ID: 1153540409

View in Genome Browser
Species Human (GRCh38)
Location 18:6147996-6148018
Sequence CAGGGAGATCAGAGGTTTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 293
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 266}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153540403_1153540409 19 Left 1153540403 18:6147954-6147976 CCCAGAAAAGGATGACCTCATAT 0: 1
1: 0
2: 0
3: 25
4: 303
Right 1153540409 18:6147996-6148018 CAGGGAGATCAGAGGTTTGATGG 0: 1
1: 0
2: 2
3: 24
4: 266
1153540404_1153540409 18 Left 1153540404 18:6147955-6147977 CCAGAAAAGGATGACCTCATATT 0: 1
1: 0
2: 1
3: 19
4: 131
Right 1153540409 18:6147996-6148018 CAGGGAGATCAGAGGTTTGATGG 0: 1
1: 0
2: 2
3: 24
4: 266
1153540405_1153540409 4 Left 1153540405 18:6147969-6147991 CCTCATATTTAAATATGAGTACA 0: 1
1: 0
2: 1
3: 44
4: 415
Right 1153540409 18:6147996-6148018 CAGGGAGATCAGAGGTTTGATGG 0: 1
1: 0
2: 2
3: 24
4: 266

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153540409 Original CRISPR CAGGGAGATCAGAGGTTTGA TGG Intronic
901150372 1:7097273-7097295 CAGGGAGGCCAGGGCTTTGATGG + Intronic
901325001 1:8360582-8360604 CAGGGAGCTCAGGGGCTTCAGGG + Exonic
902841162 1:19074767-19074789 GAGGGAGAACAGAGGGTGGAAGG + Exonic
903544744 1:24116916-24116938 TTGGGAGGTCAGAGGTTTGCAGG + Intergenic
904397403 1:30231107-30231129 GAGGCAGATCAGAGGACTGAGGG + Intergenic
904866001 1:33579421-33579443 CAGGGAAAGGAGAGGTTGGATGG + Intronic
904942117 1:34171165-34171187 TAGGGAGATCTGAGGCTAGAGGG - Intronic
904944344 1:34188432-34188454 CAGGGAGCTGAGAGATTTCACGG + Intronic
907364550 1:53947151-53947173 TTGGGAGATCGGAGGTTGGAAGG + Intronic
907946886 1:59143747-59143769 CAGGGTGATGAGAGATATGATGG + Intergenic
909329651 1:74396167-74396189 CAGGGAGATCAGAGGGCAGCAGG + Intronic
909837872 1:80280205-80280227 CAGGGATAACAGAGTTTGGAAGG + Intergenic
911864877 1:103005872-103005894 CAGGGAGATCGAGGGTTTGATGG - Exonic
913206409 1:116543244-116543266 CAGGGACATCAGGTGTGTGAAGG + Intronic
914987689 1:152474397-152474419 CTGGGAGATGAGAAGTCTGAAGG + Intergenic
915294309 1:154909389-154909411 CAGAGAGCTCAGAGGGTTGCAGG + Intergenic
915589848 1:156864560-156864582 CAGGAAGCTCAGGGCTTTGAGGG + Intronic
915719387 1:157973185-157973207 CAGGCAGATCACAAGGTTGAGGG - Intergenic
915904298 1:159866539-159866561 CAGGGGGCTCAGAGGTTGCATGG + Intronic
917851565 1:179069084-179069106 CATGGAAACCAGAGCTTTGAAGG - Intronic
919464542 1:197913198-197913220 TATAGAGAACAGAGGTTTGAAGG + Intronic
920951290 1:210573913-210573935 CAGGGAAATGAGAGGGATGAAGG + Intronic
921470924 1:215548205-215548227 CAGGTAGATCAGTGGTTTTCTGG - Intergenic
922537193 1:226390132-226390154 CATGGAGCTCAGATGTTGGAAGG + Intronic
