ID: 1153549553

View in Genome Browser
Species Human (GRCh38)
Location 18:6247322-6247344
Sequence GCAAAGCAGGAGCCAGTCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 306
Summary {0: 1, 1: 1, 2: 0, 3: 18, 4: 286}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153549546_1153549553 -8 Left 1153549546 18:6247307-6247329 CCCCATACACCGCCTGCAAAGCA 0: 1
1: 0
2: 0
3: 10
4: 98
Right 1153549553 18:6247322-6247344 GCAAAGCAGGAGCCAGTCTAGGG 0: 1
1: 1
2: 0
3: 18
4: 286
1153549544_1153549553 3 Left 1153549544 18:6247296-6247318 CCAACACTCACCCCCATACACCG 0: 1
1: 0
2: 0
3: 33
4: 385
Right 1153549553 18:6247322-6247344 GCAAAGCAGGAGCCAGTCTAGGG 0: 1
1: 1
2: 0
3: 18
4: 286
1153549542_1153549553 26 Left 1153549542 18:6247273-6247295 CCATTTATCCAACAATATGCTTT 0: 1
1: 0
2: 2
3: 38
4: 361
Right 1153549553 18:6247322-6247344 GCAAAGCAGGAGCCAGTCTAGGG 0: 1
1: 1
2: 0
3: 18
4: 286
1153549548_1153549553 -10 Left 1153549548 18:6247309-6247331 CCATACACCGCCTGCAAAGCAGG 0: 1
1: 0
2: 0
3: 4
4: 114
Right 1153549553 18:6247322-6247344 GCAAAGCAGGAGCCAGTCTAGGG 0: 1
1: 1
2: 0
3: 18
4: 286
1153549543_1153549553 18 Left 1153549543 18:6247281-6247303 CCAACAATATGCTTTCCAACACT 0: 1
1: 0
2: 2
3: 26
4: 185
Right 1153549553 18:6247322-6247344 GCAAAGCAGGAGCCAGTCTAGGG 0: 1
1: 1
2: 0
3: 18
4: 286
1153549545_1153549553 -7 Left 1153549545 18:6247306-6247328 CCCCCATACACCGCCTGCAAAGC 0: 1
1: 0
2: 0
3: 7
4: 163
Right 1153549553 18:6247322-6247344 GCAAAGCAGGAGCCAGTCTAGGG 0: 1
1: 1
2: 0
3: 18
4: 286
1153549547_1153549553 -9 Left 1153549547 18:6247308-6247330 CCCATACACCGCCTGCAAAGCAG 0: 1
1: 0
2: 1
3: 4
4: 69
Right 1153549553 18:6247322-6247344 GCAAAGCAGGAGCCAGTCTAGGG 0: 1
1: 1
2: 0
3: 18
4: 286

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153549553 Original CRISPR GCAAAGCAGGAGCCAGTCTA GGG Intronic
900417565 1:2542125-2542147 GCAAAGCAGGAGCCTGACCCGGG - Intergenic
901027158 1:6284788-6284810 GGAAAGCAGGGGGCAGGCTAGGG - Intronic
901207648 1:7505988-7506010 GGAAAGCAGAAGCCAGTGGAAGG + Intronic
902259530 1:15214347-15214369 GAGAGGCAGGAGCCAGGCTAAGG + Intronic
904943493 1:34181850-34181872 TCTAAGAAGGAGCCAGTCAAGGG + Intronic
905607607 1:39317149-39317171 GCTAAAAAGGAGTCAGTCTAAGG - Intronic
905688696 1:39927173-39927195 CCAAAGCTGGTGCCAGGCTAGGG - Intergenic
905962867 1:42059657-42059679 GCAAGGCAGCAGCAAGTCTGGGG + Intergenic
906087993 1:43152383-43152405 GCCAAGCAGGAGCCAGCCCTGGG - Intronic
906361377 1:45162748-45162770 GCAAGGCAGCAGCCAGGCTGGGG + Intronic
906856227 1:49308077-49308099 GCAAAGCAGGAGCATGCCTCAGG - Intronic
907837153 1:58120849-58120871 GAGAAGCAGGAGCCAGGCGAAGG + Intronic
911104651 1:94120258-94120280 GCAGAACAGAAGCCAGTCCAGGG + Intronic
