ID: 1153538413

View in Genome Browser
Species Human (GRCh38)
Location 18:6128631-6128653
Sequence TGGAATTGTACCCATGGCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 178}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153538408_1153538413 10 Left 1153538408 18:6128598-6128620 CCTTCAATATTCTGAAGGAAAAG 0: 1
1: 1
2: 23
3: 119
4: 517
Right 1153538413 18:6128631-6128653 TGGAATTGTACCCATGGCTGAGG 0: 1
1: 0
2: 0
3: 10
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153538413 Original CRISPR TGGAATTGTACCCATGGCTG AGG Intronic
900928626 1:5721673-5721695 CTGAATTGTACCCAGGGATGGGG + Intergenic
902775108 1:18669679-18669701 TGGGATTGTACTCAGGTCTGGGG - Intronic
905254832 1:36673688-36673710 GGGAATTGTACCCTTGGTGGGGG + Intergenic
905526030 1:38640539-38640561 TGGATTTGTTCTCATGGCAGTGG - Intergenic
905554551 1:38872206-38872228 TGGAATTGTTCGCAGGGATGAGG - Intronic
905704296 1:40042525-40042547 TGGAATTCTAGTAATGGCTGGGG + Intronic
910754602 1:90674125-90674147 TAGAATTCTACCCATCACTGTGG + Intergenic
911910442 1:103627852-103627874 ATGAATTGCACCCATGGATGTGG + Intergenic
911917860 1:103721977-103721999 ATGAATTGCACCCATGGATGTGG + Intronic
913956439 1:143301165-143301187 TGTAATTGTTCCTATGGATGTGG + Intergenic
913981000 1:143514502-143514524 TGTAATTGTTCCTATGGATGTGG - Intergenic
914075365 1:144340930-144340952 TGTAATTGTTCCTATGGATGTGG - Intergenic
914103813 1:144625566-144625588 TGTAATTGTTCCTATGGATGTGG + Intergenic
915964336 1:160293392-160293414 TGGACTTGTTCCCTTGGTTGGGG + Exonic
918296434 1:183161440-183161462 TGGAAGTGGTCCCGTGGCTGGGG + Intergenic
921524757 1:216202853-216202875 AGGAAATGTAACCATGCCTGTGG - Intronic
922930085 1:229382133-229382155 TGTCATTGTACCCATCCCTGGGG - Intergenic
923692148 1:236205143-236205165 TGGGACTGAATCCATGGCTGGGG - Exonic
924336502 1:242991429-242991451 TGGAATTATTCCCATAACTGGGG + Intergenic
1063578754 10:7286488-7286510 TTGAATTGAACCCAGGGATGGGG - Intronic
1067551372 10:47238680-47238702 TGGAATTGGAGCCAGGACTGGGG - Intergenic
1070015162 10:72520626-72520648 TGGAATTGTTCTCACAGCTGAGG - Intronic
1070404419 10:76082289-76082311 TTGAATTGTACCCTTGCCTCAGG + Intronic
1074413900 10:113250405-113250427 TGTAATTGTTCCCGTAGCTGAGG + Intergenic
1074789123 10:116868597-116868619 TGGAATTTTTAGCATGGCTGTGG - Intronic
1075908324 10:126102204-126102226 TGGCTTTGTACTCATGGTTGAGG + Intronic
1077268433 11:1663877-1663899 TGGATTTGTTCCCATGAGTGGGG + Intergenic
1077272446 11:1687741-1687763 TGGATTTGTTCCCATGAGTGGGG - Intergenic
1080618408 11:33966158-33966180 TGGAATTTTACTCATCGCTCAGG - Intergenic
1081455971 11:43223213-43223235 TGGAGCTGTCTCCATGGCTGGGG - Intergenic
1081598084 11:44473133-44473155 TGCAATCATACCCATGGCTTTGG + Intergenic
1081773554 11:45663955-45663977 TGGAAGTGTCCCCACTGCTGAGG + Intronic