923838107 1:237637057-237637079 CAGGGAGCTCTGAGGAGTGACGG + Intronic
924807837 1:247375368-247375390 TTTGGAGATCAGAGGTTTTAAGG - Intergenic
1062931392 10:1354914-1354936 CATGGAGCTCAGAGGCTAGAGGG - Intronic
1063606272 10:7525819-7525841 CAAGGAAATCAGAGATGTGAGGG + Intergenic
1063895231 10:10673685-10673707 CAGCGAAATCAGTGCTTTGAGGG - Intergenic
1064451308 10:15444641-15444663 CAGGGAGATCACAGAGCTGAAGG + Intergenic
1064701151 10:18023313-18023335 CAGGGATGTCAGAGGGTTCATGG + Intronic
1066645011 10:37597599-37597621 CAGGGAGTTCAGAGCTGGGATGG - Intergenic
1067002720 10:42632420-42632442 CAGGTAGATCAGAAGTTCCAGGG - Exonic
1067042489 10:42962442-42962464 GAGGGAGAGCAGAGGTTTCCTGG + Intergenic
1067338767 10:45384305-45384327 CAGGGACAGCACAGGTTGGAGGG + Intronic
1068958323 10:62841567-62841589 CTGGGAGACCAGAAGTTTGGGGG - Intronic
1072758730 10:98038539-98038561 CAGGGAGGCCAGAGGTCAGAGGG + Intergenic
1073055518 10:100698302-100698324 CAGGGTGATCGGAGGATGGAGGG - Intergenic
1074420679 10:113306317-113306339 CAGGTAGCAGAGAGGTTTGAAGG + Intergenic
1075182136 10:120220835-120220857 CAGAGAGACCAGAGGTGTGCTGG - Intergenic
1075512908 10:123086760-123086782 CTGGGAGCTCAGAGGAGTGAGGG + Intergenic
1075555639 10:123429464-123429486 GAGGAGCATCAGAGGTTTGATGG - Intergenic
1075979504 10:126724615-126724637 CAGGGACTCCAGAGGTTTGGGGG + Intergenic
1076187523 10:128460893-128460915 CAGGCAGAGCAGAGGTTGGGAGG - Intergenic
1076750908 10:132542506-132542528 CATGGAGTTCAGAGTTTTCAAGG - Intronic
1077473354 11:2775145-2775167 CAGGCTGAGCAGGGGTTTGATGG - Intronic
1077484033 11:2830724-2830746 TTGGGAGGTCAGAGGTCTGAGGG - Intronic
1079861484 11:25677709-25677731 CAAGGAAATCAGAGTATTGAAGG + Intergenic
1080225552 11:29956349-29956371 GAGGCAGATGAGAGGTTTCAGGG - Intergenic
1081206722 11:40284115-40284137 CAGGGAGATCAGTGGGCTTAGGG + Intronic
1082116974 11:48338951-48338973 CAGAGAGAACAGAGGATCGAAGG - Intergenic
1083858185 11:65404294-65404316 CAGGGCCTTCAGGGGTTTGAGGG - Intronic
1084383993 11:68830630-68830652 CAGGGAGAGCTGAGCTTGGAAGG - Intronic
1084753991 11:71223055-71223077 GAGGGAGCTCAGAGATTTGGAGG + Intronic
1085837304 11:79970834-79970856 CTGGGAAAGCAGAGGTTTAATGG - Intergenic
1089310562 11:117555655-117555677 CAGGGAGAGCAGGGGTTTGGCGG + Intronic
1089590463 11:119537145-119537167 CAGGGAGGCCAGGGGTTTTAAGG - Intergenic
1089729287 11:120510794-120510816 GAGGGAGCTAATAGGTTTGAGGG + Intergenic
1091351390 11:134899750-134899772 GACAGAGATCAGAGTTTTGAGGG - Intergenic
1091664836 12:2411658-2411680 CAGGGAGCCCAGAGGTTTCCAGG + Intronic
1091745870 12:2992512-2992534 GTGGGAGATGAGGGGTTTGAGGG + Intronic
1091792246 12:3278637-3278659 CAAGGAGATCAGGAGTTGGAGGG - Intronic