911549712 1:99264352-99264374 GGGGAGCAGGAGCCAGACTAGGG + Exonic
913454950 1:119021032-119021054 GCAAGGCAGCAGCCAGGCTGGGG + Intergenic
913598130 1:120396950-120396972 GTAAGGCAAGGGCCAGTCTAAGG + Intergenic
914089201 1:144482370-144482392 GTAAGGCAAGGGCCAGTCTAAGG - Intergenic
914309412 1:146451845-146451867 GTAAGGCAAGGGCCAGTCTAAGG + Intergenic
914512264 1:148344712-148344734 GTAAGGCAAGGGCCAGTCTAAGG - Intergenic
914592699 1:149121292-149121314 GTAAGGCAAGGGCCAGTCTAAGG - Intergenic
914866414 1:151433698-151433720 GGAAAGCAAAAGCCAGACTATGG + Intronic
915026024 1:152830656-152830678 GCAAGGCAGCAGCGAGGCTAGGG + Intergenic
918385435 1:184002477-184002499 ACAAAGCAGCAGCCTGCCTAGGG - Intronic
918549938 1:185730710-185730732 CCAAAGCAGTATTCAGTCTATGG - Intergenic
919466212 1:197923314-197923336 GCACAGCAGGGGCCAGTGTGAGG - Intronic
920681131 1:208073662-208073684 CCAAAGAAGGTGCCATTCTAAGG - Intronic
921215131 1:212930271-212930293 GCAGGTCAGGATCCAGTCTATGG + Intergenic
921222351 1:212982079-212982101 TCAAAGCAGGAGGTAGGCTAGGG - Intronic
922415934 1:225423415-225423437 GCTAAGCAGGAGCCAGGCTGGGG - Intronic
924731348 1:246714381-246714403 GCAAAGCAGCAGCGAGGCTGGGG + Intergenic
1064214801 10:13391338-13391360 GCAAAGCAGGAGCCAGCGAAGGG - Intergenic
1065841168 10:29702506-29702528 GCAAAGCTGCAGCCAGTATCAGG + Intronic
1067717182 10:48698637-48698659 GCAAAGCAGGAGCCATATTTGGG - Intronic
1070154249 10:73824007-73824029 GGAAAGCAGGAGGCAGGCTCAGG + Intronic
1070310714 10:75271705-75271727 GCAAGGGAGGAGCCAGTAAAGGG - Intergenic
1072568542 10:96638662-96638684 GCCATGCAGGAGTGAGTCTATGG + Intronic
1072749766 10:97969364-97969386 GTAAAGAAGGAGCCAGCCTGTGG + Intronic
1072855066 10:98937510-98937532 GCAAGGCAGCAGCCAGGCTGGGG + Intronic
1072859076 10:98983921-98983943 GCAAGGCAGCAGCCAGGCTCGGG + Intronic
1073667549 10:105550617-105550639 GCAAGTCAGCAGCCAGGCTAGGG + Intergenic
1074001614 10:109379179-109379201 GCCAAGCAGCACCCAGTCAATGG - Intergenic
1074652848 10:115544297-115544319 GCAAAAAAGGAGCCAGTGGAAGG + Intronic
1075777402 10:124997600-124997622 GTAAAGCAGCAGCCAGGCTTGGG - Intronic
1076580913 10:131510281-131510303 GCAAGGCAGCAGCCAGGCTGGGG - Intergenic
1078449878 11:11432854-11432876 GCAAAGCTGGAGCCAGGACATGG - Intronic
1078736608 11:14026062-14026084 GCAAGGCAGGAGCCAGCCTCCGG + Intronic
1078812091 11:14778094-14778116 GCAAAGCAGCAGCGAGGCTGGGG + Intronic
1079241670 11:18726331-18726353 GCAAAGCTGGATCCAGGCTGGGG + Intergenic
1079284233 11:19115067-19115089 GGAAACCAGGAGCCTGACTAAGG + Intergenic
1080031470 11:27665696-27665718 GCAAAGCAGCAGCGAGGCTGGGG + Intronic
1083301177 11:61740293-61740315 GCAGGGCAGGAGCCAGGCCAGGG + Intronic
