ID: 1153530382

View in Genome Browser
Species Human (GRCh38)
Location 18:6040302-6040324
Sequence GCAATATCCAGAAGCACTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 216}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153530381_1153530382 -9 Left 1153530381 18:6040288-6040310 CCTGGAGATATTCAGCAATATCC 0: 1
1: 1
2: 3
3: 26
4: 215
Right 1153530382 18:6040302-6040324 GCAATATCCAGAAGCACTTTTGG 0: 1
1: 0
2: 3
3: 23
4: 216
1153530376_1153530382 16 Left 1153530376 18:6040263-6040285 CCAGAAGCAATTTTGTCCCCTTC 0: 1
1: 0
2: 1
3: 18
4: 216
Right 1153530382 18:6040302-6040324 GCAATATCCAGAAGCACTTTTGG 0: 1
1: 0
2: 3
3: 23
4: 216
1153530378_1153530382 0 Left 1153530378 18:6040279-6040301 CCCCTTCATCCTGGAGATATTCA 0: 1
1: 0
2: 1
3: 13
4: 186
Right 1153530382 18:6040302-6040324 GCAATATCCAGAAGCACTTTTGG 0: 1
1: 0
2: 3
3: 23
4: 216
1153530379_1153530382 -1 Left 1153530379 18:6040280-6040302 CCCTTCATCCTGGAGATATTCAG 0: 1
1: 0
2: 0
3: 17
4: 193
Right 1153530382 18:6040302-6040324 GCAATATCCAGAAGCACTTTTGG 0: 1
1: 0
2: 3
3: 23
4: 216
1153530380_1153530382 -2 Left 1153530380 18:6040281-6040303 CCTTCATCCTGGAGATATTCAGC 0: 1
1: 0
2: 2
3: 11
4: 160
Right 1153530382 18:6040302-6040324 GCAATATCCAGAAGCACTTTTGG 0: 1
1: 0
2: 3
3: 23
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153530382 Original CRISPR GCAATATCCAGAAGCACTTT TGG Intronic
901742403 1:11350838-11350860 GTATTTTCCAGAAGCACGTTAGG - Intergenic
901881026 1:12193854-12193876 GCAATGACCCGAAGCACCTTGGG + Intronic
902110791 1:14076604-14076626 GCCATATCTGGAAGCATTTTGGG - Intergenic
902684632 1:18067897-18067919 GAAAGAGCCAGAAGCACTTGGGG - Intergenic
903248460 1:22034423-22034445 ACAATGTCCAGAAACATTTTTGG - Intergenic
908151425 1:61306532-61306554 ACAAAATCTAGCAGCACTTTGGG - Intronic
910241350 1:85089690-85089712 GCAATGTCTAGAAACATTTTTGG - Intronic
910447911 1:87317582-87317604 GCAATGTCTAGAGACACTTTTGG - Intergenic
912693677 1:111823805-111823827 TCCATATCCAGAAACACTTTGGG + Intronic
917277649 1:173347910-173347932 GCAATATCTGGAGGCATTTTTGG - Intergenic
919130304 1:193442354-193442376 GCAATGCCCAGCAGAACTTTGGG + Intergenic
919213281 1:194516910-194516932 GGTACATCAAGAAGCACTTTGGG - Intergenic
921708513 1:218350335-218350357 GCAATGTCCAGAGACACTTTGGG + Intronic
922926629 1:229352477-229352499 GCAATGTCCAGAGACATTTTTGG + Intergenic
1063587631 10:7366906-7366928 GCAATATCTGGAGGCATTTTTGG - Intronic
1064061611 10:12142314-12142336 GCAATATCTAGAGACATTTTTGG - Intronic
1064835120 10:19518030-19518052 GCCAAACACAGAAGCACTTTAGG + Intronic
1066265282 10:33770893-33770915 GCTTTATCCAGTTGCACTTTTGG + Intergenic
