergenic
1067439291 10:46299604-46299626 CCTCCCTGTTCCTCACTGCAGGG + Intronic
1067581543 10:47449675-47449697 CCTCCCTGTTTCTCACTGCAGGG + Intergenic
1070810281 10:79294093-79294115 CCTTCCAGTCACTTCCCGGACGG - Intronic
1071574730 10:86716789-86716811 CCTTCCAGTGCCCCAGTGCAGGG - Intronic
1071981787 10:91010672-91010694 CATTCCAGGCACTCCTTGCAGGG + Intergenic
1072550027 10:96470164-96470186 CTTTCCAGACACTCTCTGCAAGG + Intronic
1073857459 10:107693978-107694000 CCTTCCAATCACTGACCCCATGG - Intergenic
1073931700 10:108584272-108584294 CCTTCAATTCACTCTATGCAGGG - Intergenic
1074753510 10:116608688-116608710 TCTTCCAGTCACTCTCGGAAGGG - Intronic
1076928387 10:133507778-133507800 CCTTCCAGTTTCTCCCTGGAAGG + Intergenic
1077010982 11:379230-379252 CCTTCCAGCCACCCCCTCCAGGG - Intronic
1077866924 11:6230117-6230139 CCTTACAGCCACACACAGCAAGG + Intronic
1078414169 11:11151612-11151634 CTTTCCTTTCACTCACTCCAGGG + Intergenic
1079002302 11:16768167-16768189 CCTTCCACTAGCTCACTACAGGG + Intergenic
1080773423 11:35363637-35363659 TCTTCCAGCAACTCTCTGCACGG + Intronic
1083718753 11:64593627-64593649 CCGTCCACTCCATCACTGCAAGG - Exonic
1084009394 11:66339177-66339199 CCTTCCATTCACTCAAGTCATGG + Intronic
1085353036 11:75812875-75812897 TCATCCAGTTACTCACTGCTGGG - Intergenic
1085850592 11:80115103-80115125 TTTTCCAGTCTATCACTGCAGGG - Intergenic
1088811283 11:113394452-113394474 CCTTCCTGGCCCTCAATGCATGG + Intronic
1088834554 11:113566958-113566980 GCTTCCAGCCACTCCCAGCATGG + Intergenic
1090171766 11:124611777-124611799 CCCTCATGTCACTCTCTGCATGG + Intronic
1091262622 11:134246144-134246166 CCTTCTGGCCACTCACTGCTGGG + Exonic
1091908193 12:4206430-4206452 CCTGCCAGTCACCCTCTGCTAGG + Intergenic
1092957077 12:13560880-13560902 TCTTCAAGTCACTCCCTCCAGGG - Exonic
1095955002 12:47800794-47800816 CCTTCCCCTCACACTCTGCATGG + Intronic
1100765698 12:97863067-97863089 CCTTCCTGGCTCTCACAGCAAGG - Intergenic
1100843512 12:98636893-98636915 CCTTCCTGTCCCTCCCTGCCAGG + Intronic
1102599382 12:114017669-114017691 CCCACCAGTCAGTCACTGCATGG - Intergenic
1105296802 13:19094810-19094832 CCTTTCAGTCACTGACTTCCAGG - Intergenic
1105599589 13:21874886-21874908 CCTCTCAGGCACTCACTGCTTGG + Intergenic
1105896640 13:24722019-24722041 CATGCTAGGCACTCACTGCAGGG + Intergenic
1106693180 13:32141831-32141853 ACTGCCAGTCACTGACTTCATGG - Intronic
1107181547 13:37467056-37467078 CCTCCCAGCCAATAACTGCATGG + Intergenic
1107908380 13:45082815-45082837 CCTTGAAGACAGTCACTGCAGGG - Intergenic
1110045139 13:70818739-70818761 TTTACCAGTCACTAACTGCAGGG + Intergenic
1110342989 13:74414344-74414366 CCTTCCCGTCGCTCACAACATGG - Intergenic