1082796799 11:57383695-57383717 TGAAATGGTACCCCTGGCTTGGG - Intergenic
1084785387 11:71438902-71438924 TGGCATTGGTCACATGGCTGTGG + Exonic
1085254680 11:75165735-75165757 TGGAACAGTTCCCAGGGCTGGGG - Intronic
1087338680 11:96875634-96875656 TGGCATTTTGCCCTTGGCTGTGG - Intergenic
1089989865 11:122849322-122849344 GGGATCTGTACCCAGGGCTGTGG - Intronic
1094549702 12:31439223-31439245 TGGATTTATAACCATGCCTGTGG - Intronic
1096469264 12:51865938-51865960 TGGAATCGGACACTTGGCTGGGG - Intergenic
1098377210 12:69829619-69829641 TTGAATTCTAACCAGGGCTGGGG + Intronic
1098425778 12:70365453-70365475 TTGATTTGCCCCCATGGCTGGGG - Intergenic
1101030358 12:100652072-100652094 TGGCCTTGAACCCATAGCTGGGG + Intergenic
1102304011 12:111791341-111791363 TGGATTTGGCCCCACGGCTGGGG + Exonic
1104887786 12:132121045-132121067 TGAAATTGTCCACATGGCCGGGG - Intronic
1106060070 13:26281614-26281636 TTGATTTGGACCCATTGCTGGGG - Intronic
1108348316 13:49567462-49567484 AGGGATTGCACACATGGCTGGGG - Intronic
1110864185 13:80376152-80376174 TGCAGAGGTACCCATGGCTGCGG - Intergenic
1114484486 14:23054804-23054826 TGGCACTGTTCCCATAGCTGGGG + Exonic
1115073491 14:29357172-29357194 TGGAAATGGAGCAATGGCTGGGG - Intergenic
1118347828 14:64952425-64952447 AGGAATTTTACACATGGCAGGGG + Intronic
1119899949 14:78251059-78251081 TGGGATTGGACCCAAGGCTCCGG + Intronic
1123394282 15:19913433-19913455 TGTAATTGTTCCTATGGATGTGG - Intergenic
1124374430 15:29121352-29121374 TGGAATTGCAGCCATGTCTGAGG + Exonic
1125376910 15:39039865-39039887 TAGAATTGTAAGCAAGGCTGTGG + Intergenic
1126436065 15:48639108-48639130 TGGAATTTTACCAATGTCTTGGG + Intronic
1130145724 15:81272461-81272483 TGGAATTGTACAGGTGGCTCTGG - Intronic
1131717406 15:95128133-95128155 TGGATTTTTCCCCAAGGCTGTGG - Intergenic
1136031224 16:27504483-27504505 TGGAAGTGTTCCTATGGCAGAGG - Intronic
1136700301 16:32131322-32131344 TGTAATTGTTCCTATGGATGTGG - Intergenic
1136767351 16:32796144-32796166 TGTAATTGTTCCTATGGATGTGG + Intergenic
1136800797 16:33074557-33074579 TGTAATTGTTCCTATGGATGTGG - Intergenic
1136863605 16:33721311-33721333 TGTAATTGTTCCTATGGATGTGG + Intergenic
1140966257 16:79969019-79969041 TGGACTTGCAGACATGGCTGGGG + Intergenic
1141257086 16:82412346-82412368 TGGAGTTGTACCCATGTCAGTGG - Intergenic
1203069743 16_KI270728v1_random:1058166-1058188 TGTAATTGTTCCTATGGATGTGG + Intergenic
1144257780 17:13486695-13486717 TAAAATTGTTCCAATGGCTGTGG - Intergenic
1145057559 17:19713647-19713669 GGGGATTCTCCCCATGGCTGCGG - Intronic
1145324442 17:21790551-21790573 TGTAATTGTTCCTATGGATGTGG + Intergenic
1145710986 17:26976533-26976555 TGTAATTGTTCCTATGGATGTGG - Intergenic
1147469002 17:40639373-40639395 TGGAATTGTGCCCATAACTGAGG + Intronic