1068109016 10:52656458-52656480 ACATTATCCAGTAGAACTTTCGG - Intergenic
1068279149 10:54846114-54846136 GCAATATCAACAAGCAAATTGGG - Intronic
1068613779 10:59089294-59089316 GAAATATCAATAAGCAATTTTGG - Intergenic
1068768483 10:60792996-60793018 GCAATATCTGGAGACACTTTTGG - Intronic
1072016175 10:91348987-91349009 GCAATATCTAGAGGCATTCTTGG + Intergenic
1074088159 10:110224387-110224409 GCAATGTCTAGAGGCATTTTTGG + Intronic
1074761215 10:116668831-116668853 GCAATGTCCAGAGGCATATTTGG + Intronic
1079712815 11:23708024-23708046 GACATTTCCAGAAACACTTTAGG + Intergenic
1082548401 11:54362869-54362891 GCAATTTCCAAACACACTTTTGG + Intergenic
1082828679 11:57599268-57599290 GCAATGTCCAGAGACATTTTTGG - Intronic
1084414965 11:69026608-69026630 GCAATGTCCAGAGGCATCTTTGG + Intergenic
1085289128 11:75384743-75384765 TCTGTATCCTGAAGCACTTTGGG + Intergenic
1087930491 11:103972307-103972329 GCAATATCTGGAAACAGTTTTGG - Intronic
1090574796 11:128089085-128089107 ACAATGTCCAGAAGAACTGTGGG - Intergenic
1090898816 11:131006582-131006604 GCAATGTCTAGAAGCACCTGAGG - Intergenic
1091038790 11:132257327-132257349 ACACTATCCTGAAGCACTTCTGG + Intronic
1091551579 12:1539131-1539153 GCAATGTCCAGAGACATTTTTGG - Intronic
1092994033 12:13931079-13931101 GCATTACCTAGAAGCACTTGAGG + Intronic
1094293262 12:28875532-28875554 GCAATATACATAGGCACATTTGG - Intergenic
1097083807 12:56453031-56453053 GCAAGATCCTGAAGCCCTTCTGG - Intronic
1099127538 12:78782621-78782643 GCAATATCTGGAAAAACTTTAGG + Intergenic
1099571432 12:84324146-84324168 GCACTGTCCAGAGACACTTTTGG - Intergenic
1099582159 12:84463187-84463209 GTAATATACAGAAGCACTTTGGG - Intergenic
1100902185 12:99253867-99253889 GAAAAATGCAGAATCACTTTTGG + Intronic
1101127235 12:101649163-101649185 GCAATATCCTGAAGAATTTCTGG - Intronic
1101674159 12:106902575-106902597 GGGATTTCCAGAAGCACTTTGGG - Intergenic
1101780858 12:107833998-107834020 GAAATATTCATAAACACTTTGGG - Intergenic
1102303532 12:111788300-111788322 GCAATGTCCAGAGACATTTTTGG + Intronic
1102691187 12:114762317-114762339 GCAATATCTAGAGACAATTTTGG + Intergenic
1102897426 12:116609878-116609900 GCAATGTCTAGAGGCATTTTTGG - Intergenic
1103235956 12:119372594-119372616 GCATTTTCCAGAAGCAGCTTTGG - Intronic
1108524362 13:51273216-51273238 GCAATGTCCTGAGGCATTTTTGG + Intronic
1109042969 13:57365361-57365383 GCAAATTCCAGAAGCATTCTTGG - Intergenic
1109391243 13:61696511-61696533 GCAATGTCTAGAAACATTTTGGG - Intergenic
1111728853 13:92046947-92046969 GTAATATTCAAAAGCACTTTTGG + Intronic
1112392063 13:98994331-98994353 GCACTATCTGGAAGCATTTTTGG + Intronic
1112805533 13:103160613-103160635 GAAATATCCCGAAGCAGTGTTGG - Intergenic