1111060920 13:83017584-83017606 CTTTGAAGTAACTCACTGCATGG - Intergenic
1112013004 13:95307777-95307799 CCTTTCTGTCACTCACTCAAAGG + Intergenic
1113707213 13:112442684-112442706 CCCTGCAGTCCCTCCCTGCACGG + Intergenic
1115063231 14:29220470-29220492 ATTTCCATTCACTCACTGGAGGG - Intergenic
1115130659 14:30049012-30049034 CTTTCCAGTCACTCAATAAATGG - Intronic
1117610950 14:57482964-57482986 CCTTTCATGCACTCTCTGCATGG - Intronic
1119669680 14:76508928-76508950 CCTGCCACTCACTGGCTGCATGG + Intergenic
1121830461 14:97047174-97047196 TGTTCCAGTCACTCATTGCCAGG + Intergenic
1122637698 14:103138159-103138181 CCCTCCTTTCTCTCACTGCACGG - Intergenic
1124030263 15:26004216-26004238 CCTTCTAGGCAATCACTGCCAGG - Intergenic
1124126895 15:26944735-26944757 CCTTCCAGCAACACAGTGCAGGG - Intronic
1129653891 15:77510180-77510202 TCTTCCAAACACTCACTGGAAGG + Intergenic
1130993318 15:88889718-88889740 CCTTCCACTCAGCCCCTGCAGGG - Intronic
1131984880 15:98033135-98033157 CCTTCCAGGAACTCACAGCTTGG + Intergenic
1132467633 16:84791-84813 CCTTCCACTGAGTCATTGCATGG + Intronic
1132748978 16:1448680-1448702 CCTCACACTCACTCACTGCCAGG - Exonic
1137055469 16:35744342-35744364 TCTTCAGGTCACTCACTGCCAGG - Intergenic
1137931216 16:52589266-52589288 CATTCCAGCCACTCTCTGGAGGG + Intergenic
1138206624 16:55130364-55130386 CTCTCCAGTCCCCCACTGCAGGG + Intergenic
1138627490 16:58264203-58264225 ACTTCCAGGCCCTCACTGCCTGG + Intronic
1140539919 16:75747498-75747520 TCTACCAGGCACTCCCTGCATGG + Intronic
1141081399 16:81056345-81056367 TCTTCCTGTCACTGACTGAATGG + Intronic
1142259761 16:89037220-89037242 CCTGCCCAGCACTCACTGCAGGG - Intergenic
1143788183 17:9272356-9272378 CCTACCAGCCACTCCCTGCCGGG - Intronic
1143892460 17:10113066-10113088 CCATCCACTCACTGCCTGCATGG + Intronic
1145086459 17:19945721-19945743 CTTTGCACTCACTCACTGCTGGG - Intronic
1145276461 17:21434278-21434300 CCTTGCAGTCACCCACTCCCAGG + Intergenic
1145314302 17:21720171-21720193 CCTTGCAGTCACCCACTCCCAGG + Intergenic
1145712750 17:26992147-26992169 CCTTGCAGTCACCCACTCCCAGG + Intergenic
1149154248 17:53607516-53607538 CCTACCAGACACTCCCTACAGGG + Intergenic
1152703741 17:81832693-81832715 CCTTCTAGGCACTCACTGGGCGG - Intronic
1153527655 18:6013105-6013127 CCTTCCAGTCACTCACTGCAGGG + Intronic
1153537765 18:6120625-6120647 TCTTCCAGTCACTCCCTGTAGGG + Intronic
1153893173 18:9536636-9536658 CCTGCCAGTTCCTCACTGCGGGG + Exonic
1154078921 18:11234877-11234899 GTTTCCAGTCCCTGACTGCAAGG - Intergenic
1157774284 18:50379470-50379492 CCTTCCACACACACACTGAAGGG + Intronic