1149779903 17:59389016-59389038 AGGACCTGTGCCCATGGCTGTGG + Intronic
1153538413 18:6128631-6128653 TGGAATTGTACCCATGGCTGAGG + Intronic
1154516845 18:15178937-15178959 TGTAATTGTTCCTATGGATGTGG + Intergenic
1155364403 18:25035915-25035937 GGGAACTGCACACATGGCTGCGG + Intergenic
1163460685 19:17435780-17435802 TGGCTGTGGACCCATGGCTGAGG - Exonic
1163605814 19:18274721-18274743 TGGAATTTGCCCCATGTCTGGGG + Intergenic
1164678155 19:30117024-30117046 TGGGATTGTACCCCTGCCTGTGG + Intergenic
1166807000 19:45493293-45493315 TGGAATTGTCCCCACCTCTGTGG - Exonic
926459567 2:13111849-13111871 TGGAATTGTACAGAGGACTGAGG - Intergenic
932095292 2:68842196-68842218 TAGAAGTGTACCCATTGCGGGGG + Intergenic
936243789 2:110809311-110809333 TGGGAGTGTGCCCAGGGCTGGGG + Intronic
936698800 2:114984885-114984907 TGGAAATGGACACATAGCTGGGG - Intronic
936722919 2:115275641-115275663 AAGAATTGTTCCCATGGCTTAGG - Intronic
937985225 2:127635323-127635345 TGGGCTGGTACCCAGGGCTGAGG - Intronic
938517167 2:132023905-132023927 TGCAATTGTTCCTATGGATGTGG + Intergenic
941249432 2:163144121-163144143 TGAAGTTGAACCCTTGGCTGAGG - Intergenic
944484086 2:200185170-200185192 TGGCAGTGAACCTATGGCTGAGG - Intergenic
948771977 2:240256103-240256125 TGGAATTGTACACATTCCTTTGG + Intergenic
948862747 2:240760833-240760855 TGGAATTGTACCTGTGACAGGGG + Exonic
948947655 2:241229266-241229288 TGGAATCCTAGCCACGGCTGCGG + Exonic
1170141685 20:13131254-13131276 TGGAATTTTACCCAGAGTTGGGG - Intronic
1172287503 20:33751333-33751355 GGTAGTTGTACTCATGGCTGTGG + Intronic
1172438988 20:34952175-34952197 TGGACTTGAACCCATGTCTCTGG + Intronic
1173330055 20:42068300-42068322 GGAAATTGTTCCCATGGCCGTGG + Intergenic
1174059136 20:47820025-47820047 TGGAAATGTACACAAGGGTGAGG + Intergenic
1175654681 20:60759899-60759921 TGGGATCATACTCATGGCTGTGG + Intergenic
1176063845 20:63183960-63183982 TGTCCTTGTACCAATGGCTGAGG - Intergenic
1176584399 21:8564688-8564710 TGTAATTGTTCCTATGGATGTGG - Intergenic
1179232310 21:39515882-39515904 TTGATTTGTAGCCATGGCTGTGG + Intergenic
1179476311 21:41648433-41648455 TGGAGCTGTACCCATGCCTGGGG + Intergenic
1180267211 22:10541592-10541614 TGTAATTGTTCCTATGGATGTGG - Intergenic
1180869810 22:19139771-19139793 GGGCATTGTACCCATGGCCCTGG + Intronic
1181892061 22:26072040-26072062 TGCAGTTGTACTCATGGCTAAGG - Intergenic
1183316648 22:37140829-37140851 TGGGATTGAACCCAGGCCTGCGG - Intronic
1184011736 22:41753818-41753840 TGAAATTCTAGCCATGGCCGTGG - Intronic
1184660223 22:45962208-45962230 TGCAATGGACCCCATGGCTGTGG - Intronic
949616195 3:5756457-5756479 GGGAATTGTACTCATTCCTGAGG + Intergenic
950111063 3:10419001-10419023 GGGATTTGAACCCAGGGCTGAGG - Intronic
954933806 3:54308283-54308305 AGGAATGGAACCCATGGCTGAGG - Intronic
955024666 3:55155844-55155866 TGGAATTGTAGCCAGGGAAGTGG + Intergenic