1115587566 14:34829869-34829891 GAGATATGCAGTAGCACTTTGGG - Intronic
1117301099 14:54429258-54429280 GCAATGTCCAGAGACATTTTTGG + Intronic
1121719081 14:96096814-96096836 GCTATTTCCAAAAGCACTTCTGG - Intergenic
1122045722 14:99021801-99021823 GTAATATCCAGAGACATTTTTGG - Intergenic
1122646422 14:103197340-103197362 GCAATAGTCAGAAGAACTGTGGG + Intergenic
1202928935 14_KI270725v1_random:22465-22487 GCAACATCTAGATGCACTTTTGG + Intergenic
1123904921 15:24911770-24911792 GCAATGTCCAGCAGAACTATTGG + Intronic
1123955000 15:25326013-25326035 GGGATAACCAAAAGCACTTTGGG - Intergenic
1125430741 15:39590665-39590687 GCAACAGCCTGAAACACTTTGGG + Intronic
1126618772 15:50615426-50615448 GCAATTTACAAATGCACTTTTGG + Intronic
1130687899 15:86055118-86055140 ACAATATCCAGAAGGATTCTTGG - Intergenic
1131280664 15:91018619-91018641 GCAATGTCCAGACACATTTTTGG + Intronic
1132728440 16:1348868-1348890 GCAATGTGCAGACGCATTTTTGG + Exonic
1134557132 16:15174974-15174996 GCAATATCGGGAGACACTTTTGG + Intergenic
1134914220 16:18056281-18056303 GGAATATCTAGAAACATTTTGGG + Intergenic
1134917711 16:18086685-18086707 GCAATATCGGGAGACACTTTTGG + Intergenic
1137939452 16:52669303-52669325 GCAATATCTGGAGGCATTTTTGG + Intergenic
1139639575 16:68281328-68281350 GCAATATCTGGAGACACTTTTGG + Intronic
1139826188 16:69759199-69759221 GCAATATTCAGTAGCACTGAAGG - Intergenic
1141137945 16:81478773-81478795 GCCATATCCAGAGGCACTCAGGG + Intronic
1142537668 17:630804-630826 GAAATATACTGAAGCACTTAGGG - Intronic
1143593278 17:7898817-7898839 ACAATATCCAGCAGCACCATGGG - Intronic
1143836138 17:9694414-9694436 GCAGTCTACAGAACCACTTTGGG - Intronic
1146675445 17:34770432-34770454 GCAATATCTGGAGACACTTTTGG + Intergenic
1147022393 17:37547175-37547197 ACACTATCTAGAAGCACCTTTGG + Intronic
1147029411 17:37619392-37619414 GTAATATTCACAAGCAGTTTTGG + Intronic
1148495754 17:48052718-48052740 GCAATATCGTGAAACAGTTTTGG + Intronic
1148670556 17:49407044-49407066 GTAATATACAGGAGCAGTTTGGG - Intronic
1149025647 17:52024610-52024632 AAGATATCCAGAAGCACTTTGGG + Intronic
1150623047 17:66822794-66822816 CCAATGTCCAGAGGCACTGTGGG - Intergenic
1151993511 17:77593858-77593880 GGAATATCCCGAACCCCTTTGGG + Intergenic
1152531038 17:80919325-80919347 GGATTATCCAGAGGCACTTTTGG - Intronic
1153530382 18:6040302-6040324 GCAATATCCAGAAGCACTTTTGG + Intronic
1154034396 18:10785454-10785476 CCAATTTCCAGTAGCAATTTGGG - Intronic
1157215763 18:45782202-45782224 GCAATGTCTAGAAGCATTTTTGG + Intergenic
1158011223 18:52730198-52730220 GCAATGTCCAGAGACATTTTTGG + Intronic
1158260739 18:55603259-55603281 GCAATATCTGGGAGCATTTTTGG - Intronic
