ID: 1153542271

View in Genome Browser
Species Human (GRCh38)
Location 18:6168553-6168575
Sequence ACCTGAGAAAAAAAGCAATG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 914
Summary {0: 2, 1: 33, 2: 106, 3: 183, 4: 590}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153542268_1153542271 23 Left 1153542268 18:6168507-6168529 CCTCAGAAATAATGCTGCATATC 0: 651
1: 2645
2: 4125
3: 3343
4: 4159
Right 1153542271 18:6168553-6168575 ACCTGAGAAAAAAAGCAATGGGG 0: 2
1: 33
2: 106
3: 183
4: 590
1153542267_1153542271 24 Left 1153542267 18:6168506-6168528 CCCTCAGAAATAATGCTGCATAT 0: 636
1: 2582
2: 3973
3: 2610
4: 3016
Right 1153542271 18:6168553-6168575 ACCTGAGAAAAAAAGCAATGGGG 0: 2
1: 33
2: 106
3: 183
4: 590

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153542271 Original CRISPR ACCTGAGAAAAAAAGCAATG GGG Intronic
900711107 1:4114942-4114964 AAGAGAGAATAAAAGCAATGGGG + Intergenic
900808951 1:4786664-4786686 ACCTGAGCAAAGAAGCAAAAGGG - Exonic
902700047 1:18166179-18166201 AGCTCAGAAAAAAAGATATGTGG - Intronic
903185890 1:21628883-21628905 ACCTCAGAAAAAAAAAAAGGAGG + Intronic
904876274 1:33656959-33656981 ACCTGAGCAAAATAGACATGTGG + Intronic
904884922 1:33729278-33729300 AGCAGAGAAAGAAAGCAAAGTGG - Intronic
905093788 1:35451345-35451367 AACTGAGAAATAAAGTAAGGAGG + Intronic
905405283 1:37728351-37728373 GCCTAAGAAGAAAAGGAATGAGG + Intronic
905489455 1:38332218-38332240 AGGAGAGAAAAAAGGCAATGAGG - Intergenic
905712010 1:40113176-40113198 ATCTAACAAAAAAAGCAATGGGG + Intergenic
906176416 1:43777503-43777525 ACCTGACAAAACAAGCAATGGGG + Intronic
906499971 1:46334580-46334602 ACCTGAAAAAAAAAGCAGGGGGG - Intergenic
906571065 1:46841028-46841050 GCTTGACAAAATAAGCAATGGGG - Intergenic
906575015 1:46880939-46880961 ACCTGACAAAAAAATAAATGGGG + Intergenic
906600210 1:47120276-47120298 GCTTGACAAAATAAGCAATGGGG + Intergenic
906897335 1:49790056-49790078 ACCTGACAAAAAAAGCAATGGGG + Intronic
907181587 1:52575267-52575289 ACCTGAGAAAGAAAGACATTTGG - Intergenic
907723561 1:56997559-56997581 ACATGACAAAAAAAGGAAAGGGG + Exonic
908503830 1:64774441-64774463 ACCTGCCAAAACAAGCGATGGGG - Intronic
908662409 1:66451298-66451320 ACCTGAGAAAAAAGCCCCTGAGG + Intergenic
908735865 1:67276294-67276316 ACCTGACAAAAAAAGCAATGGGG + Intergenic
908904898 1:68996885-68996907 ACCTGAGAAAAACAGGAAATGGG - Intergenic
908933474 1:69344650-69344672 ACCTGACAAAAACAGCAATGGGG - Intergenic
908939675 1:69416570-69416592 ACCTGACAAAAACAGCAATAGGG - Intergenic
908991793 1:70099779-70099801 AGCTGAGAGAAAAAGCCATTAGG + Intronic
909045212 1:70701585-70701607 AACTGAGAATGAAAGCAAAGAGG + Intergenic
909310993 1:74148785-74148807 ACCAGGGAACAAAAGCCATGTGG + Intronic
909678232 1:78261975-78261997 ACCTGAAAAAGCAAGCAATGGGG + Intergenic
910165234 1:84320755-84320777 GCCTTATAAAAAAAGTAATGTGG + Intronic
910508135 1:87973594-87973616 CCCTCAGAAAAAAAAAAATGAGG + Intergenic
911307631 1:96250372-96250394 CCCTGAAAAAAAAAACAATTAGG - Intergenic
911522583 1:98946366-98946388 ACTTGAATTAAAAAGCAATGTGG - Intronic
911540915 1:99157419-99157441 ACCTGACAAAAACAGCAATGGGG - Intergenic
911675337 1:100652466-100652488 ACCTGACAAAACAAGCAATGGGG + Intergenic
911822059 1:102435498-102435520 ACCAGAGAAACTAAGCAATTGGG - Intergenic
912019767 1:105093193-105093215 ACCTGATAAAACAAGCAGTAAGG + Intergenic
912034301 1:105291906-105291928 ACCTGACAAAACAAGAAATGAGG - Intergenic
912352373 1:109026345-109026367 ACCTGAAAAAAAAAAAAAGGTGG - Intronic
912656943 1:111494872-111494894 AACTGACAAAACAAGCAGTGGGG + Intronic
913399065 1:118407994-118408016 CCCTGACAAAAACAGCAATGGGG + Intergenic
914684130 1:149963176-149963198 AAATGAGAAAAAAAGAAAGGTGG + Intronic
914720675 1:150286394-150286416 AAATGAGAAAAAAAGAAATGTGG - Intronic
914842146 1:151257204-151257226 AGCTGACAAAACAAGCAGTGAGG - Intronic
915011508 1:152691084-152691106 ACCTGACCAAAAAAGCAATGGGG + Intergenic
915024851 1:152818015-152818037 TCCTGACAAAATAAGAAATGGGG - Intergenic
915691441 1:157695082-157695104 ACCAGAAAAAAAAATGAATGGGG + Intronic
915846657 1:159273422-159273444 ACCTGACAAAAAAAGCAATAAGG + Intergenic
916392985 1:164352774-164352796 TCCAGAGAAAAAAATCAATAAGG + Intergenic
916621455 1:166502519-166502541 ACCTGACAAAAACAAAAATGGGG + Intergenic
916633665 1:166644017-166644039 AGCTGAGAAAAAAATCAAGAAGG + Intergenic
917347171 1:174040222-174040244 ACCTTAGAAAAAAAGCCTAGAGG + Intergenic
917437335 1:175034604-175034626 AAATGAGGAAAAAAGGAATGGGG - Intergenic
917499569 1:175574024-175574046 ACCTGAGATAAAAAACAACTGGG - Intronic
917528604 1:175812191-175812213 ACCTGACAAAAAAAGCAATGGGG + Intergenic
917714080 1:177716273-177716295 ATCTGACAAAACAAGAAATGGGG + Intergenic
917776737 1:178345189-178345211 ACCTGAGAATGACAGAAATGTGG - Intronic
917994482 1:180421008-180421030 ACTTGAAAAAAAAATCATTGAGG - Intronic
918548918 1:185717450-185717472 ATCTGAGAAAAGAAACAACGGGG - Intergenic
919154721 1:193749094-193749116 ACCTGACAAAAACAACAATGGGG - Intergenic
919235143 1:194831260-194831282 AGCTGACAAAGAAAGCAATGGGG + Intergenic
919354635 1:196505349-196505371 ACCTGAGAAAACAAGCAATGGGG - Intronic
920032863 1:203048045-203048067 ACCTGGGAAGAAAGGCAATGGGG + Intronic
921336293 1:214090095-214090117 AACTGAAAAAACAAGCCATGGGG - Intergenic
921438379 1:215154844-215154866 ATCTGACAATAAAAGAAATGGGG - Intronic
921521582 1:216162168-216162190 ACATGAAAAAAAGAACAATGAGG - Intronic
922126918 1:222736718-222736740 ACCTCAGAAAAAAGGAAAGGTGG + Intergenic
922520707 1:226249172-226249194 ACCAGAGAAAAACAGAAGTGGGG + Intronic
924102363 1:240617861-240617883 ACCCCAGAAAAAAAGCAAGGAGG - Intergenic
924307485 1:242705668-242705690 ACCTTACAAAAACAGCAATGAGG + Intergenic
924613716 1:245594433-245594455 ACCTGACAAAACAAGCAATGGGG - Intronic
924639597 1:245821272-245821294 ACCTGACAAAAGAAGCAATGGGG + Intronic
924876178 1:248106840-248106862 ACCAGACAAAACAAGCAATGGGG - Intergenic
924884106 1:248193826-248193848 ACCTGACAAAAAAAGCAATGGGG + Intergenic
924912306 1:248527256-248527278 ACCTGACAAAACAAGAAATAGGG - Intergenic
1063010303 10:2015323-2015345 ACCTGAGAAAGAAAGAAAGAGGG - Intergenic
1063383349 10:5600583-5600605 TCCTGGGAAAAATAGAAATGTGG + Intergenic
1063477960 10:6345088-6345110 GACTGAGAAAAAAGGCAAAGAGG + Intergenic
1063960309 10:11301185-11301207 AAGGGAGAAAAACAGCAATGAGG - Intronic
1064510466 10:16084275-16084297 ATCTGCTAAAACAAGCAATGGGG - Intergenic
1064765002 10:18661650-18661672 ACATGAAAAAAAATGCAGTGTGG + Intronic
1066608835 10:37212829-37212851 AACTGAAAAAAAAAGCAATGGGG - Intronic
1067207035 10:44227223-44227245 ACTTGACAAAACAAGCAATGGGG - Intergenic
1069443611 10:68452543-68452565 CCCTGGAAAAAGAAGCAATGTGG + Intronic
1071365453 10:84895286-84895308 TACTGAGTAAAAAGGCAATGTGG - Intergenic
1071488395 10:86118962-86118984 ACCTGACAACTAATGCAATGTGG + Intronic
1072052516 10:91720312-91720334 TATTGAGAAAAAAATCAATGTGG + Intergenic
1072373413 10:94789609-94789631 ACCTGACAAAAAAAGAAATAGGG - Intronic
1072408197 10:95174516-95174538 ACCTGACAAAACAAGCAATGGGG - Intergenic
1072432492 10:95385622-95385644 ACCTGAGACAAATAAAAATGGGG - Intronic
1072494494 10:95942720-95942742 ACCAGATAAAAATAGAAATGTGG - Intergenic
1072747012 10:97947620-97947642 AGCTGAGAAATAAAAGAATGAGG + Intronic
1072961401 10:99932701-99932723 ACCAGAGGAAACAAGCAGTGTGG + Intronic
1072964927 10:99963660-99963682 ACCAGAGGAAACAAGCAGTGTGG - Intronic
1073927127 10:108530184-108530206 ACCTGACAAAACAAGCAATGGGG + Intergenic
1073999152 10:109350968-109350990 AAATGAGAGAAAAAACAATGGGG - Intergenic
1074612160 10:115032334-115032356 AGTTGACAAAATAAGCAATGAGG - Intergenic
1074773430 10:116748444-116748466 CCCTGAGAAGAGTAGCAATGAGG - Intergenic
1075180982 10:120211243-120211265 ACCTAAGAAAAAAATCCAGGTGG - Intergenic
1077783704 11:5359869-5359891 ACCTGACAAAAAAAACAAATGGG + Intronic
1078120095 11:8498808-8498830 ACCTGACACAAACAGCAATGGGG + Intronic
1078278074 11:9870580-9870602 ACCTGACAGAACAAGCAATGGGG + Intronic
1078813628 11:14797128-14797150 ACCTGACACAACAAGCAATGGGG - Intronic
1078816067 11:14823524-14823546 ACCTGTGTAAAAAAGCAGTCTGG - Intronic
1078841720 11:15082761-15082783 ACCCAAGAAAGAAAGCAAGGAGG - Intergenic