1092764641 12:11841661-11841683 AAGGGAGTTCAGAGATTAGAGGG + Intronic
1093411502 12:18873890-18873912 GGGGGAGATCACAGGTTTTAAGG - Intergenic
1097496923 12:60351543-60351565 CAGAGAGGTCAGAGATCTGAAGG - Intergenic
1104721707 12:131048112-131048134 CAGGGAGAGCAGATGCTTGTCGG + Intronic
1105614335 13:21998712-21998734 CAGGGAGCTCAGAGGGTGGAGGG + Intergenic
1106760008 13:32858972-32858994 CTGGAAGAGCAGAGCTTTGAAGG + Intergenic
1108572531 13:51765490-51765512 AAGGGAGATTAAAGGCTTGAGGG + Exonic
1108869974 13:54972961-54972983 CAGGAAGGACAGAGCTTTGAAGG + Intergenic
1110198621 13:72821040-72821062 CAGTGAGATCAGTGCTCTGAAGG + Intronic
1112656671 13:101459036-101459058 CTGCGAGATCAGAAGTGTGATGG + Intronic
1112970276 13:105253218-105253240 CTGGGAGAGCAGAGGAGTGAGGG + Intergenic
1116494014 14:45538578-45538600 GAGGGAGCTCAGAGATTTAAGGG - Intergenic
1117791865 14:59350151-59350173 CAGGGAGTTCATAGGTCTGGGGG - Intronic
1118735134 14:68695697-68695719 CAGGGTGACCAGAGGCTTGTGGG - Intronic
1118860437 14:69658815-69658837 CAGGGAGAGCAGAGGGTGGAGGG + Intronic
1122199477 14:100113790-100113812 CAGGGAGGAGAGAGGTTTGGTGG + Intronic
1124627092 15:31314419-31314441 CAGGGAGATGACAGGGATGATGG - Intergenic
1125791956 15:42373779-42373801 CAGGGACATCAGGAGTGTGAAGG + Intronic
1126957272 15:53947555-53947577 CAAGGTGATCAGAGGCATGATGG - Intergenic
1128464968 15:67902822-67902844 CTGGGGGATCAGAGTTTTTAAGG - Intergenic
1129426324 15:75465892-75465914 CAGAGAGGTCAGGGGTTTGGTGG - Exonic
1129930253 15:79404624-79404646 TTGGGAGATCAGAGGTCAGAAGG - Intronic
1130833930 15:87630957-87630979 CTGGGAGATCAGAGTGTTTAAGG - Intergenic
1130838200 15:87672487-87672509 CAGGGGGAGCAGAGGATGGAAGG + Intergenic
1131758109 15:95588187-95588209 CAGTGGGATCAGTGATTTGATGG + Intergenic
1132215121 15:100056842-100056864 CAGGGAGCTCACAGTTTGGAAGG + Intronic
1132709543 16:1260263-1260285 CAGGGAGAGCAGTGCTCTGAGGG - Intergenic
1137010581 16:35316356-35316378 CAGGGACATCACAGGTTCTAAGG - Intergenic
1137534041 16:49304014-49304036 GAAGGAGATCAGAGTTTTGAGGG - Intergenic
1137620998 16:49876616-49876638 GAGTGAGATCAGAGGGTCGAGGG + Intergenic
1137664166 16:50239182-50239204 CAGGGAGATGTGAGGTTAGCAGG + Intergenic
1138523941 16:57590984-57591006 CAGGGATATCTGAGGTGGGAGGG + Intronic
1140780456 16:78291838-78291860 CAGTGAGCTGAGAGGTCTGATGG + Intronic
1141244528 16:82293564-82293586 CAGGGGGATCATAGGGTTGAAGG + Intergenic
1142441071 16:90097916-90097938 CAGGGAGAGAAGAGGTTCTAGGG + Intergenic
1145999416 17:29122394-29122416 CAGGGACATCAGAGGTGTCTGGG + Intronic
1146709845 17:35031575-35031597 CAGGGTGATCAGTGCTTTAACGG + Intronic
1146821555 17:35986851-35986873 CAGGGAGAGCCAAGGTTTAAGGG + Intronic