1158451064 18:57565736-57565758 TTAATATCCAAAAGCAATTTGGG + Intronic
1158869170 18:61667622-61667644 GCAATCCCCAGTAGCTCTTTGGG - Intergenic
1160357641 18:78241842-78241864 GCAAAAGACAAAAGCACTTTTGG - Intergenic
1162102445 19:8347853-8347875 ACAATATCCAGGAGCACTTTTGG + Intronic
1162180317 19:8864394-8864416 GCAATATCCGAAATCATTTTTGG - Intronic
1165594889 19:37004525-37004547 GCAATGTCCAGAGTCATTTTTGG + Intergenic
925100646 2:1242120-1242142 GCTATATCCGGATGCGCTTTTGG + Intronic
929585088 2:43108578-43108600 GCAATATCCAGAGACATTTTTGG + Intergenic
930693248 2:54386044-54386066 GCAATGTCTAGAAACATTTTTGG + Intergenic
931550830 2:63444378-63444400 ACAATATCCAGGAGTATTTTTGG - Intronic
932741474 2:74294093-74294115 GCTCCATCCACAAGCACTTTTGG - Intronic
933594491 2:84269163-84269185 GCAATATCCTGAGCCATTTTTGG + Intergenic
934543906 2:95198940-95198962 GCAATAACCAGATGGACTTCTGG - Intergenic
937145813 2:119643474-119643496 GAAATGTCCAGAAGAACTTTGGG + Intronic
940933912 2:159469294-159469316 GCAATATCTGGAACAACTTTGGG + Intronic
941393936 2:164951489-164951511 GTAATAACTAGAAGCAGTTTAGG + Intronic
941943506 2:171069459-171069481 GCAATACCTAGAGGCATTTTTGG + Intronic
943078823 2:183231870-183231892 GCTATATACAAAAGCACTTCAGG - Intergenic
945218307 2:207458880-207458902 GCAAAATCTAGAAGTACTTCAGG + Intergenic
945864097 2:215157618-215157640 ACAATATTGAGAAGCAATTTGGG - Intergenic
945913281 2:215674541-215674563 GCAATATCTAGAGACATTTTTGG - Intergenic
946592613 2:221267775-221267797 GAAATAGCCAAAAGCCCTTTCGG + Intergenic
1169122567 20:3106113-3106135 GCACTGTCCAGGAGAACTTTCGG + Intergenic
1169484428 20:6015115-6015137 GAAATAACCAGAAGGACTTGAGG + Intronic
1170523732 20:17215622-17215644 GCAAAATCCATTAGCAATTTTGG - Intergenic
1170525767 20:17235492-17235514 ACAATATACAGAATCACTATTGG + Intronic
1172590857 20:36116810-36116832 GAAAAATCCAAAGGCACTTTAGG - Intronic
1173820853 20:46019399-46019421 GCAATATTCAGAGACATTTTTGG - Intergenic
1173946326 20:46953679-46953701 GCAATGTCCAGAGACACTTCTGG - Intronic
1174191550 20:48744206-48744228 GCAATGTCCAGACACATTTTTGG - Intronic
1174525267 20:51165408-51165430 GCAATATCCAGAGACATTTTTGG - Intergenic
1175725817 20:61317686-61317708 GCAACATCTAGAGGCATTTTTGG - Intronic
1176218230 20:63958141-63958163 ACAAGTTCCAGGAGCACTTTGGG - Exonic
1176590959 21:8651052-8651074 GCAACATCTAGATGCACTTTTGG + Intergenic
1178288496 21:31346047-31346069 GCAATATCTGGAGGCATTTTTGG + Intronic
1178962388 21:37077289-37077311 GCAATTTTAAAAAGCACTTTTGG + Intronic
1180273785 22:10628085-10628107 GCAACATCTAGATGCACTTTTGG + Intergenic
949136307 3:570633-570655 GCAACATCTAGATGCACTTTTGG - Intergenic