1078927935 11:15891153-15891175 AACTGAGAACAAAAGCAAAGAGG + Intergenic
1080275139 11:30495249-30495271 TACTGAGCTAAAAAGCAATGTGG + Intronic
1080673360 11:34401596-34401618 AACTTATAAAAAAAGCACTGAGG + Intergenic
1080755231 11:35190975-35190997 ACCATAGAAGAAAAGCAAAGAGG - Intronic
1081007752 11:37768466-37768488 ACTTGAGAAAAAAAGCATTTTGG - Intergenic
1081010615 11:37806769-37806791 ACATGACAAGAAAAGCTATGAGG + Intergenic
1081035027 11:38133474-38133496 ACCTGACAAAATAAGGAATGGGG + Intergenic
1081225567 11:40517986-40518008 ACCTGACAAAATAAGCAATGGGG + Intronic
1081402045 11:42654699-42654721 ACCTGACAAAACAAGCAATGGGG - Intergenic
1082034823 11:47636429-47636451 ATCTCAGAAAAAAAGAAAAGGGG + Intronic
1082581233 11:54872010-54872032 ACCTGAGAAAAACAGGAAATGGG - Intergenic
1082746099 11:56965040-56965062 ACCTGAGAAAAACAAGAAAGGGG + Intergenic
1082753318 11:57046028-57046050 ACCTGATAAAAAAAGCAATGGGG + Intergenic
1082871698 11:57948817-57948839 ACCTGAAAAAACAAGCAATGGGG - Intergenic
1083095820 11:60250040-60250062 AACTGATAAAAACAACAATGTGG - Intergenic
1084437275 11:69151057-69151079 AACTGACAAAAAAAGCAATGGGG + Intergenic
1084555067 11:69871305-69871327 ACCAGAGAAAGAAAGCCAGGAGG + Intergenic
1084566620 11:69932266-69932288 ACATGAGAGAGAAAGGAATGGGG - Intergenic
1085789577 11:79485579-79485601 ACCTGAGAAAGAGAGCAGGGTGG + Intergenic
1086041272 11:82482334-82482356 ACCAGACAAAACAAGCAATGGGG - Intergenic
1086418434 11:86613172-86613194 ACCTGAAAAAATAAGCAATGGGG - Intronic
1086578999 11:88374722-88374744 AGCTGAGAAAAAAAGTAAACTGG + Intergenic
1087111778 11:94477754-94477776 GTCTGAGAGAAAAAGCAATGCGG + Intronic
1087573686 11:99963423-99963445 ACCTGACAAAAAAAGAAATGGGG - Intronic
1087668251 11:101075196-101075218 ATCTGACCAAAAAAGCAATGGGG + Intronic
1087741907 11:101897620-101897642 ACCTGACAAAAAAAGCAATGGGG - Intronic
1088052118 11:105529709-105529731 AGCTGGCAAAACAAGCAATGAGG + Intergenic
1088061470 11:105656247-105656269 ACCTGACAAAATGAGCAATGGGG + Intronic
1088176344 11:107056747-107056769 AACTGACAAAACAAGCAATGGGG + Intergenic
1088690936 11:112326881-112326903 ACCTGACAAAATAAGCAACAGGG - Intergenic
1088935564 11:114396370-114396392 ACCTTTGAAAAAAAGGCATGAGG - Intronic
1089201316 11:116726202-116726224 TCCTGAGAAAGAAAGGAAAGGGG - Intergenic
1090741298 11:129663320-129663342 ACCTGAAAAAACAAGCGATGGGG + Intergenic
1090946576 11:131435055-131435077 ACCTGAGAAAAACAAGAAAGGGG - Intronic
1091050872 11:132369769-132369791 ACCTGACAAAAACAAGAATGGGG + Intergenic
1091903442 12:4164366-4164388 ACCTGAGAATGGAAGCAAGGAGG - Intergenic
1091999651 12:5021667-5021689 ACCTGAGAGGAAAAGGAAAGAGG - Intergenic
1093544609 12:20331904-20331926 ACCTGACAAAAAAAGCAATGGGG - Intergenic
1094393120 12:29974937-29974959 ACCTGACAAAAACAAAAATGGGG - Intergenic
1094668116 12:32541940-32541962 CCCTGAGGAAAAAAGCAGGGTGG - Intronic
1094739514 12:33272806-33272828 ATCTGTGACAAAAAGCTATGCGG + Intergenic
1095104198 12:38212060-38212082 ACCTGACAAAAACAAGAATGGGG + Intergenic
1095105305 12:38226766-38226788 ACCTGACAAAAACAAGAATGGGG - Intergenic
1095613040 12:44154566-44154588 ACATAAGAAAAAAAGCACTTGGG - Intronic
1095745394 12:45652812-45652834 AGCTGAGAAAAAAAGAAAAGAGG + Intergenic
1095748585 12:45686797-45686819 ATCTGAGAAACAAAGCATTCAGG - Intergenic
1095797749 12:46238802-46238824 AACTGAGGAGAGAAGCAATGGGG - Intronic
1095817437 12:46440135-46440157 TCCTGAAAGAAAAAGCCATGTGG + Intergenic
1095903317 12:47351119-47351141 AGCTGAGAAAAGAGCCAATGTGG - Intergenic
1095914648 12:47465048-47465070 ACCTGACAAAACAAGCAATGGGG - Intergenic
1096005575 12:48168220-48168242 TCCTGAAAAGAAGAGCAATGAGG + Intronic
1096483736 12:51961543-51961565 AACTGAGAATAAAACTAATGAGG - Intronic
1096736614 12:53660463-53660485 AACTCAGAAAATAAGCAGTGGGG + Intronic
1097258153 12:57696223-57696245 ACATGAGAAAGATAGCAAAGAGG - Intronic
1097391808 12:59024348-59024370 ACCAGAGAGAACAAGGAATGAGG - Intergenic
1097422282 12:59394909-59394931 ACATGACAAAAAGAGAAATGGGG + Intergenic
1098232134 12:68382311-68382333 TCCTCAGAGAAAAAGGAATGAGG + Intergenic
1099277335 12:80593553-80593575 AGTTGAGAACAAAAGCAATTTGG - Intronic
1099297895 12:80853164-80853186 ACTTGAGAAATATAGCAATCAGG - Intronic
1099902021 12:88722676-88722698 AACTGAGAAAAAAAAAACTGTGG + Intergenic
1099973302 12:89523010-89523032 ACCTGAGCAAAAAAATTATGTGG - Exonic
1100138062 12:91579397-91579419 TTCTGAGAAAATAAGCACTGAGG - Intergenic
1100750427 12:97692575-97692597 ACCTGACAAAACAAGAAATGGGG - Intergenic
1101069398 12:101058127-101058149 ACCTGACAAAAACAGCAATGGGG - Intronic
1102828774 12:115975312-115975334 ACCTAACAAATAAAGAAATGGGG + Exonic
1102832354 12:116015273-116015295 ACCTGAAAAAAAAGGCAATTTGG + Exonic
1102839151 12:116099381-116099403 TGCTGAGAATAAAAGCAATACGG + Intronic
1102891377 12:116561112-116561134 ATCTCAGAAAAAAAGCTGTGGGG + Intergenic
1103254155 12:119526139-119526161 AGGTGACAAAACAAGCAATGGGG + Intronic
1104668885 12:130667096-130667118 ATGGGAGAAAAAAAGGAATGAGG + Intronic
1106561281 13:30848481-30848503 CCCTGAGCAAAAGAGCAAGGAGG - Intergenic
1107012195 13:35680278-35680300 ACCTCAGAATAAACACAATGGGG - Intergenic
1107201227 13:37720422-37720444 ACATGAGAAACCGAGCAATGAGG + Intronic
1107232665 13:38129398-38129420 AGTTGACAAAACAAGCAATGAGG - Intergenic
1107397924 13:40037463-40037485 ATTTGACAAAACAAGCAATGAGG - Intergenic
1107615698 13:42164770-42164792 AGCTGAGAAAATAAGCATGGGGG + Intronic
1108697322 13:52913894-52913916 AGCAGAAAAAAACAGCAATGTGG - Intergenic
1108985113 13:56576939-56576961 ACCTGAGAAAACAAGCAATGGGG + Intergenic
1109161679 13:58983098-58983120 ACCTGACAAAAACCGCAATTGGG - Intergenic
1109388093 13:61658672-61658694 ACCTCGCAAAACAAGCAATGGGG - Intergenic
1109721363 13:66280506-66280528 ACTAGAGAAAAAAATCAATCAGG + Intergenic
1109736621 13:66494133-66494155 ACCTGAGTAGAAAAGGAATCTGG + Intronic
1110071711 13:71186002-71186024 ACCTGACAAAACAAGAAATGGGG + Intergenic
1111434855 13:88193169-88193191 ACCTGACAAAACAAGAAATGGGG - Intergenic
1111488290 13:88934031-88934053 AAGTGAGAAAAAAAGAAATGTGG + Intergenic
1111639314 13:90947399-90947421 GCCTGAGAAAAAAAATAAAGGGG + Intergenic
1111967517 13:94875953-94875975 ACCTGACAGAACAAGAAATGGGG + Intergenic
1112056816 13:95696632-95696654 AACTGGGAAAAAAAGCAAGCTGG - Intronic
1112371345 13:98796453-98796475 CCCTCACAAAAAAAACAATGTGG + Intronic
1112998925 13:105609173-105609195 ACTTAAGAAAAAAAACAATTTGG - Intergenic
1113110982 13:106823494-106823516 TGCTGAGGAAAAGAGCAATGAGG - Intergenic
1113180940 13:107625244-107625266 ACTTGAGAAACAATGAAATGTGG + Intronic
1113488551 13:110674441-110674463 ACCTGACAAAAAAAGAAATGGGG + Intronic
1114058819 14:19000578-19000600 ACCTTAAAAAAAATTCAATGAGG + Intergenic
1114103725 14:19401176-19401198 ACCTTAAAAAAAATTCAATGAGG - Intergenic
1114191363 14:20441711-20441733 ACCTGAAAGGAGAAGCAATGAGG - Intergenic
1114459941 14:22879902-22879924 GCCCAAGAAAAAAAGAAATGAGG + Exonic
1114947477 14:27702838-27702860 AACTAAGAAAAAAATCAATTTGG - Intergenic
1115179758 14:30610009-30610031 TCCTGAGGAAGAAAGCAATATGG - Intronic
1115947251 14:38676024-38676046 ACCTGACAAAACAAGAAATGGGG + Intergenic
1116131915 14:40865370-40865392 GTCTGAGAGAAAAAGCAATAGGG - Intergenic
1116354050 14:43905107-43905129 ACCTGACAAAACAAGCACTGGGG - Intergenic
1116671727 14:47850835-47850857 ACCAGACAAAACAAGCAATGGGG + Intergenic
1117030334 14:51662524-51662546 ACCTGACAAAACAAGCAATGGGG + Intronic
1117210671 14:53495651-53495673 AAGTGAGAAAAAAAGGGATGTGG + Intergenic
1117386466 14:55218805-55218827 AACAGAAAAAAAAAGCAATGAGG - Intergenic
1117470734 14:56041810-56041832 GGCTGAGAAAAAAAGAAAAGGGG - Intergenic
1117640249 14:57790860-57790882 ACCTGACAAAAAATGCAATGGGG + Intronic
1117655888 14:57956166-57956188 ACCTAACAAAACAAGAAATGGGG + Intronic
1117840599 14:59856694-59856716 ACCTCAGCCAAATAGCAATGGGG - Intronic
1117893069 14:60447919-60447941 ACCTGACAAAAACAGCAACGGGG + Intronic
1117945046 14:61010648-61010670 ACCTGAGAAAAACAGGAAATGGG - Intronic
1118124638 14:62887867-62887889 AGTTGAGAAAAAAAGTGATGAGG - Intronic
1118579011 14:67274387-67274409 ACCTGACAAAAACAAAAATGGGG - Intronic
1119869562 14:78004519-78004541 TAGAGAGAAAAAAAGCAATGGGG + Intergenic