1159731663 18:72034798-72034820 CATTCCAGTCACTCCATACATGG - Intergenic
1160254456 18:77235992-77236014 CCTTCCAGCCACTGATTGCCAGG - Intergenic
1160451897 18:78972039-78972061 CCTTTCAGCGACTCACTGAAAGG + Intergenic
1160859548 19:1231853-1231875 CCTTCCACTCACTCGCTTCCTGG - Intronic
1161373021 19:3924198-3924220 CCATCCATTCACTCAATGGAGGG - Intronic
1161570919 19:5030524-5030546 CCTCCCTGTAACCCACTGCAAGG - Intronic
1161775315 19:6258869-6258891 CCTTCCAGTCAGTCTGGGCAAGG - Intronic
1162573186 19:11484026-11484048 GCGGCCTGTCACTCACTGCAGGG + Exonic
1162736806 19:12751597-12751619 CCTCCCAGTCGCTCACTGGCAGG - Intergenic
1164779750 19:30882869-30882891 CTTTCCATTCACACCCTGCAGGG + Intergenic
1165489271 19:36114021-36114043 TCTTCCAGTCACACAGTGCGCGG - Exonic
1166099826 19:40565402-40565424 CCTGCCTGCCACCCACTGCAGGG + Exonic
925298692 2:2795001-2795023 CCTTCCGGTCACTCAAGGGAGGG - Intergenic
926152146 2:10431238-10431260 CTGTCCTGACACTCACTGCATGG + Intergenic
928365012 2:30693833-30693855 CCTTCCAGTGCCTCAAGGCAAGG - Intergenic
928414347 2:31079257-31079279 GCTTCCATTCACTCGCTGTATGG + Intronic
928416282 2:31094754-31094776 CCATACAGACACTCACTGTAAGG + Intronic
931916298 2:66960523-66960545 CCTTCCACTCACCCACAGGAAGG + Intergenic
935222338 2:101026481-101026503 CCCTGCAGTCACTGACTGCGGGG + Intronic
938565641 2:132516035-132516057 TCTTTCCGTCAGTCACTGCAAGG - Intronic
939181798 2:138811844-138811866 CCTTCCTCTCACTCTCTGAAAGG + Intergenic
939197569 2:138991428-138991450 CCTTCCAGGCACTCAGAGAAAGG - Intergenic
941096600 2:161244911-161244933 CCTTCCAGTGCCACACTGCGGGG + Intergenic
944977150 2:205066939-205066961 CCTTCCCCTCACGCACTGCATGG - Intronic
945222969 2:207503492-207503514 CCTCCCATGCACACACTGCATGG + Intergenic
945976259 2:216273562-216273584 CCTTCCACCCACTCTCTGCCAGG + Intronic
947195805 2:227566085-227566107 TCTTCCAGTGACTGACTTCATGG - Intergenic
1169260628 20:4135747-4135769 CCTTCCAGTGACTCAGAGGATGG + Intronic
1172357912 20:34292493-34292515 CCTTCCAGGCATACACTGGAGGG + Exonic
1172779755 20:37429249-37429271 CCTTCTTGTCACTCAGTGCTAGG + Intergenic
1173410674 20:42806875-42806897 CCTCTCTGTCACTCACTGCCTGG + Intronic
1173938577 20:46890545-46890567 GCTTCCAGGCAGCCACTGCAAGG - Intergenic
1174444495 20:50581376-50581398 GCTTCCAGTAACTCAGTGCATGG - Exonic
1175225577 20:57442085-57442107 TCTTCCAGGAACTCCCTGCAGGG - Intergenic
1176969824 21:15252661-15252683 CTCTCAAGTCACTCTCTGCAAGG - Intergenic
1178892685 21:36533238-36533260 CCATCCAGCCACTCTCTGCCTGG - Intronic
1179580546 21:42340783-42340805 CAGTCCAGTCACTCGCTGCACGG - Intergenic
1181282068 22:21727393-21727415 CCTTTCAGTTACTTACTTCAGGG - Intronic
