ID: 1153549548

View in Genome Browser
Species Human (GRCh38)
Location 18:6247309-6247331
Sequence CCTGCTTTGCAGGCGGTGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 114}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153549548_1153549554 -6 Left 1153549548 18:6247309-6247331 CCATACACCGCCTGCAAAGCAGG 0: 1
1: 0
2: 0
3: 4
4: 114
Right 1153549554 18:6247326-6247348 AGCAGGAGCCAGTCTAGGGTCGG 0: 1
1: 0
2: 1
3: 29
4: 237
1153549548_1153549553 -10 Left 1153549548 18:6247309-6247331 CCATACACCGCCTGCAAAGCAGG 0: 1
1: 0
2: 0
3: 4
4: 114
Right 1153549553 18:6247322-6247344 GCAAAGCAGGAGCCAGTCTAGGG 0: 1
1: 1
2: 0
3: 18
4: 286

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153549548 Original CRISPR CCTGCTTTGCAGGCGGTGTA TGG (reversed) Intronic
900290067 1:1920031-1920053 CCTGCGCTGCAGGCGCTGTCTGG + Intergenic
901861470 1:12077419-12077441 CCGGCTTTGCAGATGGAGTAAGG + Intronic
903488299 1:23707884-23707906 GCCGCTGTGCAGGCTGTGTAGGG + Intergenic
905947544 1:41916763-41916785 CCTGCTGAGCAGCCAGTGTAGGG - Intronic
906689745 1:47784775-47784797 CCTGCTTTGCAGGCCGCCCAGGG + Intronic
907052956 1:51342141-51342163 CCTGATTTGTAGGCTGAGTAGGG + Intronic
913215741 1:116618853-116618875 CCTTCTTTGCAGGAGATGTATGG - Intronic
916552832 1:165865396-165865418 CATGCTTTGCAGGGGGTGGAGGG - Intronic
919930501 1:202218252-202218274 CCTGCTATTCAGGGGGTGTTTGG + Intronic
1063448621 10:6136257-6136279 CCTGCTCAGCAGGAGGTGGAGGG - Intergenic
1063961517 10:11309924-11309946 CCTGCTCTGGAGGTGGTGCAGGG + Intronic
1070172114 10:73940780-73940802 CCTGCTGGGCTGGCGGTGAAAGG + Intergenic
1071717375 10:88110909-88110931 CCTGCTTTGCTGGCAGTACATGG - Intergenic
1075438023 10:122459704-122459726 ACTGCTTTGCGGGAGGTGGAGGG - Intergenic
1079302696 11:19293067-19293089 CCTGCTTTTCATTTGGTGTATGG + Intergenic
1082271044 11:50169823-50169845 GCTGCAGTGCAGGCGGGGTAGGG + Intergenic
1083328305 11:61884969-61884991 CCTGCTTTGGGGGCTGTGGAGGG - Intronic
1089354680 11:117841922-117841944 CCTGCCTGGCAGGAGGGGTAGGG - Intronic
1090892616 11:130939084-130939106 CCTGCTTTGCTGCCAGGGTATGG - Intergenic
1097996545 12:65893649-65893671 CCTGCATTTCAGGGGGTGAATGG + Intronic
1103941961 12:124506085-124506107 CCTGCTTTGCCTGGGGTGAAGGG - Intronic
1104293118 12:127486936-127486958 ACTTTTTTGCAGGCGTTGTACGG - Intergenic
1105219468 13:18312329-18312351 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1106407178 13:29484299-29484321 CCTGCTCTGCAGGAGGGCTAAGG - Intronic
1112428985 13:99332891-99332913 CCTGCTTTTCAGAGGGTCTATGG + Intronic
1112809102 13:103197024-103197046 CCTGCTTTGCAGGTGGGAGATGG + Intergenic
1113447829 13:110384010-110384032 ACTGCTGTGCAGGCGGTAAATGG + Intronic
1116082901 14:40199124-40199146 CCTGCATTGCTGGAGGTCTAGGG - Intergenic
1121284962 14:92727874-92727896 CATGGTTTGCAAGGGGTGTAGGG - Intronic
1122554671 14:102571308-102571330 CCTGCTTTGCAGGCTGGGCTGGG + Intergenic
1124035741 15:26052355-26052377 CTTCCTTTGCAGGCAGTGGAAGG + Intergenic
1124259410 15:28175317-28175339 CCTGCTTTGCAGCAGGGGTTGGG - Intronic