949700296 3:6748896-6748918 GCAATATCCTGAAGCAACCTGGG + Intergenic
949776720 3:7641422-7641444 GGAATATTTAGAAGCACTTGTGG + Intronic
950219445 3:11183379-11183401 GCAATGTCTAGAGGCATTTTTGG + Intronic
951011726 3:17689757-17689779 GCAATGTCTAGAAAAACTTTAGG + Intronic
951729439 3:25794738-25794760 GCAATATCTGGAAACACTTTTGG - Intergenic
953253614 3:41268043-41268065 GCAATGTCTGGAAACACTTTTGG + Intronic
956017966 3:64904367-64904389 GCAATGTCTATAATCACTTTGGG + Intergenic
956204640 3:66742510-66742532 GCAATGTCCAGAGACATTTTGGG - Intergenic
956338735 3:68195527-68195549 GCAAAGTCCAGAGGCATTTTTGG + Intronic
956756204 3:72389841-72389863 GCAATGTCTAGAAGCAAATTTGG - Intronic
958061484 3:88488439-88488461 GCAGTACCCATAACCACTTTGGG - Intergenic
960549887 3:118963408-118963430 GCAATAATCAGAAGCACTGAGGG + Intronic
961237112 3:125376100-125376122 GCAGTATGCAGAAGCACCTCAGG - Intergenic
963222094 3:142824267-142824289 GCAATATCTAGAAACATTTCTGG + Intronic
963426525 3:145135507-145135529 TCCATTTCCAGGAGCACTTTGGG - Intergenic
964380175 3:156090782-156090804 GCAATGTCTAGAGACACTTTGGG + Intronic
966401755 3:179554670-179554692 GCCAGATCCAGAAGCACATAGGG - Intergenic
966986845 3:185188461-185188483 GCAATAACCAGAAGAGTTTTTGG + Intergenic
967671607 3:192242382-192242404 GCAATGTTCATAAACACTTTTGG - Intronic
967675063 3:192288079-192288101 CCCAAATCCTGAAGCACTTTTGG - Intronic
969663720 4:8545085-8545107 GGAATCTCCAGCAGCCCTTTGGG - Intergenic
970335506 4:15036375-15036397 TTAGCATCCAGAAGCACTTTAGG + Intronic
971322648 4:25617768-25617790 GCTATCTCCAGGAGCAATTTGGG - Intergenic
971991183 4:33896870-33896892 GCAAAAACCAGAATTACTTTTGG + Intergenic
972285267 4:37642270-37642292 TCACTAACCAGAAGCACTTGAGG + Intronic
973035999 4:45407212-45407234 ACAATATTCATAAACACTTTGGG + Intergenic
973975923 4:56262304-56262326 GAAGTATCCAGAAGGTCTTTGGG + Intronic
976754742 4:88485808-88485830 GCAATATCCCAAAGTACTCTGGG - Intronic
979601309 4:122589174-122589196 GCAATATCTAGAGACATTTTTGG + Intergenic
981083755 4:140661621-140661643 GCAATATCTAGAGACATTTTTGG + Intronic
981516558 4:145616459-145616481 GCAATGTCCAGAGACATTTTTGG - Intergenic
981570542 4:146146358-146146380 GCAATGTCTAGAAACATTTTTGG - Intergenic
981738346 4:147976251-147976273 GCTAAATCAAGAAGCATTTTTGG - Intronic
981789983 4:148525686-148525708 GCACTATCCAGTAGAACTTTTGG + Intergenic
982331384 4:154185402-154185424 TGAAAATGCAGAAGCACTTTTGG + Intergenic
983892218 4:173041731-173041753 GTAATATCCAGAACCAGCTTGGG - Intergenic
985072310 4:186179279-186179301 GCAATATCAAAAAGCTCTTCAGG + Intergenic
986727513 5:10610303-10610325 GCAATGTCTAGAGGCATTTTGGG + Intronic