1083310683 11:61782133-61782155 GCGAAGGAGGAGCCAGGCTCGGG - Intronic
1084559222 11:69893310-69893332 CCAAAGCAGGAGGCAGCCTCTGG + Intergenic
1084605582 11:70169892-70169914 GCACAGCAGGACCCAGTCCAAGG - Intronic
1085032561 11:73281584-73281606 GCCAAGCAGGAGCCAGACAGTGG + Intronic
1085146077 11:74198847-74198869 GAAAATGAAGAGCCAGTCTATGG - Intronic
1086254396 11:84857466-84857488 GCACAGGAGGAATCAGTCTATGG + Intronic
1089555834 11:119315619-119315641 GCAAAGCATGTGCCAGGCTGGGG + Intronic
1089673977 11:120077046-120077068 CCAGTGCAGGATCCAGTCTAAGG - Intergenic
1090406486 11:126478855-126478877 GCAAAGCAGGAGCCCTTCTGAGG + Intronic
1090918258 11:131186130-131186152 GGAAAGCAGGAGCCAGATAAGGG + Intergenic
1092063390 12:5569127-5569149 GCAAATCAGGAGTCAGCCAAGGG + Intronic
1092704734 12:11269790-11269812 GGAAAGCAGAACCCAGTCTCTGG - Exonic
1093982407 12:25489220-25489242 GCAAGGCAGCAGCGAGTCTGGGG - Intronic
1094451643 12:30588768-30588790 GCAAAGCGGCAGCCAGGCTGGGG + Intergenic
1094631311 12:32177956-32177978 GCAAAGCAGTATGCATTCTATGG + Intronic
1095560514 12:43559709-43559731 GTAAAGCAGGGCTCAGTCTAGGG + Intergenic
1095719557 12:45385942-45385964 GAAATGCAGGAGGCAGTCTTGGG - Intronic
1098421708 12:70304886-70304908 GCAAGGCAGCAGCCAGGCTGGGG - Intronic
1099106776 12:78506844-78506866 GCAAGGCAGCAGCCAGGCTGGGG + Intergenic
1101360365 12:104020719-104020741 GAAGAGCAAGAGCCAGTCAAGGG + Intronic
1101548944 12:105743681-105743703 GCAAAGGAGGAGCTCCTCTAGGG + Intergenic
1102440351 12:112959057-112959079 GCAAGGCAGAAGCGAGGCTAGGG - Intronic
1103448650 12:121012228-121012250 ACAAAGCAGGCTCCAGTCTCAGG - Intronic
1103925993 12:124423576-124423598 GCAAGGCCGGAGCCATCCTAAGG + Intronic
1104039895 12:125122849-125122871 CCAAAGCATGAGACAGTCTCAGG - Intronic
1104556850 12:129807942-129807964 CCAAAGCAGCAGCAAGTCTTGGG + Intronic
1105880256 13:24599350-24599372 TCAAAGCAGGAGCCAGGTCAGGG - Intergenic
1107208833 13:37827864-37827886 GCAAGGCAGCAGCGAGGCTAGGG - Intronic
1107687708 13:42920607-42920629 TCAAAGCAGGAGCAGGTATATGG - Intronic
1108639161 13:52366044-52366066 GCAAAGATGGAGTCAGTGTAGGG - Intergenic
1108650782 13:52477528-52477550 GCAAAGATGGAGTCAGTGTAGGG + Intergenic
1109322963 13:60832910-60832932 GCAAGGCAGCAGCCAGGCTTGGG - Intergenic
1109710426 13:66152319-66152341 GAAATGAAGTAGCCAGTCTAGGG - Intergenic
1109971992 13:69782590-69782612 GCAAGGCAGCAGCAAGGCTAGGG + Intronic
1111421297 13:88015199-88015221 GAAAAGCAGAAGCCAGTTAAGGG - Intergenic
1112797818 13:103076410-103076432 GCTAAGCAGGAACCAGGATAGGG + Intergenic
1114579507 14:23744637-23744659 GCAAGGCAGCAGCAAGGCTAGGG - Intergenic