1146951594 17:36910450-36910472 CATGGAAATCTGAGGTCTGAGGG - Intergenic
1148655316 17:49278852-49278874 CAGGGAGATCTGGGATTTCATGG + Intergenic
1150516753 17:65820294-65820316 CTGGGAGATCTGAGGTCTGTAGG - Intronic
1153540409 18:6147996-6148018 CAGGGAGATCAGAGGTTTGATGG + Intronic
1153784600 18:8523401-8523423 CAGGGGGATCAGAGATGTGGAGG + Intergenic
1155891753 18:31278816-31278838 CAGGGAGATCAGTAGTGTGAAGG - Intergenic
1156508220 18:37612640-37612662 CAGGGAGAGCAGAGACTTGCTGG + Intergenic
1157091814 18:44645090-44645112 CAGGGAGAGCTGAGACTTGATGG + Intergenic
1157166494 18:45362638-45362660 CAGGAAAATCAGAGGATTTAGGG + Intronic
1159840651 18:73394857-73394879 CAGGGAGAACACAGCTCTGATGG - Intergenic
1160974033 19:1783726-1783748 CAGGGAGAACAGAGGTGGCAGGG + Intronic
1162095361 19:8306804-8306826 AAGGGAGGTCAGAGGTGTCAGGG - Intronic
1162953439 19:14085406-14085428 CCGGGGGACCAGAGGTTTGGGGG + Exonic
1162958073 19:14110921-14110943 CAGGAACATCAGGGGGTTGAAGG - Intronic
1163176004 19:15564373-15564395 CTGGGACATCAGAGGAGTGAGGG + Intergenic
1164755752 19:30688100-30688122 CACGGAGATTAGAGATTGGAGGG + Intronic
1165083936 19:33329559-33329581 TAGAGAGATCAGATGTTAGAGGG - Intergenic
1165431730 19:35776775-35776797 CAGAGTGATCAGAGCTGTGAAGG + Intronic
1166605805 19:44141720-44141742 GTGGGAGAGCAGAGGTTTGGTGG + Exonic
1167417838 19:49386538-49386560 CAGCAAGATCAGGGGCTTGAGGG + Intergenic
1168123700 19:54271126-54271148 AAGACAGATCAGAGGTTTGTGGG + Intronic
1168178652 19:54644395-54644417 AAGACAGATCAGAGGTTTGCGGG - Intronic
925681570 2:6427564-6427586 CAGCAAGATCTGAGCTTTGATGG + Intergenic
926386362 2:12339322-12339344 CAGAGAAATCAAAGCTTTGAAGG + Intergenic
926660019 2:15454733-15454755 GAGGGTGATCAGAAATTTGATGG - Intronic
927242781 2:20933093-20933115 CATGAAGCTCAGAGGTGTGAAGG + Intergenic
927965176 2:27263645-27263667 CAGGGATAACAGTGGGTTGAAGG - Intronic
928359504 2:30651620-30651642 CAGAGAGATCAGAGATGGGAAGG - Intergenic
930204293 2:48572844-48572866 CAGGGAGAGCAGGGTTTCGATGG - Intronic
931151454 2:59578715-59578737 CAGGTAGATCAAAGGTGTGAAGG + Intergenic
931167265 2:59761526-59761548 CAGGGTGATCAGAGGATTCCTGG + Intergenic
932459631 2:71873840-71873862 CAAGGAGAGCAGAGAGTTGAGGG + Intergenic
934755246 2:96820124-96820146 CAGGGAGACCAGCGGTGTGAGGG + Intronic
935830588 2:106997471-106997493 GAGGGAGATCAGAGCTGTGATGG + Intergenic
937111243 2:119368157-119368179 AAGGGAGAGGAGAGGATTGAGGG - Intronic
937302295 2:120850671-120850693 CAGTCAGAGCAGAGGCTTGAGGG + Intronic
937787561 2:125920570-125920592 CAGGCAGACCAGAAGTTGGAGGG + Intergenic
938393478 2:130923677-130923699 AAGAGAGTTGAGAGGTTTGACGG + Intronic
946074466 2:217062574-217062596 AAGGGAGATCACAGTTTTGAAGG - Intergenic
