ID: 1153527877

View in Genome Browser
Species Human (GRCh38)
Location 18:6014957-6014979
Sequence CAGTAGGAGTGGACTGAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 167}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153527873_1153527877 3 Left 1153527873 18:6014931-6014953 CCTGGTGGCTTAGATTCAGGCAG 0: 1
1: 0
2: 2
3: 9
4: 124
Right 1153527877 18:6014957-6014979 CAGTAGGAGTGGACTGAAGTGGG 0: 1
1: 0
2: 0
3: 19
4: 167
1153527868_1153527877 28 Left 1153527868 18:6014906-6014928 CCCTTGTAGAAATCAAGTGAGAA 0: 1
1: 0
2: 1
3: 28
4: 274
Right 1153527877 18:6014957-6014979 CAGTAGGAGTGGACTGAAGTGGG 0: 1
1: 0
2: 0
3: 19
4: 167
1153527869_1153527877 27 Left 1153527869 18:6014907-6014929 CCTTGTAGAAATCAAGTGAGAAA 0: 1
1: 0
2: 1
3: 22
4: 333
Right 1153527877 18:6014957-6014979 CAGTAGGAGTGGACTGAAGTGGG 0: 1
1: 0
2: 0
3: 19
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153527877 Original CRISPR CAGTAGGAGTGGACTGAAGT GGG Intronic
901124548 1:6919873-6919895 CAGTGGGAGATGACTGAATTAGG - Intronic
906306601 1:44723935-44723957 CAGGAGGAGGGGGCTGAAGGGGG - Intronic
909059615 1:70865266-70865288 CAGTAGGGGTGTGGTGAAGTGGG + Intronic
909106405 1:71414926-71414948 CAAGAGGAGTTGACTGCAGTAGG - Intronic
912821140 1:112868707-112868729 CAGTATGATTGGACAAAAGTGGG + Intergenic
915248566 1:154572631-154572653 CAGTAGGAGTGGTGTGTATTGGG + Intronic
915468795 1:156113860-156113882 CAGTAGAAAGGGACTGAAGGGGG + Intronic
916662419 1:166934976-166934998 CAGTAGTAGTGGACTCCTGTAGG + Intronic
917104278 1:171476736-171476758 CAGTAGGGGTTGAGAGAAGTAGG - Intergenic
920744813 1:208616745-208616767 CAGAAGCAGTGGACTGGGGTGGG + Intergenic
922139241 1:222865754-222865776 CAGTAGTACTAGACTGATGTTGG - Intergenic
923465526 1:234245094-234245116 GGGTAGGAGTGAAGTGAAGTTGG - Intronic
1063603311 10:7501156-7501178 GAGGAGGAGTGGAGTGGAGTCGG + Intergenic
1063638636 10:7809950-7809972 CAAAAGGAGAGGACAGAAGTTGG - Intergenic
1065448611 10:25830037-25830059 CAGTTAGAGTGGAAAGAAGTAGG - Intergenic
1068974628 10:62995062-62995084 TAAAAGGAGTGGACTGAAGCAGG - Intergenic
1069583951 10:69584575-69584597 CAATGGGAATGGAGTGAAGTGGG + Intergenic
1071400489 10:85264138-85264160 CAGTAGGAGTGTGGTGGAGTGGG - Intergenic
1075563807 10:123488522-123488544 CAGGAGGAGTGGACAAAACTAGG - Intergenic
1078282109 11:9912703-9912725 AAGTAGGAGTGTACTGTAGATGG - Intronic
1078766642 11:14304643-14304665 AAGTAGGGGAGGACTGCAGTGGG + Intronic
1079950956 11:26803775-26803797 CAGTAGCAGTGGACTTTAGTTGG - Intergenic
1081249083 11:40807131-40807153 GAGTAAAAGTTGACTGAAGTTGG - Intronic
1082857800 11:57824628-57824650 GAGTAGGGCTGGACTGAAGCTGG + Intergenic
1083447290 11:62716941-62716963 CACAAAGAATGGACTGAAGTAGG + Intronic
1084386341 11:68844878-68844900 CAGTAGGACTGGGCAGGAGTGGG - Intergenic
1084512016 11:69611972-69611994 CAGTGGGAGTGGGCTGAGGCCGG - Intergenic