1114691577 14:24587398-24587420 GCAAGGCAGCAGCAAGGCTAGGG - Intergenic
1116286101 14:42973121-42973143 GCAAGGCAGCAGCCAGGCTGGGG - Intergenic
1116322828 14:43492589-43492611 GCAAAGCGGCAGCCAGGCTGGGG + Intergenic
1116331078 14:43598313-43598335 GCAAGGCAGAAGCCAGGCTGGGG + Intergenic
1117856773 14:60042462-60042484 GCAAGGCAGCAGCGAGGCTAGGG - Intronic
1118250732 14:64158060-64158082 GCAAAGCAGGAGGCAAGCAATGG - Intronic
1118861526 14:69668045-69668067 GGAAAGCAGGAGCAAGTCCAGGG + Intronic
1118955257 14:70475616-70475638 GCAAGGCAGCAGCCAGGCTGGGG + Intergenic
1120042346 14:79768172-79768194 GCAAGGCAGCAGCCAGACTGGGG + Intronic
1122009133 14:98731340-98731362 GCAAAGCAGGAGACAGTGATAGG - Intergenic
1122252767 14:100451666-100451688 GAAGAGCAGGAACCAGCCTAAGG + Intronic
1126030490 15:44492316-44492338 GCAGAGCAAGATCCAGTCTTGGG + Intronic
1127392237 15:58515307-58515329 GCAGAACAGGATCCAGTTTATGG - Intronic
1128872370 15:71170495-71170517 CCAGAGCAGGACACAGTCTAGGG - Intronic
1129649163 15:77468853-77468875 CCAAAACAGGTTCCAGTCTAGGG + Intronic
1131307495 15:91258396-91258418 GCAAAGGAGCAGTCAGTCAAAGG - Intronic
1131509161 15:93039834-93039856 GGAAGTCAGGAGCCAGTCTGAGG - Intronic
1132598144 16:762478-762500 GGACAGGAGGAGCCAGTCCAGGG + Intronic
1134303730 16:13013655-13013677 GCAAAGCAGTGGCCAGTGAAGGG - Intronic
1136341188 16:29644608-29644630 GCGAAGCAGGACCCAGGTTAGGG + Intergenic
1137221383 16:46454993-46455015 GCAAGGCAGCAGCCAGGCTGGGG - Intergenic
1137929250 16:52571157-52571179 GCCAAGCAGGAGCCATTGTTGGG + Intergenic
1139716225 16:68815291-68815313 GCAAAGCTGGGGCTATTCTAGGG - Intronic
1139776464 16:69319833-69319855 GCAAAACAGGAGTCAGTGTGGGG - Intronic
1141284525 16:82659375-82659397 GAATAGCAGGAGCAAGGCTACGG + Intronic
1141435618 16:83998175-83998197 GCACAGCAGGAGTCAGTGTGGGG - Intronic
1141790945 16:86233706-86233728 GCAAGGCAGCAGCCAGGCTGGGG + Intergenic
1141862570 16:86728052-86728074 GGAAAGCAGGTGCCAGTCTTGGG + Intergenic
1141973380 16:87497203-87497225 GGAAAGCAGGAGTCAGGCCAAGG - Intergenic
1142645953 17:1313792-1313814 GGAATGCAGGAGCAAGACTATGG + Intergenic
1143202631 17:5122927-5122949 GCCAAGCCGGAGCCAGTGGAGGG + Intronic
1144447733 17:15346353-15346375 GCAGAGCAGGAGACAGTGAATGG + Intergenic
1145072559 17:19823331-19823353 ACAAAATAGGAGCCAGGCTAGGG - Intronic
1148163522 17:45465865-45465887 GCAAAGCAGAAGCTAGACCATGG + Intronic
1149429799 17:56588596-56588618 GCGGAGCAGGAGCCAGACTGAGG + Intergenic
1150394749 17:64812517-64812539 GCAAAGCAGAAGCTAGACCATGG + Intergenic
1150548606 17:66188516-66188538 ACAGAGCAACAGCCAGTCTAGGG - Intronic
1152305754 17:79519375-79519397 GCAAAGCCGGGGCCATTCCAGGG - Intergenic
1153549553 18:6247322-6247344 GCAAAGCAGGAGCCAGTCTAGGG + Intronic