946830871 2:223726832-223726854 CAGGGATGTCAGAGCTTTGTTGG - Intergenic
947922373 2:233888507-233888529 CAGGGAACTCTGAGGTTAGATGG + Intergenic
1168802345 20:651703-651725 CAGTGAGATCAGAGCTATGCAGG + Intronic
1169386736 20:5156305-5156327 CAGGGAGATTAGGGTCTTGAAGG + Intronic
1170793533 20:19527074-19527096 CAGGGAGACCAAAGGTTTTGGGG - Intronic
1172570424 20:35966006-35966028 CAGGCAGTTCAGAGGACTGACGG + Intronic
1173311918 20:41904399-41904421 GCAGGAGATCAGAGGTTTGGAGG + Intergenic
1174489015 20:50879206-50879228 CAGGGAGAGCACACGTTGGATGG + Intronic
1174905568 20:54546868-54546890 CAGGGAGACCAGACATTTGGTGG + Intronic
1175486466 20:59350310-59350332 TAGGGAGATCAGAGGCATGCGGG + Intergenic
1175831535 20:61967536-61967558 CAGGGAGGTGGCAGGTTTGATGG - Intronic
1175899451 20:62354301-62354323 CAGGCTGATCAGAGGCCTGAGGG - Intronic
1178341732 21:31791352-31791374 CAGGGAGTCAAGAGGTCTGAGGG - Intergenic
1178572270 21:33749693-33749715 CAGGGAAACCACATGTTTGATGG - Intronic
1179415562 21:41195580-41195602 CAGGGAGAATGGAGGTGTGAGGG - Intronic
1182485615 22:30636872-30636894 CAGGGTGAACAGAGGTGTGGTGG - Exonic
1184519007 22:44981356-44981378 CGGGGAGTGCAGAGGTCTGAGGG - Intronic
1184692772 22:46124757-46124779 GAAGGAGATAAGAGTTTTGAGGG - Intergenic
1184982752 22:48105825-48105847 CAGGGAGAGCAGAGGGATGTGGG - Intergenic
950126353 3:10512173-10512195 CAGAGAGATCACAGGCTTCAGGG - Intronic
950753508 3:15151867-15151889 CAGGGAGAGAAGGGTTTTGATGG - Intergenic
951083572 3:18482475-18482497 CAGGGAAATCTGACTTTTGAGGG - Intergenic
951488028 3:23235808-23235830 CTGGGAGATAAGTGGTTTGATGG + Intronic
951548862 3:23856743-23856765 AGGGGAGTTCAGAGGTTAGAGGG + Intronic
952897167 3:38085394-38085416 CAGGGGGATCAGAAGTGTGTGGG - Exonic
954579797 3:51697056-51697078 CAGGGAGAACAGAGGATCAAGGG - Intronic
955322040 3:57981510-57981532 CAGGGAGGTCCCAGGGTTGAAGG + Intergenic
959842509 3:110994518-110994540 GAGGATGATCAGATGTTTGAGGG + Intergenic
960547169 3:118928682-118928704 CAGGGTGGACAGATGTTTGATGG - Exonic
961114292 3:124315482-124315504 GAGGGAGATCTGGGGTCTGAAGG - Intronic
962755145 3:138460688-138460710 GAGGGAGATCATAAGTTTGGGGG + Intronic
965537327 3:169836862-169836884 AAGGGAGTTAAGAGGTTAGAGGG + Intronic
965868631 3:173238261-173238283 CAGGGAGATTAGAGAGTGGAGGG - Intergenic
966209910 3:177442673-177442695 CAGGAAGATGAGAGGTCTGCTGG - Intergenic
966863275 3:184242243-184242265 CAGGGAGCTCAGAGGATGGAGGG - Exonic
968361334 3:198148889-198148911 CAGGGAGAGAAGAGGTTCTAGGG + Intergenic
968423888 4:508250-508272 CAGGGTGAGCAGAGACTTGAAGG + Intronic
969097683 4:4746184-4746206 CAGTGAGACAAGATGTTTGAAGG - Intergenic
970517403 4:16846515-16846537 CATGGAAATCAGACTTTTGAAGG + Intronic