1087669817 11:101092827-101092849 CAGTATAAGTAGGCTGAAGTAGG - Intronic
1088331268 11:108655147-108655169 CCTTGGGAGTGGACTGAATTTGG - Intergenic
1090040930 11:123290775-123290797 CAGTGGGAGAACACTGAAGTGGG - Intergenic
1090135498 11:124194260-124194282 CAGTATGAGTGAAGTGAAATAGG + Intergenic
1091201622 11:133784984-133785006 TGCTAGGAGTGGACTGAAATAGG - Intergenic
1091360685 11:134976680-134976702 GTGCAGGAGTGGCCTGAAGTGGG + Intergenic
1092902349 12:13071726-13071748 CATTATGACTGGTCTGAAGTGGG + Intronic
1095263870 12:40130963-40130985 CAGTATGAGTATACTGAAGCAGG + Intergenic
1097533014 12:60829443-60829465 CAGTTGGATTGCACTGAATTGGG + Intergenic
1098474109 12:70879567-70879589 CATTAAGATTGGACTGATGTTGG + Intronic
1099717827 12:86319119-86319141 CAGTAGGAGTAGAAAGGAGTAGG - Intronic
1105039301 12:132949229-132949251 TAGTGGGAGTGGGCTTAAGTAGG - Intronic
1106194037 13:27478081-27478103 GTGTAGGAGGGGGCTGAAGTGGG + Intergenic
1106715343 13:32382581-32382603 CACTTTCAGTGGACTGAAGTGGG + Intronic
1111526535 13:89478096-89478118 CAGTAGAAGTGGGCTGAAGGTGG + Intergenic
1115471400 14:33772325-33772347 CAGTAGGAGTCTATTGAAGGGGG - Intronic
1115933264 14:38522076-38522098 GAGTAGGAGTGTATAGAAGTTGG + Intergenic
1116785559 14:49284513-49284535 CAGCAAGAGTGGCCTGAGGTGGG - Intergenic
1117679858 14:58192855-58192877 CAGTAGGAATGGAGTAAAATAGG + Intronic
1118024907 14:61759231-61759253 CCCTAGGAGTAGACTGAAGCTGG + Intergenic
1118151773 14:63197257-63197279 CAGTAGCCATGGACAGAAGTAGG - Intergenic
1118328785 14:64800099-64800121 CAGAAGGAGTAGACTGGAATTGG + Intronic
1120336779 14:83167612-83167634 CAGTGGGAGTGGAGTAAGGTGGG - Intergenic
1121418463 14:93795681-93795703 CACAAGGAGTGGACTGTACTGGG + Intergenic
1125896797 15:43309245-43309267 CAGTATGAGTGGAATGAGGTTGG + Intergenic
1127597158 15:60497162-60497184 CAGGAGGAGGGTACTAAAGTCGG - Intronic
1128781171 15:70359622-70359644 TGGTAGGTGTGGACTGGAGTTGG + Intergenic
1128924384 15:71641092-71641114 CATTAGCAGTTGACTGAAGATGG - Intronic
1129444856 15:75609842-75609864 CAGTAGGCCTGGTCTGTAGTGGG - Intronic
1130550079 15:84884766-84884788 CAGTAGGAGAGGAGGGAAGGCGG + Intronic
1136220391 16:28824055-28824077 CAGTAGGAGGGGAGCGAGGTGGG + Intronic
1137753755 16:50885651-50885673 CAGTAGGGCTGGAATGCAGTAGG - Intergenic
1141265272 16:82490939-82490961 AAGGAGGAGTGGACAGCAGTAGG + Intergenic
1150717493 17:67584211-67584233 GAGTGGGAGTGGAATGGAGTGGG - Intronic
1152069826 17:78128902-78128924 CAGGAGGAGGGGTCGGAAGTTGG - Intronic
1152800125 17:82327061-82327083 CAGGAGGGGTGGACTGAGGTTGG - Intronic
1153527877 18:6014957-6014979 CAGTAGGAGTGGACTGAAGTGGG + Intronic
1154492848 18:14934437-14934459 GAGGAGCAGTGGACTGAGGTGGG - Intergenic
1155426832 18:25715915-25715937 GAGTAGGAGTGCACAGAAGTGGG - Intergenic