1120563397 14:86024734-86024756 ACCTGACAAAAAAAGAAATGGGG - Intergenic
1121072972 14:91041773-91041795 ACCTGACAATAAGAGCAAAGTGG - Intronic
1121612250 14:95289650-95289672 ACCAGGGAAAAGAAGCAATCAGG + Intronic
1122141823 14:99667318-99667340 AGCTGAGAAAAAAAAAAAAGAGG - Intronic
1122833111 14:104413293-104413315 ACCTGACAAAAAAAGAAATGGGG - Intergenic
1123157629 14:106244170-106244192 ACCTGACAAAACAAGAAATGGGG - Intergenic
1123179406 14:106454272-106454294 GGCTGACAAAACAAGCAATGGGG - Intergenic
1123188608 14:106545101-106545123 TCTTGAGAACAAAAACAATGAGG - Intergenic
1123221149 14:106857128-106857150 ACCTGACAAAAACAGCAATGGGG - Intergenic
1123550479 15:21374098-21374120 ACCTGAAAAATAAATTAATGAGG + Intergenic
1124683921 15:31762321-31762343 GACAGAGAAAAAAAGCAATGAGG - Intronic
1124866429 15:33496527-33496549 AGATGAGAGAAAAAGCAAAGGGG + Intronic
1126278039 15:46907786-46907808 ACCTGGAAAAACAAGCAATGAGG - Intergenic
1126982811 15:54265222-54265244 TCATGAGAATGAAAGCAATGGGG + Intronic
1127136297 15:55927245-55927267 ACATGAGAAAAGAAGGCATGGGG + Intronic
1127185641 15:56477084-56477106 ACCTGAAAAAAAAAGAAATGGGG - Intergenic
1127778873 15:62293932-62293954 AGCTGAGAAAACAAGCAATGGGG + Intergenic
1128214620 15:65925675-65925697 TCCTGAAAAATAAAGCAAGGGGG - Intronic
1128729650 15:70012546-70012568 AACTGAGTAAAAAAGTAATTTGG - Intergenic
1129954939 15:79627829-79627851 ACCTGAGCAAAAAGGCAAAATGG + Intergenic
1131064826 15:89427568-89427590 TCCTGAGAATAAAGCCAATGTGG - Intergenic
1132060179 15:98686036-98686058 ACTTGGGGAAAAAGGCAATGGGG - Intronic
1132436968 15:101814689-101814711 AGATGAGAAAAAAAGAAAAGGGG - Intronic
1134013280 16:10870993-10871015 ATTTGAGAAACAAATCAATGTGG + Intergenic
1134188552 16:12103418-12103440 ACCTGACAAAATAAGCAATGGGG + Intronic
1134815438 16:17201849-17201871 GCCTGAGAAGAAAACTAATGTGG + Intronic
1135210003 16:20517216-20517238 ATCTCAGAAAAAAAACAATGAGG + Intergenic
1135376179 16:21949383-21949405 ACCTGTGAAAATAAGCTATCAGG + Intergenic
1136600118 16:31280002-31280024 ACCTGAAAAAACAAGAAATGGGG - Intronic
1138726201 16:59141970-59141992 ACCTGATAAAAAAAACATTTAGG - Intergenic
1139038567 16:62977145-62977167 ACCAAAGAAAAAAATGAATGAGG + Intergenic
1139121214 16:64019833-64019855 ACCTAATAAAGAAACCAATGTGG + Intergenic
1139460097 16:67115152-67115174 ATCTGTGAAACAAAGCAATTAGG - Intronic
1140258971 16:73360896-73360918 CCATGCAAAAAAAAGCAATGGGG + Intergenic
1140755344 16:78061521-78061543 AGCTGAGAAAAAAAGCACAGAGG + Intronic
1142526396 17:544774-544796 ATCTAAGAAAATAAGCAATATGG + Intronic
1144383084 17:14722317-14722339 AGCTGACAAAACAAGTAATGGGG + Intergenic
1145227367 17:21141356-21141378 ATTTGAGAGAAAAAGCAATAGGG + Intronic
1145833250 17:27934637-27934659 CTCTGATAAAAAAAGCAATATGG - Intergenic
1146081555 17:29784896-29784918 AGGAGAGGAAAAAAGCAATGTGG - Intronic
1146506491 17:33410120-33410142 ACCTGAGACAGGTAGCAATGAGG + Intronic
1146622477 17:34409783-34409805 AGCTGACAAAAACAGCAATGGGG + Intergenic
1146743698 17:35309066-35309088 ACCTGATAAAACAAGCAATGGGG + Intergenic
1146765537 17:35517774-35517796 AACTGACAAAACAAACAATGGGG + Intronic
1147905752 17:43821788-43821810 ACAGGAAAAAAAAAGCAATCAGG + Intronic
1148076519 17:44939493-44939515 AGCCAAGAAAAAGAGCAATGAGG - Intronic
1148370031 17:47092088-47092110 ACCTGAGAGAGAAAGCATTCAGG - Intergenic
1148980440 17:51569550-51569572 ACCTGACAAAAAAAAGAATAGGG - Intergenic
1149231838 17:54544200-54544222 ACCAGAGTAAAAAAGCAACATGG + Intergenic
1149235447 17:54584970-54584992 AGCTGAGAAAACAAGCAATAGGG + Intergenic
1149253672 17:54799909-54799931 ACCTGACACACACAGCAATGGGG + Intergenic
1150306405 17:64089016-64089038 CTCTGAGAAAAAGAGGAATGTGG + Intronic
1150551476 17:66214615-66214637 ACCTGTGAAAAAAGCCACTGTGG - Exonic
1150589961 17:66553605-66553627 ATCCAAGAAAAACAGCAATGAGG - Intronic
1150914148 17:69419597-69419619 TCATGAGAAAAAAAGAAATTTGG - Intronic
1150942819 17:69711727-69711749 AACGCAGAAGAAAAGCAATGTGG + Intergenic
1151019353 17:70596270-70596292 ACCTCAGAAATAAAACAAAGGGG - Intergenic
1152482550 17:80564710-80564732 ATCTGAAAAAAAAAGCTATTGGG - Intronic
1153213249 18:2791287-2791309 ACCAAAGAAAAAAACCACTGAGG + Intronic
1153542271 18:6168553-6168575 ACCTGAGAAAAAAAGCAATGGGG + Intronic
1153701921 18:7702943-7702965 ACCTGACAAAAACAGCAATGGGG - Intronic
1154183927 18:12163986-12164008 AACTGATACAAAAAGCAAAGAGG - Intergenic
1154288144 18:13079901-13079923 ACCTGACAAAAAAAGAAATGGGG - Intronic
1154288740 18:13085659-13085681 ACTTGACAAAACAAGAAATGGGG - Intronic
1154451499 18:14479480-14479502 ACCTGAAAAATAAAGTAATAAGG + Intergenic
1155735729 18:29220161-29220183 ACCTGACAAAAAAAGAAATGGGG + Intergenic
1155769104 18:29674079-29674101 GGATGAGAAAACAAGCAATGTGG + Intergenic
1155856887 18:30845530-30845552 ACCTGACAAATCAAGCAAGGGGG - Intergenic
1155861636 18:30908981-30909003 AGTTGACAAAAAAAGCAATGGGG + Intergenic
1156008065 18:32467146-32467168 ACAGGAGAAAAAAAACATTGGGG - Intronic
1156402315 18:36750749-36750771 AGCTGACAAAACAAGCAATGGGG - Intronic
1156551015 18:38016805-38016827 ACCTGACAAAACAAGCAATGGGG - Intergenic
1156648723 18:39199101-39199123 ACCTGAGTCAAAAAGTAAGGTGG + Intergenic
1156850580 18:41721149-41721171 AGGTCAGAAAGAAAGCAATGTGG + Intergenic
1157199130 18:45643965-45643987 ACCTGGAAACAAAAGCATTGGGG - Exonic
1157396890 18:47349492-47349514 ACCTGGAAAAACAAGCAATGGGG - Intergenic
1157974550 18:52312106-52312128 ACTTCAGAAAAAAATCACTGTGG - Intergenic
1158078347 18:53559017-53559039 AGTTGATAAAATAAGCAATGAGG + Intergenic
1158095776 18:53768953-53768975 ACCTGACAAAACAAGCAATGGGG + Intergenic
1158098430 18:53802143-53802165 ACCTGACAAAAACAGCAATCAGG - Intergenic
1159146125 18:64456626-64456648 ACCTGACAGAAACAACAATGGGG + Intergenic
1159148195 18:64482117-64482139 ACCAGAGAAAAAAAAGAAAGAGG - Intergenic
1159509221 18:69375087-69375109 ACCTGGGAAAAACAGGTATGAGG + Intergenic
1159885975 18:73907267-73907289 AACTGAGAAAAAGCACAATGAGG + Intergenic
1160432940 18:78824747-78824769 AACTGAGAACAGAAGCAATTGGG + Intergenic
1163165932 19:15498198-15498220 ACCACAGTAAAAAAGTAATGTGG - Intronic
1164266029 19:23618377-23618399 ACCTGACAAAAAAAGAAATGGGG + Intronic
1164406323 19:27950079-27950101 ATGTAAAAAAAAAAGCAATGAGG + Intergenic
1164866531 19:31608901-31608923 GCCTGAGAAAGAAAGCAATGTGG + Intergenic
1164935772 19:32210060-32210082 ACCACAGAAAAAAAGCCTTGTGG + Intergenic
1165537597 19:36462473-36462495 AACAGAGAAAAAAAGTAATAGGG + Intronic
1165577338 19:36832022-36832044 ACTTGTGAAAAAAACAAATGAGG + Intronic
1166142948 19:40815041-40815063 ACCTGAGAGAAAAAGAAAAAGGG - Intronic
1166184609 19:41131764-41131786 ACCTGAGAGAAAAAGAAAAAGGG + Intergenic
1166433352 19:42745212-42745234 ACTTGAGAAAACAAGCAATGGGG - Intronic
1166632801 19:44422137-44422159 ACCTGACAAAAAAAGCAATGGGG - Intronic
1167477813 19:49711094-49711116 ATCTCAAAAAAAAAGAAATGGGG - Intronic
1167791226 19:51683529-51683551 ACCAAAGAAAAAAATAAATGAGG + Intergenic
1167964444 19:53132189-53132211 ACCTGAGACAGGAAGGAATGAGG - Intronic
1168602752 19:57732147-57732169 ACCTGAAAAAACAAACAATGGGG + Intronic
925053793 2:839450-839472 ACCTGACAAAAACAGCAATGGGG + Intergenic
925133044 2:1507149-1507171 ACCTGACAAAAACAACAATGGGG - Intronic
925459828 2:4051202-4051224 ACGTAAGAAAAAAATCTATGTGG - Intergenic
925647356 2:6050024-6050046 AGCTGACAAAAAAAGCAATGGGG + Intergenic
925889388 2:8421450-8421472 ACCTGAAAAGGAAAGCAAGGTGG - Intergenic
927015501 2:18955949-18955971 ATCTGACCAAAAAAGCAATGGGG + Intergenic
928486898 2:31741427-31741449 ACCTGACAAAACAAGAAATGGGG - Intergenic
928488003 2:31752185-31752207 ACCTGACAAAACAAGAAATGGGG + Intergenic
928971586 2:37035209-37035231 ACCTGAGAATAACTGCAGTGGGG - Intronic
929062467 2:37937169-37937191 ACCTGACAAAAACAGCAATAGGG - Intronic
929335941 2:40745642-40745664 ACCAGAGATTAAAAGCAAAGAGG - Intergenic
929358570 2:41055578-41055600 ACCTGACAAAAAAAGAAATAGGG - Intergenic
929503760 2:42512080-42512102 ACCTGAGAAGTATAGCAATCTGG + Intronic
929636443 2:43526531-43526553 AGCAGAGAGAGAAAGCAATGGGG - Intronic
929879707 2:45825076-45825098 CCCGGAGGAAAAAAGTAATGTGG - Intronic