972664285 4:41149093-41149115 AAGGGCGCTCTGAGGTTTGAGGG + Intronic
974632093 4:64506265-64506287 TATGGATATCAGTGGTTTGATGG - Intergenic
975464010 4:74688672-74688694 TAGGGAGAGCAGGTGTTTGACGG + Intergenic
977377074 4:96219371-96219393 TTGGGAGATGGGAGGTTTGAAGG - Intergenic
977610393 4:99024409-99024431 CAAGGGGATCAGAGTTTTTACGG + Intronic
978457357 4:108908767-108908789 CTTGGAGATCAGAGTTTTTAAGG + Intronic
980121444 4:128732176-128732198 CTTGGAGATCAGAGTTTTTAAGG + Intergenic
980176621 4:129353996-129354018 TAGGGATAGCAGAGGTGTGAGGG - Intergenic
981029350 4:140108382-140108404 CAGGGAGCTCACAGTTTTGTTGG - Intronic
981269567 4:142829335-142829357 CAGGTAGATCAGAGGGAGGAGGG + Intronic
982197867 4:152934743-152934765 CAAGGAGATCAAAGGGATGAGGG + Intergenic
983046380 4:162991470-162991492 CAGGGAAATGTGAGTTTTGAGGG - Intergenic
987544615 5:19297213-19297235 CAGGGATATCAGGGGGTTCAGGG - Intergenic
989297238 5:39843792-39843814 CAGGGAGAACAGATGTTTGAAGG + Intergenic
991575451 5:68098785-68098807 CTGGGACAGCAGAGTTTTGATGG - Intergenic
992226714 5:74625852-74625874 AAGGGAGAGCAGACGTTGGAGGG - Intergenic
994733718 5:103525553-103525575 AAGGGAGGTCAGAGGTCTGCTGG + Intergenic
996367506 5:122718768-122718790 CAAGGAGACCAGAAGTTAGATGG - Intergenic
999129721 5:149273155-149273177 CAAAGAGATCACAGGTGTGACGG + Intronic
999479457 5:151933513-151933535 AAGTGACATCAGATGTTTGAAGG - Intergenic
999852859 5:155561658-155561680 CAGTGAGTTCAGAGGTGGGATGG - Intergenic
999863436 5:155674367-155674389 AAAGGAGACCAGAGCTTTGAAGG - Intergenic
1000349544 5:160342578-160342600 CAGGGAGAGCAGAGTCTTCAGGG - Intronic
1000962981 5:167622266-167622288 CTTGGATTTCAGAGGTTTGATGG - Intronic
1001632013 5:173182461-173182483 TAGGAAGACCAGAGATTTGATGG - Intergenic
1002703292 5:181142456-181142478 CAGTCAGATCAGAGGGCTGAGGG - Intergenic
1003153224 6:3570427-3570449 CAGGGAGATCACAGATTGCAAGG - Intergenic
1003963630 6:11232656-11232678 CAGTGAGCTCAGAGACTTGAGGG - Exonic
1004051725 6:12088110-12088132 CAGGTAGATCAGAGTTTGAAGGG + Intronic
1004170250 6:13290270-13290292 CTGGGAGATTAGGGGATTGACGG - Exonic
1005893928 6:30162454-30162476 CAGGAAGAGCAGAGATTGGATGG + Intergenic
1006318598 6:33305398-33305420 CAGGGAGATGAGGGGTTGGGAGG + Intronic
1007653638 6:43438808-43438830 CAGGCAGCTAAGAGGTTTCAAGG - Intronic
1009913460 6:69962823-69962845 CAGGGAGAGCAAGGTTTTGAAGG + Exonic
1013356532 6:109350257-109350279 CAGGGAGAGGAGGGGTTTGAGGG + Intergenic
1014461374 6:121699710-121699732 TAGGGACATCAGAGGCTTGGAGG + Intergenic
1015272594 6:131352772-131352794 CAGAGAGATTAGAGGTGTGAGGG + Intergenic
1015642493 6:135350735-135350757 CAGAGAGATCAAATGTTCGAAGG + Intronic
1016082672 6:139875267-139875289 CAAGGAGGTCAGTGGTTTTACGG - Intergenic