1157516679 18:48316286-48316308 GAGTAGGAGCTGCCTGAAGTGGG + Intronic
1159340928 18:67132216-67132238 TAGTAGGAGTGGAGTAAACTTGG + Intergenic
1160022830 18:75193620-75193642 TAATAGGAGTGGCCTGCAGTGGG - Intergenic
1160085926 18:75777770-75777792 AAGTAGGAGGTGACTGGAGTGGG - Intergenic
1160358007 18:78244998-78245020 CAGTAGGAGGGTTCTGAAGGAGG - Intergenic
1161413197 19:4128734-4128756 GAGTAGTAGTGGACTGCAGCTGG - Intergenic
1162376885 19:10310241-10310263 GAGTAGGAGTGGACTCATATTGG - Exonic
1163730992 19:18949104-18949126 CAGTACAAGTGCTCTGAAGTGGG - Intergenic
1165921906 19:39304296-39304318 CAGTGTGTCTGGACTGAAGTGGG - Intergenic
1166975942 19:46605076-46605098 CAGCAGCAGAGGACTGAAGCTGG - Intronic
1167714214 19:51130792-51130814 ATGGAGGAGTGGACTGAAGTGGG - Intronic
1168669664 19:58230965-58230987 TGGTGGGAGGGGACTGAAGTAGG + Intronic
926835653 2:17016598-17016620 CAGCAGGTGTGGAATGAAGTGGG - Intergenic
927221326 2:20712536-20712558 CATTATGAGTTGACAGAAGTAGG + Intronic
930157244 2:48118308-48118330 GAGTAGGGGTGGACTGGGGTGGG + Intergenic
935193495 2:100796743-100796765 CAGAAGGCGTGGACTGGAGCAGG - Intergenic
935527561 2:104189926-104189948 CAGTAGGAGTGGGCTCATGAAGG - Intergenic
935572353 2:104675506-104675528 CAGAAGGGGAGAACTGAAGTGGG + Intergenic
937363469 2:121244669-121244691 CAGTAGGAGAGAATTGAGGTAGG - Intronic
941015096 2:160346561-160346583 CAGGAGGAGTGGACGGATGATGG - Intronic
942402002 2:175612734-175612756 AAGGGGGAGTGGACTCAAGTGGG + Intergenic
942977264 2:182033010-182033032 CAATTGGAGTGGAGTGAATTTGG - Intronic
946119690 2:217499028-217499050 CAGTAGGAGTAGAATGAATGAGG + Intronic
947498647 2:230656934-230656956 CAGTGGGAGTGGCCTGGAGGGGG + Intergenic
947655231 2:231821093-231821115 CAGTAGGAGGGGAATGAGCTGGG - Intergenic
947794714 2:232887006-232887028 CAGGAGGAGTGGCCCGAGGTGGG + Intronic
948010108 2:234645678-234645700 CAGTGGGAGTAGACAGCAGTGGG - Intergenic
948469293 2:238167023-238167045 CAGGAGGACAGCACTGAAGTGGG - Exonic
948674919 2:239591617-239591639 CAGGAGGTGTGGACGGCAGTGGG + Intergenic
1170955747 20:20978020-20978042 CAGTAAGAGTGGGCTGAGATAGG - Intergenic
1171442783 20:25178858-25178880 CAGTTGGAGCTGACTGGAGTTGG - Intergenic
1172799153 20:37564289-37564311 CAGAAGGCGTGGACAGAACTCGG - Intergenic
1177435358 21:21045206-21045228 CATCAGGAGTGGACTGGAGTGGG - Intronic
1179535475 21:42048730-42048752 CAGATGGAGTGGACGGTAGTAGG + Intergenic
1180790339 22:18572337-18572359 GAGTGGGAGGGGACTGAAGGGGG - Intergenic
1181231399 22:21422978-21423000 GAGTGGGAGGGGACTGAAGGGGG + Intronic
1181247251 22:21511890-21511912 GAGTGGGAGGGGACTGAAGGGGG - Intergenic
1182429633 22:30292099-30292121 CAGGAGGAGGGGGCTGAAGGAGG + Exonic
1183799699 22:40151937-40151959 CAGAAGGAGAGAACAGAAGTTGG + Intronic
1183844791 22:40533473-40533495 TACTAGGAGTGGACAGAAATGGG - Intronic
1185133931 22:49057923-49057945 CACTTGGAATGGACTGAAGCTGG + Intergenic