929960825 2:46495038-46495060 ACCTGAGAATAAAATCGATATGG + Intronic
930127900 2:47817412-47817434 CCCTGAGAAACTAAGCAATAAGG + Intronic
930270173 2:49247045-49247067 ACCTGACAAAATAAAAAATGGGG + Intergenic
930327669 2:49940724-49940746 GCTTGAGAAAAAAAGTAATAGGG + Intronic
930353707 2:50290922-50290944 CCCTGAGAAAAAATGCAGTTTGG - Intronic
930370579 2:50496094-50496116 ACCTGGGAAAAAAATGAAAGAGG + Exonic
930433684 2:51313970-51313992 ACCTCAGAAAACAAGCAATGGGG - Intergenic
930598693 2:53418906-53418928 ATCTGACAAAACAAGCAATGGGG - Intergenic
930933354 2:56916837-56916859 ACCTGACAAAACAAGCAATGGGG + Intergenic
931318165 2:61151713-61151735 ACCTGAGAGAAAAGGCAAGGAGG + Intronic
931420991 2:62127602-62127624 ACCTGACAAAAAAAGCAATGGGG + Intronic
931846661 2:66211099-66211121 ACCTGAGAAAACAAGCAATGGGG + Intergenic
932098872 2:68878219-68878241 ACCTGAAAGGAAAAGAAATGTGG + Intergenic
932339803 2:70956057-70956079 TGCTGAGAACAAAACCAATGAGG - Intronic
932891513 2:75600976-75600998 ACCTGAGAAGAGAAGCCTTGAGG - Intergenic
932966748 2:76484869-76484891 AAATGGGAAAAAAAGCTATGAGG - Intergenic
933212970 2:79592874-79592896 TCCTTAGAAAAAAATCACTGAGG - Intronic
933944253 2:87271252-87271274 ACCTGACAAAACAAGAAATGGGG - Intergenic
934251985 2:90363222-90363244 CCATGTGAAGAAAAGCAATGAGG - Intergenic
934257455 2:91439734-91439756 CCATGTGAAGAAAAGCAATGAGG + Intergenic
934989208 2:98909741-98909763 ACCAGGGAAAAAGAGCAAAGTGG - Intronic
935020706 2:99228283-99228305 ACCTGACAAAACAAGAAATGGGG + Intronic
935451670 2:103216636-103216658 ATCTGACAAAAACAACAATGGGG + Intergenic
935651667 2:105387345-105387367 ACCTGAGATTAGATGCAATGAGG + Intronic
936335963 2:111590327-111590349 ACCTGACAAAACAAGAAATGGGG + Intergenic
936582406 2:113713113-113713135 ACCTGTGAGAAAAAGCAAACAGG + Exonic
936605965 2:113954577-113954599 ATCTGAAAAAAAAAAAAATGTGG - Intronic
936669113 2:114635121-114635143 AACAGAAAAAAAAAACAATGAGG - Intronic
936947521 2:117943911-117943933 ACTAGAGAAAATAAGTAATGAGG - Intronic
937494047 2:122399334-122399356 ATCTGAGAAGAAACGCATTGGGG + Intergenic
937648684 2:124296238-124296260 ACCTGAGAAATAAATCTTTGTGG - Intronic
938691620 2:133795773-133795795 AGCTGAAAAAAAAAACAAAGAGG - Intergenic
939025057 2:137002580-137002602 AACAGAGAATAAAAGCAAAGGGG - Intronic
939393398 2:141598281-141598303 ACTTGAAATAAAAAGCAATAAGG + Intronic
939412860 2:141853689-141853711 AACTGATAAAAAAAATAATGAGG + Intronic
939543731 2:143526264-143526286 ATCTAAGAAATACAGCAATGTGG + Intronic
940603242 2:155887080-155887102 ACCTGAGAAAGAAATCAATAAGG + Intergenic
940710472 2:157156549-157156571 AGCTAAGAAAAAAAAGAATGGGG + Intergenic
941278704 2:163523166-163523188 ACTGGAAAAAAGAAGCAATGGGG - Intergenic
941762756 2:169262971-169262993 ACCTGAGAAAAAAAGCAATGGGG + Intronic
941901071 2:170678772-170678794 ACCTGAGAAAAAAATGAAATGGG + Intergenic
942003579 2:171675473-171675495 AACTGAGAAAGAAATCAAAGTGG - Intergenic
942362921 2:175191605-175191627 ACCTGACAAAATAAGAAATGGGG + Intergenic
942429489 2:175895211-175895233 ACCTGACAAAAATGGCAGTGGGG + Intergenic
942607139 2:177704454-177704476 GCCTGAGACAAAAGGCACTGAGG - Intronic
942848950 2:180459900-180459922 ATGTGAGAAAAATAGAAATGTGG + Intergenic
943136067 2:183914409-183914431 ACCTGAGAAAAACAGCAATGGGG - Intergenic
943232406 2:185271614-185271636 ACCTGACAAAACAAGCAATGGGG - Intergenic
943555827 2:189402658-189402680 ACCTGACAAAAGCAACAATGGGG - Intergenic
943765112 2:191652504-191652526 ACCTGAAAAGAATAGGAATGGGG - Intergenic
943871108 2:193000991-193001013 ACAATAGAAAAAAAGTAATGAGG - Intergenic
943890354 2:193278149-193278171 ACCTGACAGAAAAAAAAATGAGG + Intergenic
944439745 2:199730077-199730099 ACCTGACAAGAACAACAATGGGG + Intergenic
944537053 2:200721224-200721246 ACTGGAAAAAAAAAGAAATGAGG + Intergenic
945344203 2:208693591-208693613 ATCTTAGAATAATAGCAATGTGG - Intronic
945461300 2:210112221-210112243 ACCTAACAAAAACAGCAATGGGG + Intronic
945510996 2:210702649-210702671 AAGTGAGAAGAAAAGCACTGTGG + Intergenic
945611323 2:212007749-212007771 ACCTGAGAAGAATATTAATGAGG + Intronic
945696218 2:213108171-213108193 ACCTGTGAAAAAATGAAATAAGG + Intronic
945720863 2:213416828-213416850 AACTGGGAAAAACACCAATGTGG + Intronic
945830898 2:214783745-214783767 ACCTAACAAAACAAGCAATGGGG + Intronic
946019178 2:216628557-216628579 AGTTGAGAAAATAAGCAATGGGG - Intergenic
946091818 2:217232696-217232718 CCTTGAAAAAGAAAGCAATGGGG - Intergenic
946774138 2:223119931-223119953 AGCTGAGAAAAAAAGCCACTGGG + Intronic
947353259 2:229268607-229268629 AAATGAGAAAAAAATTAATGAGG + Intronic
947688204 2:232109603-232109625 ACCTGACAAAATAAGCAAGGGGG + Intronic
947852287 2:233298072-233298094 ACACGAGAGAAAAAGCCATGCGG - Intergenic
947978649 2:234388975-234388997 ACCTGACAAAACAAGCAACGGGG + Intergenic
948240011 2:236422927-236422949 ACCTGAAAAAACAAGAAATGGGG + Intronic
948610038 2:239161077-239161099 ACCTCACAAAAAAAGGCATGGGG - Intronic
1168916732 20:1494663-1494685 ACTTGAGAGATAAAGCAGTGAGG + Intergenic
1170228933 20:14023665-14023687 ACCTGACTAAACAAGCAATGGGG - Intronic
1170258325 20:14372657-14372679 AACTAAGAAATAAAGGAATGGGG - Intronic
1170902668 20:20481043-20481065 ACCTGAGAAAGAAATTAATTTGG - Intronic
1171274060 20:23840341-23840363 ACCTGACAAAAACAAAAATGGGG + Intergenic
1171575083 20:26302347-26302369 ACCTGAGAAAACAAGCAACGGGG - Intergenic
1171726550 20:28626949-28626971 GTCTGAGAATAAAATCAATGGGG - Intergenic
1171790629 20:29520206-29520228 GTCTGAGAATAAAATCAATGGGG - Intergenic
1171857078 20:30356629-30356651 GTCTGAGAATAAAATCAATGGGG + Intergenic
1173055635 20:39609801-39609823 ACCTGACAAAACACGCAATGGGG + Intergenic
1173738701 20:45380419-45380441 GCCTAGGAAAGAAAGCAATGTGG + Intronic
1174373249 20:50108439-50108461 ACCTCAGAGAATAAGAAATGGGG + Intronic
1174888951 20:54368728-54368750 ACTTGAGCTAAAAAGCCATGTGG + Intergenic
1176444645 21:6810748-6810770 ACCTGAAAAATAAAGTAATAAGG - Intergenic
1176822811 21:13675786-13675808 ACCTGAAAAATAAAGTAATAAGG - Intergenic
1176909001 21:14540018-14540040 ACCTGAGAAAACAAGCAATGGGG + Intronic
1176970743 21:15262693-15262715 ACCTGAGAAAAACAGGAAATGGG - Intergenic
1177086154 21:16707248-16707270 GTGTGAGAAAAAAAGCAATAGGG + Intergenic
1177090254 21:16758964-16758986 ACCTGAGAAAAACAGGAAATGGG + Intergenic
1177126385 21:17198407-17198429 AACAAAGAAAAAAAGAAATGTGG - Intergenic
1177388575 21:20438090-20438112 AACTGACAAAAAAAGCTATGGGG + Intergenic
1177463795 21:21447276-21447298 ACCTGACAAAACAAGCAATGGGG + Intronic
1177500874 21:21952977-21952999 ATCTGAGAAAGAAAGGAAGGGGG - Intergenic
1177535721 21:22424253-22424275 ATTTGAGAAATAAAGCACTGGGG + Intergenic
1177544579 21:22539908-22539930 GGTTGACAAAAAAAGCAATGAGG + Intergenic
1177951361 21:27542079-27542101 ATCTGACAAAACAAGTAATGGGG + Intergenic
1178033950 21:28559851-28559873 CCCAAAGAAAACAAGCAATGGGG + Intergenic
1178079420 21:29047767-29047789 ACTCAAAAAAAAAAGCAATGGGG - Intronic
1178828874 21:36038475-36038497 AGCTGAGAATAAAAGCACGGGGG + Intronic
1179247702 21:39648047-39648069 AGCTAAGAATCAAAGCAATGAGG - Intronic
1180477304 22:15723194-15723216 ACCTTAAAAAAAATTCAATGAGG + Intergenic
1180524271 22:16239907-16239929 ACCTGCAAAAACAAGCAATGGGG + Intergenic
1182761742 22:32727966-32727988 ACCTGACCAAACAAGCAATGGGG + Intronic
949432773 3:3995601-3995623 ACCTGACAAAACAAGCAATGAGG - Intronic
949656646 3:6228403-6228425 ACTTGAGAATCAAATCAATGTGG - Intergenic
950171022 3:10839195-10839217 ACCTGAAAACAAAACAAATGTGG + Intronic
950315390 3:11997443-11997465 ACCTCAGAAAAAAAAAAAAGAGG - Intergenic
951070411 3:18321753-18321775 AGCTGATAAAACAAGCAATGAGG - Intronic
951197670 3:19842169-19842191 ACCTGACAAAACAAGTAATGGGG - Intergenic
951296863 3:20947875-20947897 GCCAAAAAAAAAAAGCAATGGGG - Intergenic
951461317 3:22954677-22954699 ACCTGAGAAAAACAGGAAATGGG - Intergenic
952010010 3:28889874-28889896 ACCTGACAAAAAAAGCAATGGGG - Intergenic
952101708 3:30020778-30020800 ACCAGAGAAAAAAATAAATAAGG - Intergenic
952238324 3:31503484-31503506 AACTAAGAAACAAAGCAAAGAGG - Intergenic
952522235 3:34173086-34173108 ACCTGACAAAACAAGCAATGGGG - Intergenic
952998994 3:38913758-38913780 AGCTGACAAAACAAGCAATGAGG - Intronic
953116620 3:39998903-39998925 ACCTGACAAAACAAGCAATGGGG + Intronic