1154172583 18:12062025-12062047 GGACAGCAGCAGCAAGTCTAGGG + Intergenic
1155321595 18:24624639-24624661 GCAAGGCAGCAGCCAGGCTGCGG - Intergenic
1155331016 18:24716411-24716433 GCAAGGCAGCAGCCAGGCTGGGG - Intergenic
1155350558 18:24901551-24901573 GCAAAGCAGCAGCAAGGCTGGGG + Intergenic
1156725301 18:40119769-40119791 GCAAAGCGGCAGCGAGGCTAGGG - Intergenic
1157367392 18:47078109-47078131 GCAAAGCAGGAGACAGATAAAGG + Intronic
1158919306 18:62172293-62172315 GCAGTCCAGGATCCAGTCTAAGG + Intronic
1160091238 18:75828616-75828638 ACAAGGCAACAGCCAGTCTAAGG - Intergenic
1160698330 19:495039-495061 AAAAAGCAGCAGCCAGTCCATGG - Intronic
1162212193 19:9101127-9101149 ACAAAGCAAGACCCTGTCTATGG + Intergenic
1163080342 19:14935520-14935542 AAAAAGCAGTAGCCATTCTAAGG - Intergenic
1164090988 19:21952072-21952094 GCAACGCAGCAGCCTGGCTAGGG + Intronic
1164688648 19:30190378-30190400 GCAAGGCAGCAGCGAGGCTAGGG - Intergenic
1165060869 19:33204676-33204698 GCCCAGCAGGAGCCAGTCCAGGG - Exonic
928401763 2:30984143-30984165 GAGAAGCAGGAGCTAGTCTTAGG - Intronic
931789821 2:65654764-65654786 CCAAGGCAGGAGCCAGTGCAGGG + Intergenic
933945467 2:87282696-87282718 GCAAAGCGGGAGGCAGGCTATGG - Intergenic
936334742 2:111578892-111578914 GCAAAGCGGGAGGCAGGCTATGG + Intergenic
939939186 2:148328433-148328455 GCAAGGCAGCAGCGAGGCTAGGG - Intronic
940577094 2:155522704-155522726 GAAAGGCAGGAGTAAGTCTAAGG - Intergenic
941448481 2:165630324-165630346 GAAAAGGAGGAGTCAGTCTTAGG - Intronic
943549325 2:189319594-189319616 GCAAGGCAGCAGCCAGGCTCGGG + Intergenic
944368781 2:198956379-198956401 GAAAAGCAGGAGCCAGACCTTGG - Intergenic
944520997 2:200566783-200566805 GCAAGGCAGCAGCCAGGCTGGGG - Intronic
946033019 2:216720012-216720034 GCAAAGCAAGAGGCACTTTAAGG + Intergenic
946515175 2:220403637-220403659 GCAAAGGAGGAGCTAGCATATGG - Intergenic
948516490 2:238507095-238507117 GCAAAGCAGCAGCCCTTCCACGG + Intergenic
1169175638 20:3510202-3510224 GCAGTACAGGATCCAGTCTAGGG + Intronic
1173014068 20:39209085-39209107 CCAAAGCTGGACACAGTCTAAGG + Intergenic
1173907761 20:46641195-46641217 GCAAACCAGGAAGCAGTCTGGGG + Intronic
1174480673 20:50829070-50829092 GCACAGCAGGAGCTGGACTAAGG - Intronic
1174703117 20:52629312-52629334 GCAAACCTGGAGTCAGACTATGG - Intergenic
1178730685 21:35100059-35100081 GGAAAGGAGGAGCTAATCTATGG - Intronic
1179798278 21:43798370-43798392 CCAAGGCAGGAACGAGTCTAGGG - Intronic
1181626551 22:24125927-24125949 GGAAAGCAGCAGCCAGTATGGGG - Intronic
1182978620 22:34646971-34646993 CCAATGCAAGAGCCATTCTAGGG - Intergenic
1185038532 22:48491729-48491751 GCAGAGCAGGCGACAGTCTCAGG - Intronic
952742453 3:36747942-36747964 GCAAAGCAAGAGATATTCTATGG - Intergenic