1124940535 15:34213516-34213538 CTTCCTTTGCAGGCTGTGGAAGG + Intergenic
1127592447 15:60439078-60439100 CTTGCTTTGCATGCAGTGTGAGG + Intronic
1132354190 15:101159252-101159274 CATGCTTTGTGGGGGGTGTAGGG - Intergenic
1134346032 16:13392825-13392847 CGTGCTTTGCAGGCAGTCTTTGG - Intergenic
1135054320 16:19218430-19218452 CCTGTTGTGCATGCTGTGTATGG + Intronic
1136506795 16:30709639-30709661 CCTGCTTTGCTGGAGGTTAATGG - Exonic
1142589913 17:998858-998880 CTTCTTTTGCAGTCGGTGTACGG - Exonic
1143733726 17:8895978-8896000 CCTGCTTAGCATGGGGTGTGGGG + Intronic
1146403891 17:32520901-32520923 TCTTCTTTGCAGGCGGTATTGGG + Intronic
1153549548 18:6247309-6247331 CCTGCTTTGCAGGCGGTGTATGG - Intronic
1155504946 18:26524180-26524202 CCTGCTTTCCAGCAGGGGTAGGG + Intronic
1157417729 18:47520178-47520200 CCTGCTTTGTAGGCACTGTCTGG + Intergenic
1157491237 18:48125294-48125316 CCTGCTGTGGAAGCCGTGTAAGG + Intronic
1159349809 18:67258089-67258111 CCTGTTTTGCAGGCTGGGGAGGG + Intergenic
1160060800 18:75527203-75527225 CCTCCTTTTCAGGGGGTGCAGGG - Intergenic
1160880290 19:1316556-1316578 CCTGCCTTGCAGGGGCAGTAGGG - Intergenic
1161455364 19:4367156-4367178 CCTGCTCTGCAGGCAGCGTGTGG - Intronic
1161601823 19:5188852-5188874 CATGATTTGCAGGCAATGTAGGG + Intronic
1167868970 19:52351658-52351680 CCTGCTCTGCAGCCTGTGTGAGG + Intronic
1168469455 19:56628842-56628864 CCTGGCTTGCAGCCTGTGTAGGG + Intergenic
934184580 2:89660188-89660210 CCTTCTTTGCAGGAGATGGATGG + Intergenic
934294862 2:91734326-91734348 CCTTCTTTGCAGGAGATGGATGG + Intergenic
940429140 2:153567479-153567501 CCTGCTTTGCAGGCACAGCATGG + Intergenic
940443264 2:153744964-153744986 CCTGGTTTGCAGGCAGAGCATGG + Intergenic
943890017 2:193275227-193275249 ACTGCTTTGCAGGTAGTGAAGGG + Intergenic
1171108972 20:22463145-22463167 CCTGCTTTTCAGCCGGCATAGGG + Intergenic
1172335916 20:34115253-34115275 CCTGTTTTGCTGGCTGTATATGG - Intergenic
1177080630 21:16634611-16634633 CCTGTTTTGGAGGTGGTGTTTGG + Intergenic
1179014822 21:37587485-37587507 CCTGCCTTGCAGGTTGGGTATGG + Intergenic
1179895171 21:44357787-44357809 CCTGCTTTCAAGGTGGTGTCTGG - Intronic
1180817070 22:18797189-18797211 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1181060327 22:20279228-20279250 CCATCTTTGCAGCCGGTGAAGGG + Intronic
1181203259 22:21231534-21231556 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1181447590 22:22989967-22989989 CCTGCTTTGCAAGAGCAGTATGG - Intergenic
1181515075 22:23405545-23405567 CCTGATGTGCAGGCGGTGGCTGG - Intergenic
1182108244 22:27704517-27704539 CCTGTTTTACAGGCGCTGTGAGG - Intergenic
1183831646 22:40421243-40421265 TCTGCTTTTCACGGGGTGTACGG - Intronic
1184897853 22:47422500-47422522 CCAGTTTTGCAGGCTGCGTATGG + Intergenic
1185275265 22:49947924-49947946 CCTGCTTCACAGGCTGTGTGGGG - Intergenic
1185343832 22:50302890-50302912 CCTGCTTTGGAGGAGATGGAGGG - Intronic
1203223660 22_KI270731v1_random:63890-63912 CCTTCTTTGCAGGAGATGGATGG + Intergenic
1203267169 22_KI270734v1_random:22910-22932 CCTTCTTTGCAGGAGATGGATGG - Intergenic
952546445 3:34424908-34424930 CCTGCTTTGCAGTGGCTGAATGG + Intergenic