1016807035 6:148222078-148222100 CAGGGAGACCATAGGTTAGAAGG - Intergenic
1016917286 6:149256046-149256068 CTGGTTGATCAGAGGCTTGAAGG - Intronic
1018381456 6:163261548-163261570 CAAGGAGCTCATGGGTTTGAGGG - Intronic
1019166335 6:170100083-170100105 GAGGGAGAAAAGAGGTTTGCAGG + Intergenic
1019254357 7:39832-39854 CAGGGAGAGAAGAGGTTCTAGGG - Intergenic
1021561375 7:21971979-21972001 CAAAGAGAGCAGAGGTTGGAGGG - Intergenic
1022587494 7:31628340-31628362 CAGGGAGACCAGTCGTTTGTTGG - Intronic
1024707047 7:51972262-51972284 AAGGGTGATCAGAACTTTGAGGG + Intergenic
1026097558 7:67358471-67358493 CAAGGAGAGCAGAGTTTTTAAGG + Intergenic
1027126673 7:75561355-75561377 CAGAGAGATCAGTGGATTGAAGG - Exonic
1027504452 7:78998085-78998107 AAGGGACATCAGAGTTATGATGG + Intronic
1028772097 7:94637735-94637757 CAGAGAGAACAGAGGTTCCAGGG + Intronic
1029015638 7:97312993-97313015 CAGGCAGATTAGAGGCTGGAAGG + Intergenic
1029965716 7:104738068-104738090 CAGGGAGAAAAGGGGTTTGTGGG - Intronic
1031352185 7:120747222-120747244 CATTAAGTTCAGAGGTTTGAGGG + Intronic
1031642950 7:124188249-124188271 CAGGGATGACAGAGGCTTGATGG + Intergenic
1032125841 7:129192206-129192228 GAGGGAGAGTTGAGGTTTGAAGG + Intronic
1032152706 7:129443818-129443840 CAGGAAGAGGACAGGTTTGATGG + Intronic
1032413836 7:131720816-131720838 CAGGGAGATGAGATGTTCTAGGG - Intergenic
1032418438 7:131757360-131757382 AAAGGAGATCAGTGGTTTGAGGG + Intergenic
1032690228 7:134278416-134278438 CAGGGGGAGAAGAGGTGTGAGGG + Intergenic
1033569131 7:142609928-142609950 GAGGGAGATCAGAGGGATTAAGG + Intergenic
1034080266 7:148270491-148270513 CAGGGAGGTCACAGGCTTGTAGG - Intronic
1035073282 7:156160115-156160137 CAGGCAGGGCAGAGGTTTGACGG + Intergenic
1035704919 8:1668383-1668405 CACCGAGATCAGAGGCTTGGAGG - Exonic
1036486319 8:9182654-9182676 CAGGGAGAGCAGAGGTGTCAGGG - Intergenic
1036989461 8:13576245-13576267 CAGGTAGTTAAGGGGTTTGAAGG + Intergenic
1037646452 8:20796735-20796757 CAGGGAGTTAAGGAGTTTGAAGG + Intergenic
1037879115 8:22564562-22564584 CAGGGAGATTAGGGTTTTGGTGG + Intronic
1038073138 8:24040291-24040313 CTGGGAGATGAGAGGATAGAAGG - Intergenic
1038165038 8:25077691-25077713 GAGGGGGATCAGAGTTTTTAAGG + Intergenic
1039101747 8:33948843-33948865 CAGAGAGATCAGGAGATTGAAGG + Intergenic
1041954287 8:63540311-63540333 CCAGGAGGTCAGATGTTTGAGGG + Intergenic
1042209516 8:66365964-66365986 CTGGGAGAAAAGAGGTTTGTGGG - Intergenic
1047626633 8:126663623-126663645 CAGTGAGATCAGTGGTTTCCCGG + Intergenic
1048648295 8:136447002-136447024 TAGGGAGATCAAAGGTTTGTTGG + Intergenic
1048928387 8:139291214-139291236 CAGGGAGAGCAGAGCTTAGTAGG - Intergenic
1049949169 9:627699-627721 CAGGGGGACCAGAGGGTGGATGG + Intronic