953178796 3:40577861-40577883 GACTGAGAAAAAAAAAAATGTGG - Intergenic
953287092 3:41621490-41621512 ACCTGACAAAAACAAAAATGGGG + Intronic
953721450 3:45358896-45358918 AGTTGACAAAACAAGCAATGGGG - Intergenic
953798462 3:46003184-46003206 ACCTGTTAAGAAGAGCAATGAGG + Intergenic
954525460 3:51266554-51266576 ACCTGACAAAAGAAGCAATGGGG + Intronic
954998015 3:54899789-54899811 ACCAGTCAATAAAAGCAATGTGG + Exonic
955439036 3:58935649-58935671 ACCTGAGAAAAACAGCAATGGGG + Intronic
955637684 3:61047851-61047873 ACATGAAAAAACAAGCAATGGGG + Intronic
955825964 3:62948302-62948324 ACATGAGAAAAAAATGGATGGGG - Intergenic
955854683 3:63260446-63260468 ACCTGACAAAACAAGAAATGGGG + Intronic
956940474 3:74155094-74155116 ACATGAGAAAAAAAGCAAAGTGG + Intergenic
957456978 3:80464253-80464275 GCCATAGAAAAAGAGCAATGGGG - Intergenic
957632776 3:82739281-82739303 ACCTGGCAGAAAAAGAAATGAGG - Intergenic
957688513 3:83536947-83536969 ACCTGAAAAAAAAAGAAATGGGG + Intergenic
957721855 3:84012473-84012495 ACCTGACAAAATAAGAAATGGGG + Intergenic
957739861 3:84250450-84250472 ACCTAACAAAATAAGCAATAGGG - Intergenic
958270552 3:91493769-91493791 ACTTGAGAAACAAAGCAGTGTGG + Intergenic
958673584 3:97236028-97236050 ACCTGAGAAAAAAAGTTAAGAGG - Intronic
958746707 3:98144612-98144634 ATCTGACAAAAAGTGCAATGGGG + Intergenic
959119876 3:102220684-102220706 ACCTGACAAAACAAGCAACGGGG - Intronic
959175618 3:102905632-102905654 ACCTGAGAAAAGTAGGAGTGAGG - Intergenic
959494804 3:107037830-107037852 ACCTGATAAAACAAGTAATGGGG + Intergenic
959642789 3:108660364-108660386 ACCTGACAAAAACAGAAATTGGG + Intronic
959829597 3:110844569-110844591 ACCTAACAAAAAAAGCAATGGGG + Intergenic
959957092 3:112251767-112251789 ACCTGTGTAAAAAAGCAAGCTGG - Intronic
959986165 3:112573792-112573814 ACCTGACAAAAAAAGCTTTTTGG - Intronic
960177946 3:114539463-114539485 ACCTTAGGACATAAGCAATGTGG + Intronic
960306602 3:116069553-116069575 TCCTCAGAAAAAAAAAAATGTGG + Intronic
960343273 3:116501306-116501328 AACTGAAAAAACAAGCAATGGGG + Intronic
960607165 3:119518468-119518490 ATATGAGAAGAAAAGCATTGAGG + Intronic
961009551 3:123426714-123426736 CCCTGAGAAAGGAAGCTATGTGG + Intronic
961583859 3:127905884-127905906 ACCTGACAAAATAAGCAATGGGG + Intergenic
961912899 3:130339086-130339108 ACAAAAAAAAAAAAGCAATGAGG - Intergenic
962004023 3:131330220-131330242 AACTGAGATAAACAGAAATGGGG + Intronic
963260080 3:143183672-143183694 ATCTGAGAAGAACAGCCATGGGG + Intergenic
963307285 3:143667207-143667229 ACCTGACCAAAAAAGAAATGGGG + Intronic
963320938 3:143808301-143808323 ACCTGAGTAAAAAAGCTTTTTGG + Intronic
963381859 3:144540676-144540698 AATTGACAAAATAAGCAATGGGG + Intergenic
963387507 3:144615873-144615895 ACCTCAAAAAACAAGCAATGGGG - Intergenic
963556432 3:146794641-146794663 ACCAAAGAAAAAAATCACTGTGG + Intergenic
963694251 3:148544837-148544859 ACCTGACAAAAAAAGCAATGAGG + Intergenic
964179796 3:153869141-153869163 ACCTGACAAAAACAAAAATGGGG - Intergenic
964241071 3:154595349-154595371 ACCTGAGAAAACAAGCAATGGGG - Intergenic
964296120 3:155235325-155235347 AATTGAAAACAAAAGCAATGGGG - Intergenic
964695518 3:159503522-159503544 ACCTGACAGTAAAAGCCATGAGG + Intronic
964780063 3:160327553-160327575 ACCTGACAAAACAAGCAATGAGG + Intronic
964886222 3:161486244-161486266 CACTGATTAAAAAAGCAATGGGG - Intergenic
965148166 3:164933346-164933368 ACCTGAGAATTAAAACAAGGAGG + Intergenic
965621494 3:170646395-170646417 ACCTGACAAAAACAAGAATGGGG - Intronic
965808563 3:172568198-172568220 AGCTGACAAAACAAGCAATGGGG - Intergenic
966059166 3:175734164-175734186 ACCTCTGCAAAAAAGAAATGTGG - Intronic
966291612 3:178366007-178366029 ACCTGACAAAACAAGAAATGGGG + Intergenic
966313911 3:178624863-178624885 ACCAGAGAAAAAAGACCATGGGG - Intronic
966389429 3:179436667-179436689 TCCTGAGAAAGAAAGCCACGTGG - Intronic
969410220 4:7023296-7023318 TCCTGAGAAAAAAACGGATGGGG - Intronic
970012652 4:11476846-11476868 AGCTGACAAAACAAACAATGAGG + Intergenic
970210003 4:13699631-13699653 AGCTGACAAAATAAGCAATGGGG - Intergenic
970353601 4:15230622-15230644 ACCAAAGAAAAAAAGAAATTGGG + Intergenic
970475823 4:16421869-16421891 ACCTGAGAAAACAAGCAATGGGG + Intergenic
971067431 4:23049556-23049578 ACCTGAGAACAACAACAATAAGG + Intergenic
971693936 4:29873474-29873496 ACCTGACAAAAGAAGAAATGGGG - Intergenic
971815243 4:31478422-31478444 GGCTGACAAAAAAAGCAATGGGG - Intergenic
971817571 4:31508169-31508191 ACTTAAGAAAAAAATCAATGAGG - Intergenic
971863884 4:32143716-32143738 ACCTGAAAAAACAAGCAATGAGG - Intergenic
972219751 4:36940465-36940487 ACCTGACAAAACAAGCAATGAGG + Intergenic
972572254 4:40321218-40321240 AAAAGAGAAAAAAAGCTATGTGG + Intergenic
973098581 4:46232647-46232669 GCCTGCAAAAACAAGCAATGGGG - Intergenic
973328429 4:48887602-48887624 ACCTGAAAAAACAAGAAATGGGG - Intronic
973683410 4:53344825-53344847 ACCTGAGAAAACAAGCAACGGGG + Intronic
973722505 4:53739512-53739534 ACCTGAGAAAACAAGCAATGGGG + Intronic
973733623 4:53848232-53848254 ACCCTTGGAAAAAAGCAATGAGG - Intronic
974110463 4:57519786-57519808 ACCTGGCAAAAAAAGAAATGGGG + Intergenic
974236765 4:59191765-59191787 ACCTGAGAACAAAAGTAAACCGG + Intergenic
974539414 4:63214767-63214789 ATATGACAAAACAAGCAATGGGG - Intergenic
974562879 4:63544392-63544414 AGTTGAAAAAATAAGCAATGAGG + Intergenic
974649841 4:64741135-64741157 ACCTGAGAAAAACAACAATGGGG + Intergenic
974805331 4:66872296-66872318 AACAGAGTGAAAAAGCAATGTGG - Intergenic
974854264 4:67440765-67440787 ACCTGACAAAAACAAGAATGGGG + Intergenic
974888994 4:67855913-67855935 AGCTGAGAAAAAAATCAAGAAGG + Intronic
975166124 4:71180077-71180099 ACCTGACAAAAACAAGAATGGGG + Intergenic
975483734 4:74911458-74911480 ACCTGACAAAAAAAACAATGGGG - Intergenic
975496547 4:75041790-75041812 ACTAGAGAAAGAGAGCAATGAGG + Intronic
975513181 4:75216271-75216293 ACCTGACAAAACAAGCAATAGGG - Intergenic
975541468 4:75516539-75516561 ATGTGAGAAAAAATGAAATGAGG + Intronic
975549508 4:75596838-75596860 TTCTGAGAATAAAAACAATGTGG + Intronic
975677356 4:76840481-76840503 AGCTGAGACAAAAAGCAAAATGG - Intergenic
976371813 4:84298763-84298785 AGCTGAGAAAGAAATCAAGGAGG + Intergenic
976459256 4:85289026-85289048 ACTTAACTAAAAAAGCAATGGGG + Intergenic
976524486 4:86071657-86071679 ACCTGAGAAAAACAACAATGGGG - Intronic
976912941 4:90330586-90330608 AGCTGAGAAAAAAAGAAGTGAGG + Intronic
978117087 4:105032529-105032551 ACCTGACAAAACAAGAAATGGGG + Intergenic
978544283 4:109853851-109853873 ACCTGACAAAACAAGCAATGGGG - Intronic
978657291 4:111079425-111079447 ACCTGACAAAACAAGCAATAGGG + Intergenic
978744632 4:112178470-112178492 AGCAGACAAAACAAGCAATGGGG - Intronic
978867676 4:113534282-113534304 ATCTGAGAAAAAAGGAGATGTGG - Intronic
979338037 4:119486429-119486451 ACCTGACAAAAACAAGAATGGGG + Intergenic
979459016 4:120959103-120959125 CTTTGAGAAAAAAAGCGATGTGG + Intergenic
979477911 4:121180057-121180079 ACCAGAGAAAAAAAGCGGGGAGG + Intronic
979982934 4:127278465-127278487 AACTTAGAATAAAAGCAGTGAGG + Intergenic
979985822 4:127313130-127313152 ACCTGACACAGCAAGCAATGGGG + Intergenic
979998266 4:127459385-127459407 ACCTGACAAAAGAAGCAATGGGG - Intergenic
980198612 4:129624954-129624976 ACCTGACAAAACAAGAAATGGGG - Intergenic
980328963 4:131386550-131386572 AGCTGACAAAAACAACAATGGGG - Intergenic
980517098 4:133877699-133877721 ACCTGCGTAAAAAAGCAGTCTGG + Intergenic
980594993 4:134942719-134942741 ACTTGAGAAACAGAGCAATGGGG + Intergenic
980688036 4:136255759-136255781 ACCTGACAAAACAAACAATGGGG + Intergenic
980867414 4:138569636-138569658 ACCTGAAAAACCAAGAAATGGGG + Intergenic
981302280 4:143201256-143201278 AGCTGTCAAAACAAGCAATGGGG + Intronic
981399749 4:144300572-144300594 AATTGAGGAAAAAAGCAAAGAGG - Intergenic
982686064 4:158490358-158490380 ACCTACAAAAACAAGCAATGGGG - Intronic
982792614 4:159610681-159610703 ACCTGAAAAAACAAGAAATGGGG - Intergenic
982810522 4:159820266-159820288 ACCTGCCAAAACAAGCAATGGGG + Intergenic
983018857 4:162649323-162649345 AGCTGACAAAACAAACAATGGGG - Intergenic
983030734 4:162798616-162798638 ACCTACAAAAACAAGCAATGGGG - Intergenic
983441557 4:167793061-167793083 AGTTGACAAAACAAGCAATGGGG - Intergenic
983479044 4:168250849-168250871 ACATGAGAAAAAAAGAAAAATGG + Intronic