956213219 3:66823253-66823275 TGAAACAGTACCCATGGCAGTGG - Intergenic
956330571 3:68102545-68102567 TGGAGTTTTACCCAGGGGTGAGG + Intronic
958972037 3:100622144-100622166 TGGATTGGTACCCGGGGCTGGGG + Intronic
959787521 3:110318618-110318640 GGGAATTGTAATCATGGCAGGGG - Intergenic
960915955 3:122695054-122695076 GGGCATTGTACACCTGGCTGAGG + Intronic
961642791 3:128375391-128375413 TGGATTTGTGCCCATGGCGAGGG - Intronic
962515718 3:136149228-136149250 TGAGATTGTACACATGGATGAGG - Exonic
968280642 3:197474226-197474248 TCGAATTGTAACCATGTCAGGGG + Intergenic
970556493 4:17238830-17238852 TGGCATTGTGCCAATGGTTGAGG - Intergenic
973262079 4:48175353-48175375 TCGCCTTTTACCCATGGCTGTGG - Intronic
973271996 4:48270698-48270720 AGGAACTGTTCCCATGCCTGGGG + Intergenic
976947744 4:90791298-90791320 TGGCATTTTACCCACTGCTGTGG - Intronic
978410345 4:108418285-108418307 TGAACTTGGAACCATGGCTGTGG + Intergenic
979069044 4:116177649-116177671 TTGAATTCTACCAATGGGTGAGG + Intergenic
979240627 4:118443881-118443903 TGGAATTATTCCCATAACTGGGG - Intergenic
980789571 4:137602559-137602581 TAGAATTAAACCCATGGATGTGG + Intergenic
981960445 4:150531160-150531182 TCTAAATGTACCCATGGCTCTGG - Intronic
982275170 4:153630755-153630777 TGGAAGTGTTGCCATGTCTGGGG + Intronic
982292942 4:153797343-153797365 AGAAATTGTACCTATGGCTCTGG + Intergenic
982438610 4:155406822-155406844 TAGAAATGTACTCATGGATGTGG - Intergenic
983073896 4:163301690-163301712 TGAAATTGTTCCCATGGCTCTGG + Intergenic
983876430 4:172881877-172881899 TGGAATGTTGCCCAAGGCTGAGG - Intronic
985826140 5:2192877-2192899 TTGAAGGGTGCCCATGGCTGTGG + Intergenic
986735987 5:10667707-10667729 TGGAGTTGTCCCCTTGGGTGGGG - Intergenic
988085927 5:26475806-26475828 TATAATTGTACTCATGGCTAAGG + Intergenic
990257950 5:53991045-53991067 TGGAATTATACCCATGGGGTGGG - Intronic
991117341 5:62969833-62969855 TGGCATTTTCCCCATGCCTGTGG - Intergenic
996349835 5:122526495-122526517 TGCATTAGTACCGATGGCTGTGG + Intergenic
1001598716 5:172915115-172915137 GGGACTTGAACCCAGGGCTGGGG - Intronic
1003654409 6:7992482-7992504 TGGAATCCTTCCCTTGGCTGTGG + Intronic
1003665689 6:8109326-8109348 TGTCATTGTCCCCAGGGCTGTGG - Intergenic
1006843700 6:37048432-37048454 TGGAATTCTGCCCTGGGCTGAGG + Intergenic
1007992636 6:46273087-46273109 AGGAATGGTACCCAAAGCTGTGG + Intronic
1009577916 6:65491111-65491133 TTGAATTGTTCCCTTGGCTAGGG - Intronic
1010301628 6:74266998-74267020 TGGCATTATGCCCATTGCTGAGG - Intergenic
1012769829 6:103418262-103418284 AGGAATTGTCACCTTGGCTGAGG - Intergenic
1014365554 6:120536871-120536893 GGCAGTTGTACTCATGGCTGTGG + Intergenic
1014573599 6:123042498-123042520 TGGGATTGTACACATGACAGAGG - Intronic
1015295230 6:131583766-131583788 TGGAAGTGAACCCATCCCTGGGG + Exonic
1015812697 6:137177302-137177324 TGGAATCCTTCCCATGGCTGAGG - Intergenic