1051823941 9:21198073-21198095 CACCGAGATAAGAGGTTGGAAGG - Intergenic
1052513000 9:29445771-29445793 CAAGGACATCAGAGGTGTAAGGG + Intergenic
1056950161 9:91035375-91035397 CTGGGAGATGGGAGGCTTGAGGG - Intergenic
1057388410 9:94623945-94623967 GAGGGAGATGAGAGGCTAGATGG + Intronic
1057781622 9:98055318-98055340 CTTGGAGATCAGAGTTTTTAAGG + Intergenic
1057889834 9:98861185-98861207 CAGGGAGGGAAGAGGTTTGCTGG + Intergenic
1058886885 9:109328547-109328569 CAAGGAGATTAAAGGTTTTAGGG + Intergenic
1059287273 9:113185386-113185408 GAGGGAGATGACAGTTTTGATGG + Intronic
1059350299 9:113659543-113659565 CAGGGAGATCAGACATCTGCTGG + Intergenic
1060768809 9:126315216-126315238 CAGGAGGATGAGAGGTTTGCTGG - Intergenic
1060899913 9:127248210-127248232 CATGGAGAAGAGAGGTTGGAAGG + Intronic
1060944431 9:127561608-127561630 CAGGGAGCCCAGAGGTTTTGGGG - Intronic
1061052904 9:128206554-128206576 CAGGGAGGTCAGAGGTCTCCAGG + Intronic
1061246094 9:129401869-129401891 CAGGGAGAGCAGAGCTGTGAAGG - Intergenic
1061368789 9:130186484-130186506 GAGGGAGATGAGAAGTTTGCGGG + Intronic
1062088218 9:134659627-134659649 CAGGGAGGACAGAGGGTTGTTGG - Intronic
1062746045 9:138212709-138212731 CAGGGAGAGAAGAGGTTCTAGGG + Intergenic
1203744931 Un_GL000218v1:36361-36383 CAGGGAAAACTGAGGCTTGACGG - Intergenic
1203565175 Un_KI270744v1:83123-83145 CAGGGAAAACTGAGGCTTGACGG + Intergenic
1188447501 X:30271431-30271453 TAGGGAAATCAGTGGTTAGAAGG - Intergenic
1188618309 X:32187412-32187434 CAGGGATATGAGATGTTGGAAGG - Intronic
1189316238 X:40058784-40058806 CTGGGAGCTCAGAGGATTGTGGG - Intronic
1190326965 X:49212490-49212512 CAGTGAGACCAGAGGTGTGTTGG + Intronic
1190629819 X:52375572-52375594 AAGGGAAATCACAGGTTTAAAGG + Exonic
1190874590 X:54450582-54450604 CAGGGAGATCAGTGTTTTGATGG + Intronic
1190931950 X:54956282-54956304 CAGGGAGAACAGAGGTATCAAGG + Intronic
1191645091 X:63471290-63471312 CAGGGTGATCAGAGGTTCTCTGG + Intergenic
1193786079 X:85760899-85760921 GAGGGAGACCAGAGGTGTGAGGG - Intergenic
1194439277 X:93910347-93910369 CATGGAGATCAGTGGTTGGCAGG - Intergenic
1196016233 X:110943673-110943695 CTTGGGGATCAGAGGGTTGAAGG - Intergenic
1196769687 X:119281415-119281437 CAGGGAGAACAGAGCTGTCAGGG - Intergenic
1197841933 X:130757495-130757517 CAGGGAGGAAAGAGGTATGATGG + Intronic
1198549982 X:137735186-137735208 CAGGGAGAACAGATGCATGAAGG - Intergenic
1198875162 X:141216851-141216873 AAGGGTGATCAGAGTGTTGATGG - Intergenic
1199850010 X:151719036-151719058 CAGGGACATTAGTGGTTTGCAGG - Intronic
1199950022 X:152699633-152699655 CAGGGTGACCAGAGAGTTGAGGG + Intronic
1199959652 X:152768828-152768850 CAGGGTGACCAGAGAGTTGAGGG - Intronic
1200765625 Y:7078530-7078552 CAGGGAGCTCTGGGTTTTGAGGG - Intronic