983677099 4:170308402-170308424 GACTGAGAAACAAGGCAATGTGG + Intergenic
983829859 4:172313126-172313148 ACCTAAAAAAAAAAGAAGTGTGG - Intronic
983958454 4:173724068-173724090 ACCTGACAAAACAAGCAACGGGG - Intergenic
984187082 4:176558077-176558099 AACAGAGAGAAAAAACAATGAGG + Intergenic
984226288 4:177039306-177039328 ACTTGGGAAGAAAAGGAATGAGG - Intergenic
984242101 4:177230336-177230358 ATGTGAGAAAAATAGCACTGTGG + Intergenic
984275510 4:177605369-177605391 ACCTGGGAAAAAAAGCCATCAGG - Intergenic
984447394 4:179854151-179854173 AACAGAAAAAAAATGCAATGAGG + Intergenic
985159750 4:187032245-187032267 ACCTGACAAAAACAGAAATGGGG - Intergenic
985233329 4:187845736-187845758 ACCTGACAAAAACAACAATGGGG + Intergenic
986172003 5:5322255-5322277 ACCTGAAAAAACAAGCAACGAGG - Intergenic
986192112 5:5507262-5507284 AAAGGAGAAAAAAAGCAAAGAGG + Intergenic
986487221 5:8249840-8249862 ACCAAGGAAAGAAAGCAATGAGG - Intergenic
987019741 5:13857738-13857760 ACCTGACAAAACAAGCAATAGGG + Intronic
987213483 5:15708707-15708729 AACTGAGAATAAAAGCACTTTGG - Intronic
987229202 5:15875139-15875161 ACCTGATAAAACAAGCAGTGGGG + Intronic
987260848 5:16201295-16201317 ATTTGACAAAACAAGCAATGGGG + Intergenic
987464753 5:18258648-18258670 ATCTGAGAAAAAAAGCAGTGGGG + Intergenic
987608573 5:20171987-20172009 AGCTTACAAAATAAGCAATGAGG - Intronic
987939734 5:24518175-24518197 ACTTGAGAGAAAAAGGTATGTGG - Intronic
987975832 5:25013903-25013925 ATCTGACAAAAACAGCAATGGGG + Intergenic
988063926 5:26210176-26210198 AGTTGACAAAATAAGCAATGGGG + Intergenic
988352671 5:30131629-30131651 ACCTGACAAAAAAAGCAATGGGG - Intergenic
988455425 5:31383117-31383139 ATCTGAGAAGAAAGGCAATTAGG + Intergenic
988675558 5:33429343-33429365 ACCTGAAAAAACAAGCAATGAGG - Intergenic
988696251 5:33625340-33625362 CAATGGGAAAAAAAGCAATGTGG + Intronic
988855066 5:35220265-35220287 ACCCGAGGTAAGAAGCAATGAGG - Intronic
989656968 5:43754979-43755001 ACTTGACAAAATCAGCAATGGGG - Intergenic
989779866 5:45250965-45250987 AATTGAGAAAAATAGAAATGAGG - Intergenic
989816532 5:45744336-45744358 ACCTGAGAAAAACAACAATGGGG - Intergenic
989848055 5:46171277-46171299 ACCTGACAAAACAAGAAATGGGG + Intergenic
989858988 5:46341629-46341651 ACCTGAGAAAACAAGCAATGGGG - Intergenic
990111917 5:52336883-52336905 ACCTGACCAAAAAAACAATGGGG - Intergenic
990138628 5:52677916-52677938 ACCTGACAAAAAAAGCAATGGGG - Intergenic
990175681 5:53105451-53105473 ACCTACAAAAACAAGCAATGGGG + Intronic
990298290 5:54425343-54425365 ACCTGGGAAGAAAAGCATGGTGG - Intergenic
990501428 5:56400099-56400121 TCCTGAGAAAAACAGCAGTAGGG + Intergenic
990775300 5:59299767-59299789 ACCTGAAATAAAACGCCATGGGG + Intronic
991063510 5:62402648-62402670 AACTGAGAAAAAAAGAAAGAAGG - Intronic
991261142 5:64669622-64669644 ACCTGAGCATAAAAAGAATGCGG - Intergenic
991293340 5:65055066-65055088 AGCTGAGAAAAAAATCAAGAAGG - Intergenic
991409125 5:66329562-66329584 GCCTGAAAAAGAAAACAATGGGG - Intergenic
991973692 5:72165180-72165202 ACATGTGAAAAAAAGCAAATTGG - Intronic
992232992 5:74681922-74681944 ATCTGAGAAAGACAGCAAAGAGG - Intronic
992611113 5:78509525-78509547 CCCCGAGGAAATAAGCAATGAGG + Intronic
992853870 5:80840281-80840303 ACCTGACAAAACAAGCAATGGGG + Intronic
992854077 5:80842170-80842192 ACCTGACAAAACAAGCAATGGGG - Intronic
992868226 5:80979609-80979631 ATCTTAGAAACAAAGGAATGTGG + Intronic
993023226 5:82617055-82617077 ACCTGACAAAACAAGAAATGGGG + Intergenic
993081080 5:83301840-83301862 ACCTGAAAAAACAAGCAATGGGG - Intronic
993092598 5:83444785-83444807 AGCTGAGAAAAAAAACTCTGTGG - Intergenic
993665295 5:90688271-90688293 ACCTGAGAAAAACAGCAATGGGG + Intronic
993865570 5:93190584-93190606 ACAAGAGAAAGAAAGCAAGGTGG + Intergenic
993953744 5:94206936-94206958 ACCAGAAAAGAACAGCAATGTGG - Intronic
994344252 5:98665584-98665606 ACCTGACAGAAACAGCAATGGGG + Intergenic
994479053 5:100310019-100310041 ACCTAACAAAACAATCAATGGGG + Intergenic
994672250 5:102776600-102776622 ACCTGACAAAAACAACAATGGGG - Intronic
994831546 5:104788900-104788922 AATTGAGAATAAAGGCAATGTGG - Intergenic
995163886 5:109014347-109014369 ACCTGACAAAAACAACAATGGGG - Intronic
995586142 5:113650673-113650695 ACCTGACAAAAAAAGAAATGGGG + Intergenic
995866166 5:116693520-116693542 ATCTGAGAAAAAAATGATTGTGG + Intergenic
996426201 5:123315789-123315811 ACCTGACAAAATAAGTCATGGGG - Intergenic
996648753 5:125847842-125847864 ACCTGACAATAAACTCAATGAGG + Intergenic
996902513 5:128558797-128558819 ACCTGAAAAAACAAGCAATAAGG + Intronic
996909920 5:128644342-128644364 ATAAGAGAAAAAAAGCAATGAGG - Intronic
997850131 5:137324958-137324980 TCCTGAAAAAAAAAAAAATGAGG + Intronic
998333106 5:141346533-141346555 ATTTGAGAAATAAAGCCATGAGG + Intronic
999607299 5:153330054-153330076 ACCTGAGAAAAACAACAACGGGG + Intergenic
999622147 5:153484589-153484611 AAGTGAGAGCAAAAGCAATGCGG + Intergenic
1000093826 5:157953380-157953402 TCTTGAGAAAAAAAGAAATAGGG + Intergenic
1000521934 5:162306029-162306051 ACCTGGCAAAAACAGCAATGGGG + Intergenic
1000753604 5:165129091-165129113 ATATGAGAAAAAAATCAATGTGG - Intergenic
1000994975 5:167949643-167949665 AGCTGAGAATGAAAGAAATGAGG + Intronic
1001600727 5:172926488-172926510 ACCTGTGGAAAAATGCAGTGAGG - Exonic
1001782678 5:174383691-174383713 AATTTAGAAAGAAAGCAATGAGG - Intergenic
1003488302 6:6598626-6598648 ACTTGAGAAAAAAAGCAGCAGGG - Intronic
1004079440 6:12376876-12376898 TCCTGAAACAAAAAGGAATGAGG + Intergenic
1004760542 6:18661252-18661274 ACCTACAAAAACAAGCAATGAGG + Intergenic
1005013588 6:21358043-21358065 ACCTGAGAAAACAAGATATCGGG - Intergenic
1005186781 6:23171486-23171508 AGGTGAGAAAAGAAACAATGAGG + Intergenic
1006333375 6:33407834-33407856 ACCAGAGAAAAAAATTACTGTGG - Intronic
1006666949 6:35701848-35701870 ACCTAAGAAAAAAAAAAATACGG - Intronic
1006712620 6:36088003-36088025 ACCTGACAAAACGAGCAATGGGG + Intronic
1006887788 6:37396896-37396918 AACAGAGAAAAAAGGCATTGTGG + Intergenic
1006955468 6:37866415-37866437 ATCTAAGAAAAAAAGAAGTGGGG - Intronic
1008175731 6:48266031-48266053 ACCTGAAAAAGCAAGCAATGGGG - Intergenic
1008462751 6:51794785-51794807 ACCTCAAAAAACAAGCAGTGGGG - Intronic
1008527560 6:52421157-52421179 AACGGAGAAAGAAAGGAATGGGG - Intronic
1008640513 6:53457807-53457829 ACAAGAGAAAAAGAGCAAAGTGG + Intergenic
1008984593 6:57527575-57527597 ACTTGAGAAACAAAGCAGTGTGG - Intronic
1009057398 6:58353432-58353454 ATCTGAGAAAAAAAATAATAAGG + Intergenic
1009172640 6:60420463-60420485 ACTTGAGAAACAAAGCAGTGTGG - Intergenic
1009986487 6:70787175-70787197 ACCTGACAAAAGGAGCAATGGGG + Intronic
1010315392 6:74442951-74442973 ACCTGACAGAAATAGCAATGGGG - Intergenic
1010321557 6:74515986-74516008 ATTTGACAAAACAAGCAATGGGG - Intergenic
1010395098 6:75382583-75382605 GCCTGAGAAAAAAAGAGATATGG - Intronic
1010556070 6:77281340-77281362 ACCTGACAAAACAAGCAATGGGG + Intergenic
1010672409 6:78701882-78701904 ACCTAAGAAAAAGAACAGTGGGG + Intergenic
1010881849 6:81185679-81185701 ATCTGAAAAAAACAGCAATAGGG - Intergenic
1011023050 6:82835694-82835716 AGCTGAGGAAAATAGCTATGGGG + Intergenic
1011174446 6:84544503-84544525 ACCTGACAAAAAAAGCAATGGGG + Intergenic
1011285213 6:85715549-85715571 TCCTGAGACCAAAAGGAATGAGG + Intergenic
1011530810 6:88319201-88319223 ACCTGAGAAAAACAACCAAGGGG + Intergenic
1011830834 6:91369468-91369490 ACCTGACAAAACAAGCAATGGGG - Intergenic
1012289008 6:97427827-97427849 AGCTGAGGAAACAAGCAGTGAGG + Intergenic
1012451597 6:99357726-99357748 ATCTGAGGAAAAAAGTGATGCGG - Intergenic
1012540795 6:100359438-100359460 ACCTGAGAGAAACAACAATGGGG + Intergenic
1012591859 6:100991739-100991761 ACCTGACAAAAACAGCAATGGGG - Intergenic
1012719980 6:102728712-102728734 ACCCGACAAAACAAGCAATGGGG - Intergenic
1012830990 6:104203212-104203234 ACCTGACAAAACAAACAATGGGG + Intergenic
1013335047 6:109149384-109149406 ACCTGAAAAAACAAGCAACGGGG - Intronic
1013390750 6:109684124-109684146 ACCTGACACAAAAAGCAATGGGG + Intronic
1013402091 6:109807872-109807894 ATCTGACAAAACAAGCAATGGGG - Intronic
1013941481 6:115668241-115668263 ACCTTAGAAAAAAAGAATTTTGG - Intergenic
1014020664 6:116585078-116585100 ACATGAGGGAAAAAGCCATGAGG - Intronic
1014399888 6:120975291-120975313 ATTTGAGAGAAAAAGAAATGAGG - Intergenic
1014406087 6:121052846-121052868 GACAGAGAAAAAAAGCAATGGGG - Intergenic