950684429 3:14606283-14606305 CAGTAGGGGAGGAATGAAGGAGG + Intergenic
953430735 3:42837644-42837666 GAGTATGAGTGGACTAATGTGGG - Intronic
957567348 3:81902162-81902184 CAGTAGGGGTGCACTGAAATGGG - Intergenic
958806714 3:98819774-98819796 AAGGAGGACTGGATTGAAGTTGG - Intronic
959837162 3:110932851-110932873 CAGTAGGAATGGTCTGGATTTGG - Intergenic
960983492 3:123254487-123254509 AAGTGGGAGTGGACAGAGGTGGG - Intronic
961672039 3:128540216-128540238 CAGTAGGAATGGAAAGAATTGGG + Intergenic
964633184 3:158834586-158834608 CAGTAGGAATGGAATGGATTGGG + Intergenic
964986136 3:162741903-162741925 CTGTAGGTGTGCACCGAAGTTGG + Intergenic
965834995 3:172841343-172841365 CGGTAGAAGTGGACAGAAGGGGG - Intergenic
967494761 3:190130273-190130295 CAGCAGGACTGGACTGGTGTAGG - Intergenic
967575924 3:191093200-191093222 CAGTAGAACAGGACTCAAGTGGG + Intergenic
969548123 4:7845498-7845520 CACTAGGAATGGGCTGAAGAAGG + Intronic
970820267 4:20204175-20204197 CAGTAGGACTGGATGGAAGAAGG + Intergenic
974506963 4:62787868-62787890 CAGGAGGAGGAGTCTGAAGTGGG + Intergenic
978311731 4:107391640-107391662 CTGTAGGATTGGCCTAAAGTTGG - Intergenic
982167704 4:152629733-152629755 GAGTAGGAGAGCACTGAAGTAGG - Intronic
983231870 4:165136801-165136823 CACTGGGACTGGACTGAGGTAGG - Intronic
983347685 4:166547322-166547344 TAGTAGGACTGGACTAAAGAGGG + Intergenic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
985349071 4:189038398-189038420 AAGTAGGGAAGGACTGAAGTAGG - Intergenic
987702901 5:21424635-21424657 TAGAAGTAGTGGACTAAAGTTGG + Intergenic
989469911 5:41803935-41803957 CAGTGGTAGTGGACAGTAGTGGG - Intronic
993471718 5:88314674-88314696 CAGAAGGAAAGAACTGAAGTAGG - Intergenic
993507857 5:88733232-88733254 CAGTAGGAAAGGGCTGAGGTAGG + Intronic
997522890 5:134534633-134534655 CAGCAGGAATGGACTGGGGTTGG + Intronic
998173701 5:139887265-139887287 GAGAAGGAGTGGCCTGAACTGGG - Intronic
1000361649 5:160453228-160453250 GATGAGGAGTGGGCTGAAGTGGG - Intergenic
1001327766 5:170741896-170741918 CAGAAGGGGTAGACTGGAGTTGG - Intergenic
1003990705 6:11483575-11483597 CAGGAGGAGGGGGCTGAAGAAGG - Intergenic
1007687398 6:43675079-43675101 CAGCAGGGGTGGACTGATGGGGG + Intronic
1012012258 6:93804368-93804390 CATTTTGAGTGGACTGAAGAAGG - Intergenic
1012310475 6:97718309-97718331 CAGTAGGAATGGACAAAAGAGGG + Intergenic
1013118000 6:107116563-107116585 CAATTGGAGTGGTCTGAAGGAGG - Intergenic
1015605583 6:134952057-134952079 CAGTAGAAGAGGACAGAAGCCGG + Intergenic
1015910524 6:138164159-138164181 CAGTGGAAATGGACTGGAGTGGG - Intronic
1017438224 6:154437961-154437983 CAGAAGGAGTAGACTGTGGTAGG - Intronic
1019686737 7:2386046-2386068 CAGGGGGAGTGGACTGCAGAGGG + Intergenic
1022610561 7:31867425-31867447 CAATAGTAGTGGACTGGACTGGG - Intronic
1022749420 7:33208150-33208172 ATGTAGGAATGAACTGAAGTTGG - Intronic