953524733 3:43679369-43679391 GCAAGGCAGCAGCGAGGCTAGGG + Intronic
955523374 3:59796371-59796393 GCAAAGGAGGAGCTGGTGTAAGG - Intronic
956862455 3:73338575-73338597 GCAAGGCAGCAGCGAGGCTAGGG - Intergenic
960433606 3:117599448-117599470 GGAGAGCAGGAGCCACTCTGAGG + Intergenic
960730291 3:120719628-120719650 GCAAGGCAGCAGCCAGGCTGGGG + Intronic
961193262 3:124980310-124980332 GATAAGCAGGAGCCAGACTCTGG - Intronic
961722957 3:128908307-128908329 GCCCAGCAGGGGCCAGTCCAGGG + Intronic
962007698 3:131363862-131363884 GCAAAGCAAGAGGCAGGGTATGG - Intergenic
962424485 3:135257805-135257827 GCAAGGCAGCAGCCAGGCTGGGG - Intronic
962465942 3:135659016-135659038 GCAAGGCAGCAGCCAGGCTGGGG + Intergenic
962976750 3:140452424-140452446 GCACACCAGGAGTCAGTCTGTGG + Intronic
963984433 3:151575444-151575466 GCAAGGCAGCAGCCAGGCTGGGG - Intergenic
966494132 3:180560322-180560344 GCAAGGCAGCAGCAAGGCTAGGG + Intergenic
967843475 3:194026151-194026173 CCAAAGTAGGAGCCTGTCTTAGG + Intergenic
969807154 4:9618023-9618045 GCAAGGCAGGAGCAAGGCTGGGG + Intergenic
969988444 4:11235640-11235662 GCAAGGCAGCAGCCAGGCTGGGG + Intergenic
971333862 4:25704792-25704814 GAAAAGCAGGTGCCATTTTAGGG + Intergenic
972422814 4:38905546-38905568 AAAAAGCAGGAGCCACTCTACGG + Exonic
972821055 4:42702000-42702022 GCAAAGCAGCAGCGAGGCTGGGG - Intergenic
974547683 4:63334014-63334036 GCAAGGCAGGAGCAAGGCTGAGG + Intergenic
974690677 4:65293830-65293852 GCAAGGCAGCAGCCAGGCTGGGG - Intergenic
975287456 4:72637055-72637077 GCAAGGCAGGAGCCAGGCGGGGG - Intergenic
976977270 4:91180522-91180544 GCAAGGCAGCAGCCAGGCTGGGG - Intronic
977485023 4:97633891-97633913 GCAAGGCAGCAGCCAGGCTGGGG + Intronic
978782884 4:112575706-112575728 GCAAGGCAGGAGCTAGGCCAGGG + Intronic
979569139 4:122195914-122195936 TCAAAGAAGGTGCCAGTCTATGG - Intronic
981514896 4:145597018-145597040 GCAAGGCAGCAGCAAGGCTACGG - Intergenic
982292569 4:153793100-153793122 GCAAAGCAGGAGCCAGTCTGGGG + Intergenic
984307605 4:178015443-178015465 GCAAGGCAGCAGCGAGGCTAGGG + Intergenic
988466880 5:31499928-31499950 GCAAGGCAGGACCAAGCCTAAGG + Intronic
988917742 5:35912139-35912161 GCAAAGCAGCAGCGAGGCTGGGG + Intronic
988945201 5:36189932-36189954 GCAAGGCAGCAGCGAGGCTAGGG - Intergenic
990030285 5:51251156-51251178 GCAAGGCAGCAGCCAGGCTGGGG + Intergenic
990071750 5:51790862-51790884 GCAAAGCAGCAGCGAGGCTGGGG - Intergenic
990648417 5:57870453-57870475 GCAAGGCAGCAGCCAGGCTGGGG - Intergenic
991435179 5:66590828-66590850 AGAAAGCAGATGCCAGTCTAAGG - Intergenic
991535604 5:67666544-67666566 GCAAAGCGGCAGCCAGGCTGGGG - Intergenic
992514258 5:77475216-77475238 GCAAGGCAGCAGCCAGGCTGGGG + Intronic
993052737 5:82944458-82944480 GCAAGGCAGCAGCGAGGCTAGGG + Intergenic