1182494552 22:30696623-30696645 CCTTCAAGTCACCCACTACAGGG + Intronic
1182668193 22:31973957-31973979 CACTCCTGTCACTCACTGCCTGG - Intergenic
1183423674 22:37726157-37726179 CCCTCCACTGACTCTCTGCATGG + Exonic
1184410321 22:44322485-44322507 GCTCCCTGTCACCCACTGCATGG + Intergenic
950014831 3:9748161-9748183 CCTGCCACTCACTCCATGCATGG - Intergenic
950500648 3:13361512-13361534 CCCTCCAGTGACACACAGCAGGG + Intronic
954841709 3:53517191-53517213 CCTTCTAATCCCTCACTGCAAGG + Intronic
956031483 3:65042681-65042703 CCTTCCTTGAACTCACTGCAGGG - Intergenic
956720220 3:72110854-72110876 CCTTCCACCTACTCAATGCATGG - Intergenic
959790185 3:110350978-110351000 TCTTCCAGTCAATAGCTGCATGG - Intergenic
960759514 3:121057486-121057508 CCTTCCAGTCACTTACCCCCAGG + Intronic
961453420 3:127012906-127012928 GCTTCCTGTAACTCACTGCAGGG + Intronic
961832753 3:129632597-129632619 CCTCCCAGTCCCTCAATGGATGG - Intergenic
962197155 3:133374007-133374029 CGTTCCTGTTACTCTCTGCAAGG + Intronic
964082772 3:152779953-152779975 CCTGCTCCTCACTCACTGCATGG + Intergenic
968966403 4:3771122-3771144 CCTGCCAGTCACACCCTCCAGGG + Intergenic
969576463 4:8038895-8038917 GCTCCCAGTCACTCACAGCCTGG + Intronic
970670815 4:18394865-18394887 CTTAACATTCACTCACTGCAAGG - Intergenic
973061172 4:45727217-45727239 CCTTCTAATCACTCTCTTCAAGG - Intergenic
974949771 4:68573837-68573859 ACTTCCTGTCTCTCACGGCAGGG - Intronic
977162996 4:93659626-93659648 TCTGCCAATCATTCACTGCAGGG - Intronic
977653813 4:99498683-99498705 CCTTCCAGTTATTAAATGCAAGG - Intergenic
978314291 4:107418429-107418451 ACTTCATGTCTCTCACTGCAGGG + Intergenic
979609086 4:122670601-122670623 CCTGCCAGTCCCTCACCGCAGGG - Intergenic
984141730 4:176012385-176012407 CCTCCCAGTGCCCCACTGCAGGG + Intergenic
984788431 4:183591525-183591547 GCTTCCAGTGACTCCCTCCAAGG + Intergenic
986112744 5:4736041-4736063 CCTTCCAGTAACACATTCCATGG + Intergenic
987261825 5:16211923-16211945 CCTTCCAGCCACTGTCTCCAAGG + Intergenic
988942042 5:36156547-36156569 CTTTCCATACACTCACTCCAAGG - Intronic
989305276 5:39947978-39948000 ACTTCCAGTCACACACTGGAGGG - Intergenic
989730393 5:44641424-44641446 CCTTCCTGTCACCCACAACATGG + Intergenic
993007202 5:82441525-82441547 CCTTCCCCTCACTGATTGCATGG - Intergenic
1006896775 6:37476249-37476271 CCCTCCTGTCCCTCACTGGACGG - Intronic
1007276534 6:40678400-40678422 GCTTCCAGCCACTGACTGAATGG - Intergenic
1008854471 6:56065424-56065446 CCTTCAAGTCACTCACTGTGTGG + Intronic
1010317821 6:74470966-74470988 ACTTCCTGTCTCTCACGGCAGGG + Intergenic
1011173546 6:84534477-84534499 CCTTTCAGTCAGTCAGTGTATGG - Intergenic