1014703404 6:124716722-124716744 AGGTGAGAAAGAAAGCTATGGGG - Intronic
1014872175 6:126610265-126610287 ACCTACAAAAACAAGCAATGGGG - Intergenic
1015000128 6:128204150-128204172 ACCTGAAAAAACAAGCAATGGGG + Intronic
1015946794 6:138511042-138511064 ATCTGAGAAAAAAATCAACCAGG + Intronic
1016226176 6:141741224-141741246 ATCTGACAAAAAAAGCAATGGGG + Intergenic
1016612834 6:146011818-146011840 AGCTGACAAAAGAAGCAATGGGG - Intergenic
1017211970 6:151866991-151867013 ACCTGACAAAACAAGCAATGGGG + Intronic
1018164663 6:161081912-161081934 ACAAGAGACAAAATGCAATGGGG - Intronic
1018328446 6:162700329-162700351 ATCTGAGAAGAAAAGAGATGAGG + Intronic
1019169606 6:170125404-170125426 ACCTGTGCAAATAAGAAATGAGG + Intergenic
1019224751 6:170500647-170500669 ACCTGTGCAGAAAAGCATTGGGG - Intergenic
1019619293 7:1981778-1981800 GCCTGGGAAAAAAGGCACTGGGG + Intronic
1019790584 7:3010100-3010122 TCCAGAGAAAAAAGGCATTGGGG + Intronic
1019825040 7:3277265-3277287 AATAAAGAAAAAAAGCAATGTGG - Intergenic
1020288131 7:6701674-6701696 CCCTGAGAAAAGAAGCAAATAGG + Intronic
1020614940 7:10447481-10447503 ACCTGACAAAACAAGCAGTGGGG + Intergenic
1020690503 7:11348978-11349000 ACCTGACAAAAACAGCAATAGGG - Intergenic
1020694418 7:11395849-11395871 ATTTTAGAAAAAATGCAATGTGG - Intronic
1020757851 7:12226137-12226159 ACCTGACAAAAACAAGAATGGGG - Intronic
1020800474 7:12726624-12726646 ACTTGAGGATAAAAGCAGTGAGG - Intergenic
1021252607 7:18349700-18349722 TCCTGACAAAAAAAAAAATGTGG + Intronic
1021870125 7:24997531-24997553 ACCTGACAAAACAAGCAATGGGG - Intergenic
1021943444 7:25702516-25702538 ACCTGACAAAAACAGAAATGGGG + Intergenic
1022404604 7:30076587-30076609 ACCTGAGACACAAAGTGATGAGG + Intronic
1022676128 7:32500871-32500893 ACCTGACAAAATAAGCAATGGGG - Intronic
1022871917 7:34488854-34488876 ATCTGAGATATAAAGCAGTGGGG + Intergenic
1022885334 7:34637729-34637751 ACCTGACAAAACAAGCAATGAGG + Intergenic
1022999518 7:35793608-35793630 AACAGAAAAAAAAAGCTATGAGG + Intergenic
1023232217 7:38045940-38045962 AGCTGAGAAAGAAATCAATAAGG - Intergenic
1023421341 7:39983284-39983306 TACTGAAAAAACAAGCAATGGGG - Intronic
1023697262 7:42860401-42860423 ACCTGACAAAAACAGCAATGGGG - Intergenic
1024388996 7:48785923-48785945 ACTTGTGAAAACAATCAATGAGG - Intergenic
1024528878 7:50373992-50374014 TCCTGAGAAATCCAGCAATGGGG - Intronic
1024664425 7:51531816-51531838 ACCTGACAAAAACAACAATGGGG - Intergenic
1025784186 7:64629185-64629207 ACCTAAAAAAACAAGCAATGGGG + Intergenic
1026615165 7:71895805-71895827 AGCTGAGAATGAAAGTAATGTGG + Intronic
1027949473 7:84796016-84796038 AATTGACAAAACAAGCAATGGGG - Intergenic
1028016715 7:85724134-85724156 ACCTGAGATAAAATGAAATCTGG - Intergenic
1028080732 7:86572054-86572076 ACCTGAAAAAATAAGCAATAGGG + Intergenic
1028319649 7:89443081-89443103 ACCTGACAAAAACAAGAATGGGG + Intergenic
1028400197 7:90417261-90417283 AAATGAGAAAAACATCAATGGGG + Intronic
1028689406 7:93634852-93634874 ACCTGAGAAAAGAAGTGTTGGGG - Intronic
1028767200 7:94572994-94573016 AGCTGACAAAACATGCAATGGGG - Intergenic
1029001077 7:97154923-97154945 ACCTTAGTAAAAAATCAATTAGG + Intronic
1029554726 7:101260771-101260793 ACCTCAAAAACAAAACAATGTGG - Intergenic
1030390820 7:108926295-108926317 ATCTGACAAAACAAGCAATGGGG - Intergenic
1030528446 7:110681581-110681603 CCCTGAAAAATAAAGAAATGTGG + Intronic
1031179132 7:118392850-118392872 ACCTGACAAAACAAGCAATGGGG + Intergenic
1031270684 7:119645351-119645373 ACGTGACAAAATAAGAAATGGGG - Intergenic
1031386259 7:121155082-121155104 ACCTGAAAAAGAAATCAAGGAGG + Intronic
1031388105 7:121177988-121178010 AACAGAAAGAAAAAGCAATGGGG + Intronic
1031523582 7:122796590-122796612 ACCTGACAAAACAAGCTAGGAGG + Intronic
1031805917 7:126305763-126305785 GCCTTAGAAAAGAAGAAATGTGG - Intergenic
1031817335 7:126454010-126454032 AACTGGGAATAACAGCAATGGGG + Intronic
1032062147 7:128733862-128733884 AACTGAGAAAAAGGTCAATGAGG - Intergenic
1032835056 7:135664729-135664751 ATTTAAAAAAAAAAGCAATGAGG - Intronic
1033565351 7:142573248-142573270 ACCTGACAAAACAAGCAATGGGG + Intergenic
1033853834 7:145532718-145532740 TCCTGGGGAAAAAAACAATGGGG + Intergenic
1033873068 7:145781181-145781203 ACCTGAGAAAATAAGCAACGGGG - Intergenic
1033957408 7:146868282-146868304 AGATGACAAAACAAGCAATGAGG - Intronic
1034649350 7:152677180-152677202 ATCTGAGGTAAAAAGAAATGAGG - Intergenic
1035113130 7:156501136-156501158 ACCTGACAAAATAAGCAATGGGG - Intergenic
1035558368 8:585041-585063 ACCTGAAAAAACAAGCAATGGGG - Intergenic
1036109593 8:5883235-5883257 ACCTGACAAAACAAGCACTGGGG - Intergenic
1036113957 8:5937501-5937523 ACCTGACAAAACAAGCAATGGGG + Intergenic
1036529344 8:9568239-9568261 CCCTGAGAAACAAACCAAGGGGG - Intronic
1037166374 8:15834104-15834126 ACGTGAAAAAGAAAGTAATGAGG - Intergenic
1037684803 8:21129687-21129709 AGCAGAGAAGCAAAGCAATGAGG + Intergenic
1038310192 8:26440638-26440660 ACCTGAGACAAACATGAATGTGG + Intronic
1038854001 8:31311202-31311224 ACTGTAGGAAAAAAGCAATGAGG + Intergenic
1038855494 8:31327382-31327404 ACCTGAGAAAAACAGCAATGGGG + Intergenic
1038897362 8:31800184-31800206 TCATAACAAAAAAAGCAATGAGG + Intronic
1039134300 8:34302443-34302465 ACAAAAAAAAAAAAGCAATGGGG + Intergenic
1039243468 8:35582227-35582249 ATCTGAGAAAGAAATCACTGTGG - Intronic
1039331143 8:36538323-36538345 ACATAAGAAAAACATCAATGTGG + Intergenic
1039459642 8:37732938-37732960 AACTGAAAAAAAAAGAAAAGAGG + Intergenic
1039942718 8:42104994-42105016 AGCAGAGAAAAAAAGCAAAAAGG - Intergenic
1040608115 8:48955166-48955188 ACCTGACAAAACAAGAAATGGGG - Intergenic
1040753324 8:50738789-50738811 ACAAAAAAAAAAAAGCAATGGGG + Intronic
1040860343 8:51992438-51992460 ACCTGAAAAAACGAACAATGGGG + Intergenic
1040907256 8:52481155-52481177 ACCCCAGAAAAAAGGCATTGGGG - Intergenic
1041396572 8:57397662-57397684 ACCTTAACAAAAAAGCACTGTGG - Intergenic
1041412214 8:57569181-57569203 ACCTGACAAAAAAAGAAATCGGG + Intergenic
1041837999 8:62238779-62238801 ACCTGACAAAACAAGCAACGGGG - Intergenic
1041947905 8:63467336-63467358 ACTTGAGAAAAGAAAAAATGTGG + Intergenic
1042386938 8:68187636-68187658 ACTTGGTAGAAAAAGCAATGTGG - Intronic
1042621121 8:70705559-70705581 AGTTGAGAAAAACAGCAAGGAGG + Intronic
1042888009 8:73573628-73573650 ACCTGCCAAAAACAGAAATGGGG + Intronic
1043038123 8:75224496-75224518 ACCTGAAGAAATAAGCAGTGGGG + Intergenic
1043139947 8:76575607-76575629 ACTTAAGCCAAAAAGCAATGTGG + Intergenic
1043272809 8:78355375-78355397 ACCTGAGAAAACAAGCAATGGGG + Intergenic
1043452832 8:80385250-80385272 ACCTGAGAAAACAAGCAATGGGG - Intergenic
1043564777 8:81535681-81535703 ACTTGAGAAAATATGCAATGAGG - Intergenic
1043730810 8:83678070-83678092 ATATGACAAAACAAGCAATGGGG + Intergenic
1043867202 8:85388939-85388961 ACTGGAAAAAAAAAGCTATGAGG + Intronic
1044106258 8:88210780-88210802 CCCAGAGATAAAAATCAATGTGG + Intronic
1044272271 8:90260210-90260232 AAATGACAAAACAAGCAATGGGG + Intergenic
1044349965 8:91152393-91152415 ACCTGACAAAACAAGCAATGGGG - Intronic
1044384558 8:91572152-91572174 ACCTGACAAAAACAACAATAGGG + Intergenic
1044596599 8:93965091-93965113 ACCTGACAAAAACAAAAATGGGG - Intergenic
1044825428 8:96191775-96191797 ACCTGACAAAATAAGCAATGGGG - Intergenic
1045055878 8:98368067-98368089 AACAGAGAAAAACAGCAGTGGGG + Intergenic
1045389186 8:101698657-101698679 ACCTCACAAAACAAGTAATGGGG + Intronic
1045402760 8:101835223-101835245 ACCTGAGATAGAAAGCCAAGTGG - Intronic
1045610033 8:103828831-103828853 AGTTGACAAAGAAAGCAATGGGG - Intronic
1045669206 8:104528472-104528494 GCCACAGAAAAAATGCAATGAGG + Intronic
1046285370 8:112086678-112086700 ACCTGACAAAAAAAGCAATGCGG + Intergenic
1047001757 8:120580164-120580186 TCCTGAGGCAAAAAGCAATACGG + Intronic
1047987219 8:130247633-130247655 AGTTGAGATAAAAAGCAAAGTGG + Intronic
1048229122 8:132619973-132619995 CGTTGAGAAAAAAAGCAATCAGG - Intronic
1048786214 8:138053198-138053220 ACCGGAAAAAACAAGCAATGGGG - Intergenic
1048790881 8:138102191-138102213 TCCTGAGAAAGAAAGCTATGTGG - Intergenic
1048811205 8:138288342-138288364 ACCTGAGAAAAAGAGAAAAGAGG + Intronic
1050761950 9:9083277-9083299 ACTTGAGAAAAACAAGAATGGGG + Intronic
1051190746 9:14509467-14509489 ACCAGAGAAAAAAAGGAAATGGG - Intergenic