988730279 5:33965837-33965859 GCAATATCTAGAGACATTTTTGG - Intronic
991581261 5:68157447-68157469 GCAATATCCACAGACATTTTTGG - Intergenic
992391472 5:76335149-76335171 GCACTAGCCAGTAGCACTTTTGG - Intronic
992495328 5:77287464-77287486 GCAAAGTCAAGAAGCACTGTAGG - Intronic
992728247 5:79631177-79631199 GCAATGTCCATAGGCATTTTGGG - Intronic
995102721 5:108334037-108334059 GCAATTTCCAATAGCACTGTAGG - Intronic
998697420 5:144656035-144656057 GCAATGTCCTGAAGCTGTTTTGG + Intergenic
999378711 5:151105010-151105032 GCAATATCCAGACACATTTTTGG - Intronic
999886305 5:155926923-155926945 GCAATGTCCAGAGACACTTTTGG + Intronic
1000398668 5:160802426-160802448 GCAATGTCTAGAGGCATTTTTGG + Intronic
1000969391 5:167697135-167697157 GCACCATCCAGAGGCATTTTTGG - Intronic
1003819067 6:9875677-9875699 GGAATATTCAGAAGCACTTTAGG + Intronic
1003871581 6:10407882-10407904 CTTAAATCCAGAAGCACTTTAGG - Intronic
1004439096 6:15630091-15630113 TCAATATCCAGAAAGAATTTTGG - Intronic
1005034408 6:21542544-21542566 GTTATATCCAGGAGCAATTTGGG + Intergenic
1009454965 6:63845798-63845820 CCAATATCTAAAAGCTCTTTTGG - Intronic
1009881742 6:69575710-69575732 GCAAAATTCAGAAGAACGTTTGG + Intergenic
1011746509 6:90412474-90412496 GCAATGAGCAGAACCACTTTTGG + Intergenic
1012760057 6:103289619-103289641 GAAAAATCCACAAGCACTCTGGG + Intergenic
1013852058 6:114527971-114527993 GCAATATCTGGAGGCATTTTTGG + Intergenic
1014452190 6:121594317-121594339 GCAATATCTGGAGACACTTTTGG - Intergenic
1015299773 6:131639771-131639793 CCAATATCAAGAAGCTTTTTTGG + Intronic
1017715017 6:157203614-157203636 TCCACCTCCAGAAGCACTTTCGG + Intronic
1018748046 6:166777770-166777792 GTAATATTCAAAAGCAGTTTTGG + Intronic
1020107595 7:5429318-5429340 AGAATTTCTAGAAGCACTTTTGG + Intergenic
1022023622 7:26425288-26425310 GCAGTATACAGAAGCAATGTTGG - Intergenic
1024701261 7:51906720-51906742 GCAGTATCTTGGAGCACTTTGGG - Intergenic
1025031827 7:55563516-55563538 GCAAAATCCAAAAACACTTCTGG - Intronic
1027405767 7:77858766-77858788 ACTATATACAGAAGCACTCTTGG - Intronic
1027592932 7:80137075-80137097 GCAATATGTGGAAACACTTTTGG - Intronic
1028461017 7:91092637-91092659 GCAAACTCCAGAAGTACTTTAGG + Intronic
1030315007 7:108105616-108105638 GCAGAATCCACAAGCACTTGTGG + Intronic
1033713726 7:143977506-143977528 GCAAGCTCCTGAAGCACTCTTGG - Intergenic
1034975547 7:155447470-155447492 GCTATATACAAAAGCTCTTTGGG + Intergenic
1036045972 8:5140770-5140792 GCAAACTCCTGAAGCACATTCGG - Intergenic
1036718092 8:11145266-11145288 GCAAAATCCAAAAACACTTCTGG + Intronic
1041730744 8:61060219-61060241 GCACTTTCCAGCAGGACTTTAGG + Intronic