994791352 5:104230335-104230357 TCACAGCAGGAGGCTGTCTAGGG - Intergenic
995150275 5:108835335-108835357 CCAAAAAAGGAGCCAGGCTATGG - Intronic
995676764 5:114671284-114671306 GCAAGGCAGCAGCCAGGCTGGGG + Intergenic
996162418 5:120181740-120181762 GCAAGGCAGTAGCAAGGCTAGGG - Intergenic
997084659 5:130783891-130783913 GCAAGGCGGCAGCCAGGCTAAGG + Intergenic
997112192 5:131087569-131087591 GCAAGGCAGCAGCCAGGCTGCGG + Intergenic
997134646 5:131312532-131312554 GCAAGGCAGCAGCCAGGCTGGGG - Intronic
997864145 5:137445961-137445983 GCAAAGCTGGAATCAGTCTTAGG - Intronic
998202699 5:140137934-140137956 GAAAAGCAGGAGGCAGTATCAGG - Intergenic
999124722 5:149238802-149238824 GCTAAGCAGGGGCCAGGCTGGGG - Intronic
999258869 5:150225573-150225595 ACAAAGCAGGGACCAGGCTAAGG - Intronic
1000632691 5:163608584-163608606 GCAATGCTTGAGCCAATCTAAGG - Intergenic
1002536633 5:179879552-179879574 GGAAAGCTGGAGCCAGTCCTGGG - Intronic
1004159896 6:13204151-13204173 ACCAAGCAGGAGCCAGCCCATGG + Intronic
1004705255 6:18118508-18118530 CAAAAGCAGGAGACAGTCCAAGG + Intergenic
1005810298 6:29510084-29510106 GCAAAGCAGGAAACAGGCTAAGG + Intergenic
1006303133 6:33204580-33204602 GCAAAGCCGGGGCCAATCAAAGG - Intergenic
1007477108 6:42126013-42126035 GGACAGCAGGAGCCACTCCAGGG + Intronic
1007745714 6:44041872-44041894 GGAAAGCAGGGGCCTGTCTGGGG - Intergenic
1008361089 6:50620271-50620293 GCAAGGCAGCAGCAAGGCTAGGG + Intergenic
1008689523 6:53962152-53962174 GCAGAGCAGGCGCCACTGTAGGG + Intronic
1008689705 6:53964322-53964344 CCAAAGCAGGAGCCAGTACCTGG + Intronic
1008787421 6:55185929-55185951 GCTGAGCAGGAGCCAGTCATAGG - Intronic
1008801099 6:55369034-55369056 GCAAGGCAGCAGCCAGGCTGGGG - Intronic
1008812733 6:55524687-55524709 GCAAAGTTTGAGCCAGTCTCTGG - Intronic
1008978619 6:57457500-57457522 GCAAAGGAGCAGCGAGCCTAGGG - Intronic
1011953334 6:92995587-92995609 GCAAGGCAGCAGCAAGGCTAGGG + Intergenic
1012089545 6:94874012-94874034 GCAAGGCAGCAGCCAGGCTGGGG - Intergenic
1012251547 6:96986584-96986606 GCAAGGCAGCAGCCAGGCTGGGG - Intronic
1012426934 6:99125015-99125037 TCAATACAGGATCCAGTCTAGGG - Intergenic
1012832700 6:104225642-104225664 ACAAAGCAAGACCCTGTCTATGG + Intergenic
1012923547 6:105244787-105244809 GCAAGGCAGCAGCGAGGCTAGGG + Intergenic
1014849742 6:126327012-126327034 GCAAGGCAGCAGCGAGGCTAGGG + Intergenic
1015732319 6:136361342-136361364 GCAAGGCGGGAGGAAGTCTAAGG - Intronic
1016102064 6:140115121-140115143 GCAAGGCTGCAGCCTGTCTAGGG + Intergenic
1017075398 6:150613023-150613045 GCAGAGCAGGGGCCAGACTAGGG - Intronic
1018870868 6:167781178-167781200 GCAAAGCTGGAGTCATTCTGTGG - Intergenic
1019352374 7:560648-560670 GCAATGCACCAGCCAGTCTCAGG + Intronic