1051274211 9:15383471-15383493 ACTTGAGGAAATAAGCAAGGAGG + Intergenic
1051537094 9:18171944-18171966 ACGTGAAAAAACAAGAAATGGGG - Intergenic
1051962171 9:22780068-22780090 TGCTGACAAAACAAGCAATGGGG - Intergenic
1052287337 9:26801254-26801276 TCTTGAGAAAGAAAGCAATGAGG + Intergenic
1052299834 9:26941592-26941614 AGATGAGAAAAAAACCAATATGG + Intronic
1052449624 9:28612101-28612123 GCCTGTGAAAAAGTGCAATGGGG + Intronic
1052749308 9:32473191-32473213 ACCTGAGAAAAAAAGCATTTTGG + Intronic
1052885474 9:33643562-33643584 ATGTGACAAGAAAAGCAATGGGG + Intergenic
1053723177 9:40970150-40970172 GTCTGAGAATAAAATCAATGGGG + Intergenic
1054342788 9:63881842-63881864 GTCTGAGAATAAAATCAATGGGG - Intergenic
1055261462 9:74439973-74439995 AATTAAGAAAAAAAGCAATAAGG + Intergenic
1055341473 9:75288665-75288687 ACCGGAGACAAAAACCACTGGGG + Intergenic
1055540438 9:77299024-77299046 ACCTGAAAAAACAAGCAATGGGG - Intronic
1055677513 9:78679912-78679934 ACCCAAGAACAAAAGCAATAGGG + Intergenic
1055810653 9:80143992-80144014 ACCTTAAAAAAAAAGAAAAGAGG + Intergenic
1056087601 9:83167233-83167255 ACCTCAGAAAAAAAAAAATCTGG + Intergenic
1056158356 9:83862440-83862462 ACCTGACAAAACAAGAAATGGGG - Intronic
1057336536 9:94160047-94160069 ACCAGAGAAACAAAGCCAAGAGG + Intergenic
1058327089 9:103711963-103711985 AGATGACAAAAAGAGCAATGGGG - Intergenic
1058549289 9:106096611-106096633 ACCTGACAAAACAAGCAATGGGG + Intergenic
1058872836 9:109217303-109217325 ACTTAAGAAAAAGAGCAAAGTGG + Intronic
1058925317 9:109657426-109657448 TTCTGAGAACAAAAGCAATATGG + Intronic
1058926661 9:109671368-109671390 ACCTGACAAAACAAGCAATAAGG - Intronic
1059049993 9:110914019-110914041 ACCAAAGGAAAAAAGCAATGAGG - Intronic
1059078689 9:111223648-111223670 ACCTGACAAAACAAGCAATGGGG - Intergenic
1059262274 9:112989387-112989409 ACCTGAAAAAACAAGCAATTGGG - Intergenic
1059745763 9:117199387-117199409 AACTGACAAAAAAAGGAATGGGG - Intronic
1060474780 9:123978531-123978553 ACCTAACAAAGAAAGAAATGAGG - Intergenic
1060476582 9:123991592-123991614 ACCTAACAAAGAAAGAAATGAGG + Intergenic
1061585356 9:131563838-131563860 AACTGTGAAAATAAGCAATGAGG - Intergenic
1062188601 9:135232571-135232593 ACTTGACAAAGAAAGGAATGTGG + Intergenic
1203524553 Un_GL000213v1:73779-73801 ACCTGAAAAATAAAGTAATAAGG + Intergenic
1203451960 Un_GL000219v1:125828-125850 GTCTGAGAATAAAATCAATGGGG - Intergenic
1203398162 Un_KI270519v1:47259-47281 ACCTGAGAAAAACAAGAATGGGG + Intergenic
1185812433 X:3123157-3123179 ACCTGAAAAAACAAGCAATGGGG - Intergenic
1188308595 X:28588766-28588788 ACTTGAGAAAGAAAGCACTGTGG - Intronic
1188645088 X:32555704-32555726 ACCTGAAAAAACAAGCAATGGGG + Intronic
1188796787 X:34476801-34476823 AGCAGACAAAACAAGCAATGAGG - Intergenic
1188930959 X:36110377-36110399 AATTGACAAAAAAAGCAATGGGG - Intronic
1189120577 X:38390070-38390092 ACCTTAGAGAAAAATGAATGGGG - Intronic
1189141201 X:38608051-38608073 ACTGGAGAAATAAAGCAAAGGGG + Intronic
1189274225 X:39773069-39773091 AAAGGAGAAACAAAGCAATGAGG - Intergenic
1189697841 X:43684052-43684074 AACAGACAAAAAAAGAAATGTGG + Intronic
1189911049 X:45810810-45810832 ACGGGAGAAAAAAAGAAAAGAGG + Intergenic
1190478586 X:50852049-50852071 GCCTCAAAAAAAATGCAATGAGG - Intergenic
1191073298 X:56425322-56425344 ACCTGACAAAAAAAGAAGTGGGG - Intergenic
1191099191 X:56706689-56706711 ACCTGACAAAACAAGCAATAGGG - Intergenic
1191212145 X:57896815-57896837 AGCTGAGAAAAAAAACAATAAGG + Intergenic
1191573151 X:62658776-62658798 ACCTGAGAAAACAAGCAATGGGG - Intergenic
1191701729 X:64049142-64049164 ACCTGACAAAACAAGCAATGGGG + Intergenic
1191831939 X:65424731-65424753 ACCTGACAAAAAAAGCAATGGGG - Intronic
1192023146 X:67417452-67417474 AACTGAGAATAAAATCAATAGGG + Intergenic
1192316665 X:70057455-70057477 ACCAGAGAAAAAAACAACTGTGG + Intergenic
1192427364 X:71089143-71089165 ACCTGAGGAATGAAGCATTGTGG + Intergenic
1192597116 X:72422640-72422662 GCCTGAGAAGAAAAGCCATAGGG - Intronic
1192714112 X:73620964-73620986 ACCTGAAAAAATAAGCAATGGGG - Intronic
1192951353 X:76020577-76020599 ACCTGAAAAAACAAGAAATGGGG + Intergenic
1192957666 X:76090507-76090529 ACCTGACAAAACAAGCAATGGGG - Intergenic
1192964628 X:76164186-76164208 ATCTGACAAAACAAGCAACGGGG + Intergenic
1193035102 X:76941371-76941393 ACTATACAAAAAAAGCAATGGGG + Intergenic
1193160815 X:78227196-78227218 ACCTGCACAAACAAGCAATGGGG - Intergenic
1193163029 X:78249870-78249892 ACCTGCGAAAAAAATCAAGGAGG - Intergenic
1193199370 X:78670024-78670046 GCCTGACAAAACAAGCAATGGGG + Intergenic
1193277798 X:79610082-79610104 AGTTGAGCAAAAAAGCAATGGGG + Intergenic
1193318809 X:80096350-80096372 CCCTGACAAAAAAAGCAATGGGG + Intergenic
1193367775 X:80655443-80655465 ACCTGACAAAACAAGCAATGGGG + Intergenic
1193598634 X:83480554-83480576 ACTGTAGAAAAAAAGAAATGAGG + Intergenic
1193634164 X:83927626-83927648 ACCTGACAAAAAAAGCAATGGGG - Intergenic
1193812491 X:86068134-86068156 ACATGATAAAACAAGCAATGGGG + Intergenic
1194027872 X:88776448-88776470 ACCTGACAAAATAAGCAATGGGG - Intergenic
1194287228 X:92024894-92024916 ACCTGACAAAAATAGGAATTGGG + Intronic
1194376879 X:93147182-93147204 ACTTGAGAAAGGAAACAATGAGG + Intergenic
1194460804 X:94165559-94165581 TGCTGAGAAAAAAAGCAAGCAGG - Intergenic
1194551064 X:95300122-95300144 ACCTGACAAAACAAGCAATGGGG + Intergenic
1194918218 X:99730674-99730696 ACCTGACAAAAACAACAATGGGG + Intergenic
1194947934 X:100091264-100091286 ACCTGTGTATAAAAGCAATCTGG - Intergenic
1195098458 X:101529209-101529231 ACCTGACAAAACAAGCAATGGGG + Intronic
1195140553 X:101955053-101955075 ACCTGACGAAAACAGCAATGGGG + Intergenic
1195222054 X:102754358-102754380 ACGTGGGAAAGACAGCAATGAGG - Intergenic
1195789999 X:108573792-108573814 ACCTGAAAATAAAAGCAATCTGG + Intronic
1196288161 X:113906655-113906677 ATGTGAGAAAAATAGCAATTTGG + Intergenic
1196367320 X:114938227-114938249 ACCTGACAAAACAAGCAATGGGG - Intergenic
1196584477 X:117413893-117413915 AACTAACAAAAAAAGCAATGGGG + Intergenic
1196854020 X:119966075-119966097 ACCTGACAAAAAAAGAAACAGGG + Intergenic
1196855415 X:119978308-119978330 ACCTGACAAAAAAAGAAACGGGG - Intergenic
1197096406 X:122601532-122601554 ACTTCAGAAAAAAATCAAAGTGG + Intergenic
1197388690 X:125832959-125832981 AACGGACAAAAAATGCAATGGGG + Intergenic
1197532977 X:127653503-127653525 ATCTGACAAAAAAAGCAATGGGG + Intergenic
1197680583 X:129379951-129379973 AGTTGACAAAATAAGCAATGGGG + Intergenic
1198923941 X:141765551-141765573 AACTGAGAAACAAAGAAATGGGG + Intergenic
1199136513 X:144259994-144260016 AGCTGAGAAAGAAATCAAGGAGG + Intergenic
1199254613 X:145704935-145704957 ACCTGACAAAACAAGAAATGGGG + Intergenic
1199301130 X:146215345-146215367 CCCTGAGAAAAAGAGTGATGAGG + Intergenic
1199387917 X:147244832-147244854 ACCTGACAAAAACAGCAATGGGG + Intergenic
1199469398 X:148177406-148177428 ACCTGAAAAAACAAGAAATGGGG - Intergenic
1199519602 X:148720574-148720596 ACATGAGATAAAAAGCACTGAGG - Intronic
1199565315 X:149209486-149209508 ACCTGAAAAAGGAAGCCATGAGG + Intergenic
1199994758 X:153015354-153015376 AGTTGAGAAAAACAGCAATGAGG + Intergenic
1200390289 X:155938189-155938211 AGGAGACAAAAAAAGCAATGGGG - Intronic
1200604766 Y:5249462-5249484 ACCTGACAAAAATAGGAATTGGG + Intronic
1200885865 Y:8268960-8268982 ACCTGACAAAACAAGCAATGGGG + Intergenic
1201476074 Y:14382030-14382052 AACTGAGAAAGAAATGAATGGGG + Intergenic
1201563093 Y:15338483-15338505 ACCTGATGAAAACAACAATGGGG - Intergenic
1201594824 Y:15656699-15656721 ACCTGAGAAACCTAGCAAAGTGG + Intergenic
1201596328 Y:15673653-15673675 ACCTGAGAAAAACAGAAATGGGG - Intergenic
1201625531 Y:16010903-16010925 TCCTAAGAAAAAAAGAAAAGTGG + Intergenic
1201664900 Y:16439844-16439866 ACCAGAGAAAATTAGCAGTGAGG - Intergenic
1201741084 Y:17325383-17325405 AACTAAGAAAGAAAGAAATGAGG + Intergenic
1201781420 Y:17726902-17726924 TGCTGAGAAGAAAAGCATTGAGG + Intergenic
1201820133 Y:18179088-18179110 TGCTGAGAAGAAAAGCATTGAGG - Intergenic
1201946740 Y:19518750-19518772 ATCTTACAAAAAAAGCAATGGGG + Intergenic
1202065389 Y:20934232-20934254 ACTTGACAAAAACATCAATGGGG + Intergenic
1202079338 Y:21068476-21068498 ACCTGAGAAAAACAGCAATGGGG + Intergenic
1202084783 Y:21124790-21124812 ACCTGACAAAATAAGAAATGGGG - Intergenic
1202190598 Y:22239783-22239805 ACCTTACAAGCAAAGCAATGTGG - Intergenic