1042599719 8:70487022-70487044 GCAATATCTAGAGACATTTTTGG - Intergenic
1046223191 8:111241648-111241670 GCATTCTCCAGAAGCACACTTGG + Intergenic
1047394224 8:124479671-124479693 GCAATATCCAGGGACAGTTTTGG - Intronic
1047759483 8:127943628-127943650 GCAATGTCTGGAAACACTTTAGG - Intergenic
1048152721 8:131909812-131909834 GCAATATCTAGAGACACTTTTGG - Intronic
1049906637 9:223528-223550 GCATTATCCAAAAACATTTTTGG + Intronic
1050479022 9:6070606-6070628 GCAATGTCTAGAGGCATTTTTGG - Intergenic
1050634059 9:7591523-7591545 GCAATGTCTAGAAACATTTTTGG - Intergenic
1051112859 9:13659525-13659547 GCAATATCTAGAGACATTTTTGG + Intergenic
1055140770 9:72874702-72874724 GCAATGTCCAGAGACATTTTTGG + Intergenic
1057149798 9:92786193-92786215 GCAATGTCCAGAGTCATTTTTGG - Intergenic
1057777680 9:98024146-98024168 GCAATTTCCTGTAACACTTTTGG + Intergenic
1059194468 9:112357854-112357876 GCAATTTCCAGAGACATTTTTGG + Intergenic
1060252357 9:121996374-121996396 TCAATATGGAGAAGGACTTTGGG - Intronic
1060806582 9:126581430-126581452 GCAATGTCTGGAGGCACTTTTGG + Intergenic
1203620971 Un_KI270749v1:129776-129798 GCAACATCTAGATGCACTTTTGG + Intergenic
1185831524 X:3307719-3307741 GCAATGTCCAGAGACATTTTTGG + Intergenic
1186265374 X:7827410-7827432 CCAACACCCAGAAGTACTTTTGG - Intergenic
1186418002 X:9400186-9400208 GCAATACCCAGAACAGCTTTGGG + Intergenic
1186442245 X:9596442-9596464 GCAATATCTAGAGACATTTTTGG + Intronic
1186472300 X:9831281-9831303 GCAATGTCTAGAAACAGTTTTGG - Intronic
1186472727 X:9834039-9834061 GCAATGTCCAGAGGTATTTTTGG + Intronic
1186637411 X:11421425-11421447 GCAATGTCTGGAGGCACTTTTGG - Intronic
1187344001 X:18446436-18446458 TCAATGTCCAAAAGAACTTTTGG - Intronic
1187737208 X:22317095-22317117 GCAATGTCTGGAAGCAGTTTGGG - Intergenic
1188936967 X:36188227-36188249 GCAATTTCTAGAACCACTTTTGG + Intergenic
1189131787 X:38506505-38506527 GCAATAGGGAGAAGCACTTCAGG + Intronic
1189830894 X:44972025-44972047 GCAATACCAAGAAGCTTTTTTGG + Intronic
1191390673 X:60130618-60130640 GCAATTTCCAAATACACTTTTGG + Intergenic
1191393119 X:60163531-60163553 GCAGTTTCCAAAAACACTTTTGG + Intergenic
1191443889 X:60843401-60843423 GCAGTTTCCAAAAACACTTTTGG + Intergenic
1191535295 X:62066563-62066585 GCAGTTTCCAAAAACACTTTTGG + Intergenic
1191554372 X:62321751-62321773 GCAGTTTCCAAAAACACTTTTGG + Intergenic
1195615161 X:106906225-106906247 GCAGAACCCAGAAGCACTATAGG - Intronic
1199603103 X:149554922-149554944 GCAGTACCAAGAAGCTCTTTGGG - Intergenic
1199647285 X:149924553-149924575 GCAGTACCAAGAAGCTCTTTGGG + Intergenic
1201426175 Y:13852987-13853009 GAAATATCAAGAATCACTTGCGG - Intergenic
1201720996 Y:17097081-17097103 GCAATGTCTGGAGGCACTTTTGG - Intergenic