1020499241 7:8894841-8894863 TGGTATTGTAAATATGGCTGTGG - Intergenic
1022821614 7:33967793-33967815 TAGCATTGTAACCATGGCTTTGG - Intronic
1023368629 7:39490111-39490133 TTGAATTGTGTCCATAGCTGGGG + Intronic
1024115418 7:46188187-46188209 CTGAATTGTACCCAGGTCTGAGG - Intergenic
1024807459 7:53161374-53161396 TGTAATTGTTCCTATGGATGTGG + Intergenic
1025235772 7:57234001-57234023 TGGAAATGTACACAAGGGTGAGG - Intergenic
1025306249 7:57860813-57860835 TGTAATTGTTCCTATGGATGTGG + Intergenic
1025482936 7:61007567-61007589 TGTAATTGTTCCTATGGATGTGG - Intergenic
1025564250 7:62411929-62411951 TGTAATTGTTCCTATGGATGTGG - Intergenic
1025877285 7:65494145-65494167 TGTAATTGTTCCTATGGATGTGG + Intergenic
1030957549 7:115873577-115873599 TGGAATTGTACCTTGGGGTGTGG - Intergenic
1033715593 7:143998601-143998623 TGGAAGTTTTCCCAGGGCTGGGG + Intergenic
1034451422 7:151139160-151139182 TGGGAGAGCACCCATGGCTGGGG - Intronic
1035009878 7:155705586-155705608 TGAAAGCGTACCCTTGGCTGGGG + Intronic
1035472423 7:159119059-159119081 TCCAAGTGTACCCAGGGCTGAGG + Intronic
1037323833 8:17669373-17669395 TGCAAATGAACCCATGGCCGGGG + Intronic
1037723145 8:21461660-21461682 TGGCATTGTAGGAATGGCTGGGG - Intergenic
1038905177 8:31894139-31894161 TGTAATTGTACCCATGTATATGG + Intronic
1043225230 8:77719108-77719130 TGAAATTGTATTTATGGCTGAGG + Intergenic
1049977867 9:876928-876950 TGGAAGTGGGACCATGGCTGAGG - Intronic
1049977875 9:876989-877011 TGGAAGTGGGACCATGGCTGAGG - Intronic
1050284105 9:4083142-4083164 TGGAATAGAACTCATGCCTGTGG + Intronic
1053130598 9:35612753-35612775 TGGCAGTGCACACATGGCTGGGG - Intronic
1053475616 9:38380127-38380149 TCAAATTATACCCATGGCTAAGG + Intergenic
1059321972 9:113476988-113477010 TGAAATTCAACCCATGACTGCGG + Intronic
1062630312 9:137460333-137460355 TGGGACTGTCCCCAAGGCTGAGG - Exonic
1203614302 Un_KI270749v1:42217-42239 TGTAATTGTTCCTATGGATGTGG - Intergenic
1192993637 X:76488681-76488703 TGGAACTGCCCCCTTGGCTGTGG + Intergenic
1193540385 X:82764452-82764474 TGGAATTGTATTCTGGGCTGTGG + Intergenic
1194209400 X:91052282-91052304 TGGTATTGTACCCATGACGTGGG - Intergenic
1194754125 X:97717177-97717199 TGGAGTATTACCCATGGCTGGGG - Intergenic
1195427291 X:104748656-104748678 TGGAATCCCACCCAGGGCTGTGG - Intronic
1195872702 X:109502503-109502525 ATGAATTGTATCCATGTCTGAGG - Intergenic
1196314677 X:114209310-114209332 TGAAATTGAATACATGGCTGAGG - Intergenic
1196937025 X:120740335-120740357 TAGATTTGGACCTATGGCTGGGG + Intergenic
1197156866 X:123279823-123279845 TGGAGTTCTACCTATGGCTCAGG + Intronic
1198422736 X:136483773-136483795 GGGAATGGTACACATGGTTGAGG + Intergenic
1202388350 Y:24345700-24345722 TGGAATTATTCCCATAACTGGGG - Intergenic
1202482437 Y:25324428-25324450 TGGAATTATTCCCATAACTGGGG + Intergenic