1023025613 7:36047333-36047355 CAGTAGGAGAGTCCTGGAGTTGG + Intergenic
1024208462 7:47183652-47183674 CAGTGGGAGTAGAGAGAAGTGGG + Intergenic
1025162668 7:56677209-56677231 CAGCAGGTGTGCACTGAAGTGGG + Intergenic
1025221477 7:57113734-57113756 CAGCAGGTGTGCACTGAAGTGGG + Intergenic
1025225433 7:57156238-57156260 CAGCAGGTGTGCACTGAAGTGGG + Intergenic
1025267898 7:57481268-57481290 CAGCAGGTGTGCACGGAAGTGGG - Intergenic
1025632261 7:63285403-63285425 CAGCAGGTGTGCACTGAAGTGGG + Intergenic
1025650299 7:63460825-63460847 CAGCAGGTGTGCACTGAAGTGGG - Intergenic
1025721716 7:64021897-64021919 CAGCAGGTGTGCACTGAAGTGGG - Intergenic
1025749260 7:64278439-64278461 CAGCAGGTGTGCACTGAAGTGGG - Intergenic
1026191787 7:68135616-68135638 TAGTAGGAGTGTGCTGAAATGGG - Intergenic
1027951887 7:84826686-84826708 CAGAAAGAGAGGACTGAAATAGG + Intergenic
1029189331 7:98760714-98760736 CAGTTGGAGAGGACAGAAGGAGG + Intergenic
1029219719 7:98978634-98978656 CAGTAAGAGTGGACTTCTGTGGG - Intronic
1031796848 7:126185934-126185956 AAGTAGCAGGGGAGTGAAGTGGG + Intergenic
1032432237 7:131871576-131871598 CAGTAGGAGTTAATTGAATTAGG - Intergenic
1032900141 7:136297809-136297831 CAGTTGGAGTGGGTTGAAGAGGG + Intergenic
1033037253 7:137886314-137886336 CAGAAGGAGTGGCCAGAGGTGGG + Intronic
1036643456 8:10598173-10598195 CGGCAGGTGTGCACTGAAGTGGG + Intergenic
1042204220 8:66312253-66312275 AAGTAGGAGAGGAATGAAGGAGG - Intergenic
1045721022 8:105111162-105111184 CAGAACTAGAGGACTGAAGTGGG + Intronic
1046255651 8:111693858-111693880 CAGTTTGATTGGACTGCAGTGGG + Intergenic
1047535941 8:125719650-125719672 CAGAAGGTGTGGAATGAAGAAGG - Intergenic
1047551507 8:125877754-125877776 AAGTGGGAGTGGACAGAAGGAGG - Intergenic
1048280941 8:133105335-133105357 CAGTAGGGGTGGACCGGAGGTGG + Intronic
1048842973 8:138581285-138581307 CAGCAGGGGTGGAGTGAGGTGGG - Intergenic
1049638203 8:143700636-143700658 CAGAAGGGGTGGAATGCAGTTGG + Intronic
1051847478 9:21468313-21468335 AAGTATGAGGGGACAGAAGTTGG - Intergenic
1058916126 9:109567980-109568002 CAGTAAGAGTGGACAGAGGGAGG + Intergenic
1059891878 9:118813090-118813112 AAATAGGAGTGGACTGAGGAGGG - Intergenic
1060898586 9:127237504-127237526 CAGTGGAAGGGGACTGAAGTGGG + Intronic
1187418106 X:19111015-19111037 TAGTAGGAGTAGAGAGAAGTGGG + Intronic
1191047117 X:56150338-56150360 CAGTAGGAGTGGGTTGTGGTGGG - Intergenic
1193291521 X:79778187-79778209 CATTAAGAGTGGACTGAGGGAGG - Intergenic
1194218985 X:91168052-91168074 CAGAGAGAGTGGACTGAAGAGGG - Intergenic
1197262523 X:124333685-124333707 CAGTAGGAGGCATCTGAAGTGGG - Intronic
1198990065 X:142503111-142503133 CAGTAGGAGTTGGCTAGAGTGGG + Intergenic
1200555498 Y:4631808-4631830 CAGAGAGAGTGGACTGAAGAGGG - Intergenic
1201857938 Y:18566104-18566126 CAGCAGGGGTGGGCTGAAGCAGG - Intronic
1201875383 Y:18754277-18754299 CAGCAGGGGTGGGCTGAAGCAGG + Intronic