953575651 3:44111255-44111277 CCTGCAAAGCAGGGGGTGTAAGG - Intergenic
954363292 3:50133684-50133706 CCTGCTTTGCTGGTGGGGTGGGG - Intergenic
957550529 3:81697786-81697808 CCTGCTTTGGAGCAGGTGGAAGG + Intronic
961648572 3:128405896-128405918 CCTCCTTGGCAGGCAGGGTATGG + Intronic
961787634 3:129357231-129357253 CCTGCTTTGCTGGGGGAGAAAGG + Intergenic
968454016 4:688272-688294 CCTCCTTTGCTGGCTGGGTATGG - Intronic
969175281 4:5394090-5394112 CCTGCTTTGCAGTCTGTGCATGG + Intronic
971851921 4:31995164-31995186 CATGCTTTGAAGGGGGTGGAGGG + Intergenic
979524266 4:121701264-121701286 CCTGGTATGCAGGCAGAGTAGGG - Intergenic
985730707 5:1546719-1546741 CCTGCTTTGCAGAGGATGGAAGG - Intergenic
986481163 5:8189620-8189642 TCTGCTTTCCAGGCTATGTAGGG - Intergenic
987359188 5:17091582-17091604 CCTGCTTTACAGTCGGTCCAGGG - Intronic
988599697 5:32628202-32628224 CCTGCTTGGTCGGCTGTGTAAGG + Intergenic
989683581 5:44058741-44058763 CCTGCTTTGCATGTGTTGTGTGG + Intergenic
991996912 5:72396998-72397020 CATGCTTTGAAGGCTGAGTATGG - Intergenic
997413637 5:133708564-133708586 CCTGCCTCACAGGCTGTGTATGG + Intergenic
997447854 5:133954665-133954687 ACTGTTTTGCAGGCTGTGGAGGG - Intergenic
999677138 5:154015379-154015401 CCTGTTTTGCTGGAGGTGTCGGG - Intronic
1002369234 5:178737607-178737629 CTTGCTGTGCAGGAGGTTTAAGG - Intergenic
1007822422 6:44570488-44570510 CCTGCAATGCAGGCTGTCTATGG - Intergenic
1016802783 6:148183441-148183463 CTTGCTTTGCAGTCAGTGTGAGG - Intergenic
1019309005 7:349893-349915 CCTCCTCTGCAGGCCGTGTTTGG + Intergenic
1020737594 7:11970585-11970607 CCTGCTTTTCATCCTGTGTATGG - Intergenic
1020788270 7:12594746-12594768 CCTGTCTTGCAGGCCTTGTATGG + Intronic
1022098089 7:27153077-27153099 CCTGGTCTGCAGGCGGGGTGGGG + Intergenic
1022826614 7:34020803-34020825 CCTGCTTTGCAGGCAGCATGGGG + Intronic
1023227754 7:37989281-37989303 CATGCTTTGCTGCCAGTGTAAGG + Intronic
1023640430 7:42251449-42251471 CCTGCTGTGCAGCTGGAGTAGGG + Intergenic
1027998962 7:85466774-85466796 CCAGCTGTGCAGGAGGTGCAAGG + Intergenic
1030902349 7:115140202-115140224 CCAGCTTTGGAGGGGGTGCAGGG + Intergenic
1032064471 7:128755575-128755597 CCTGCTTTGCAAGTGCTTTAAGG + Intronic
1035672955 8:1434093-1434115 GCTGCTTTGCAGGTGGAGCATGG + Intergenic
1036692977 8:10956404-10956426 CCTGCTTTGTATGGGGTGTTGGG - Intronic
1037287274 8:17314798-17314820 CCTGATATGCAGTCGGTGAAGGG + Intronic
1042118442 8:65458037-65458059 CCTGCTTTGCAGGCCTTGTCTGG - Intergenic
1045960704 8:107964690-107964712 TCTGCTTTGCAGGGGGTGGGGGG + Intronic
1049818668 8:144621000-144621022 CCTGCTTTGCAGGAGGCACATGG + Intergenic
1057182213 9:93036340-93036362 ACTGCTTTCCAGGTGGTGTGTGG - Intergenic
1059471213 9:114505684-114505706 CCGGCTCTGCCGGCGGGGTAGGG - Intergenic
1061937513 9:133866362-133866384 CCTGCTCTGCAGAAGGCGTAGGG - Intronic
1189268047 X:39731338-39731360 CCTGCTCTGCGGGCGGTGACAGG + Intergenic
1194486504 X:94492881-94492903 CCAGCTTTGCAGGCGGCCCACGG + Intergenic
1195011498 X:100736266-100736288 CCTTCTTTGCAGGTGGTGCTTGG + Intergenic
1198616492 X:138463600-138463622 CCTGCTTTGCTGGAGGTGGTAGG - Intergenic