1012306679 6:97667518-97667540 TCTTCTAGTTACTAACTGCATGG - Intergenic
1013013227 6:106138351-106138373 GCTTCAAGTCACTCTCTGCTTGG - Intergenic
1017757288 6:157540191-157540213 CCTGCCACACTCTCACTGCAGGG - Intronic
1018798785 6:167207150-167207172 CCTTCCAGTCAGTGACAGCCAGG - Intergenic
1019994541 7:4715652-4715674 CCTGCCAGTCAGTCACAGCAGGG - Intronic
1021786667 7:24159092-24159114 ACTTCCAGTCAGTCTCAGCAGGG + Intergenic
1022414977 7:30169881-30169903 CATTCCAGCCACTCACCGAAGGG + Intergenic
1024192525 7:47027312-47027334 CCTTCCAGTCACTAACCACATGG + Intergenic
1024423504 7:49198275-49198297 CCTTCCACTGACTCTCTGGATGG + Intergenic
1024509525 7:50192442-50192464 CCTTCCACTCACTTGCTGCTGGG + Intergenic
1027232134 7:76278895-76278917 CCTTCCAGTCCCTAGCGGCAAGG + Intronic
1028610032 7:92700548-92700570 CCTTCCAGTCATTCCCTTCTGGG - Intronic
1029108191 7:98195296-98195318 CCCTCCAGACACCCACCGCAGGG - Intronic
1030112444 7:106038370-106038392 CCTTCCAGGCAGTGAGTGCAAGG + Intergenic
1036746293 8:11412398-11412420 CTTTCCTCTCACTCACTGAAAGG + Intronic
1040957134 8:52990895-52990917 CCTTCCAGTCTGTCACAGTAAGG - Intergenic
1042754560 8:72196423-72196445 CCTTCCACTCACCCACAGCAAGG - Intergenic
1043511916 8:80958230-80958252 CCTGACAGTAACTCTCTGCAGGG - Intergenic
1046455747 8:114458354-114458376 CATTCCAGTCACTGCCTGAAGGG + Intergenic
1049614261 8:143569289-143569311 CCTTCCAGTCTCTCCCTCCCAGG - Intronic
1049614293 8:143569364-143569386 CCTTCCAGTCTCTCCCTCCCAGG - Intronic
1050586840 9:7121783-7121805 CCTTCCATTCAATCAATGGAAGG + Intergenic
1051149309 9:14063280-14063302 CTCTTCAATCACTCACTGCAGGG - Intergenic
1051221925 9:14857870-14857892 CCTTCCAATCATTCACTGAGTGG + Intronic
1055772968 9:79736979-79737001 CCCTCCCGTCACTCACTCTAGGG + Intergenic
1062407562 9:136404039-136404061 CCTCCCAGGCACTCACTTGATGG + Exonic
1062717316 9:138017765-138017787 CCAGCCAGTCACTCCCTGGAGGG - Intronic
1189075824 X:37913124-37913146 ACATCCAGTCAGTCACTCCATGG - Intronic
1194740626 X:97569120-97569142 CATTCCAGACACTGTCTGCAGGG - Intronic
1198148982 X:133889351-133889373 ACTTCCAATCACTTCCTGCAGGG + Intronic
1198681718 X:139190181-139190203 CCTTCCTTTCACTGACTCCATGG - Intronic
1199310075 X:146311591-146311613 CATTCCAGTCACTCAAGCCAGGG - Intergenic
1200252224 X:154559746-154559768 CCTTCCACAGCCTCACTGCAGGG - Intronic
1200265544 X:154644670-154644692 CCTTCCACAGCCTCACTGCAGGG + Intergenic
1200875758 Y:8153061-8153083 CCTTCCAGACAGAGACTGCAGGG - Intergenic
1202239729 Y:22754114-22754136 CCTTCCAGACAGAGACTGCAGGG + Intergenic
1202478068 Y:25282241-25282263 CCTTCCAGACAGAGACTGCAGGG - Intergenic