1020528503 7:9296448-9296470 GGAAAGTAGGAGTAAGTCTAAGG - Intergenic
1022285685 7:28955303-28955325 GCAATGCAGAAGCCAGGCTTTGG - Exonic
1023892996 7:44406924-44406946 GCAGAGCAGGAGCAAGGCCAGGG + Intronic
1023966520 7:44965712-44965734 GCAAGGCAGCCGCCACTCTACGG - Exonic
1027125571 7:75554452-75554474 GAAAAGCTGGAGCCAGTATCTGG - Exonic
1027292436 7:76728896-76728918 GCAAGGCAGCAGCCAGGCTGGGG + Intergenic
1027330748 7:77090248-77090270 GCAAGGCAGCAGCGAGGCTAGGG - Intergenic
1027819393 7:83024505-83024527 GCAATGCAGCAGCCAGGCTGGGG + Intronic
1028369051 7:90070360-90070382 GCAAGGCAGGAGTGAGGCTAGGG + Intergenic
1029785014 7:102781090-102781112 GCAAGGCAGCAGCGAGGCTAGGG + Intronic
1031334802 7:120515170-120515192 GGAAAGCAGGAGCAAGTATAGGG - Intronic
1031344720 7:120651328-120651350 GCAAGGCAGCAGCCAGGCTTGGG - Intronic
1032372212 7:131368137-131368159 GCAAAGGAGAATCCAGTTTAGGG - Intronic
1032675034 7:134121966-134121988 GCAATGCTCGAGCCAGTCCAGGG - Intergenic
1032742576 7:134753609-134753631 GCAAGGCAGGAGCCACCCTCAGG - Intronic
1033975521 7:147095759-147095781 GCAAACCAGGATCCAGTTTTAGG - Intronic
1034337133 7:150330857-150330879 GCAGAGCAGCAGCCACTCTGGGG + Exonic
1035694525 8:1585144-1585166 ACAAACCAGGCGCCAGTCTTAGG - Intronic
1036579809 8:10063463-10063485 TCAGAGCAGGAGCCAGCCTCGGG - Intronic
1037460465 8:19103319-19103341 GGAAAGCAGGAGCCAGGCAGGGG + Intergenic
1038477863 8:27880835-27880857 ACAAAGCAAGACCCTGTCTAAGG + Intronic
1040427440 8:47303157-47303179 GCAAGGCAGCAGCCAGGCTGCGG - Intronic
1041345527 8:56893126-56893148 CCAAATCAGGCCCCAGTCTAGGG + Intergenic
1041388196 8:57326612-57326634 GCAAAGCAGCAGCAAGGCTGGGG - Intergenic
1041638689 8:60173660-60173682 GGAAAGCAGGAGCCCATCCAAGG - Intergenic
1041847883 8:62352517-62352539 GCAATGCATGAGCCAGTCAGAGG + Intronic
1042020643 8:64369663-64369685 GCAAAGCAGAAGTAAGTCTCGGG - Intergenic
1043485704 8:80697189-80697211 GCAGAGCCTGAGCCAGACTATGG + Intronic
1044134927 8:88574501-88574523 GCAATGCAGCAGCGAGGCTAGGG + Intergenic
1047046267 8:121056402-121056424 GCAAGGCAGCAGCAAGGCTAGGG - Intergenic
1047499509 8:125430736-125430758 GCAAAGCAGGAGCCACTCCCCGG - Exonic
1050051233 9:1603747-1603769 GAAAAGCAGAAGCCAGAGTATGG - Intergenic
1050083195 9:1936781-1936803 GCAAGGCAGCAGCCAGGCTGGGG - Intergenic
1050907665 9:11026432-11026454 GCAAAGCAGGAGCAAGAGTCGGG + Intergenic
1052992923 9:34532277-34532299 GCAATGCAGCAGCCAGGCTGGGG - Intergenic
1053827086 9:42036475-42036497 GCAAGGCAGCAGCGAGACTAGGG + Intronic
1054603477 9:67150957-67150979 GCAAGGCAGCAGCGAGACTAGGG - Intergenic
1056556583 9:87694802-87694824 ACAGAGCAGGATGCAGTCTACGG + Intronic
1057756842 9:97846107-97846129 GCAAAGCAGGGGCCCAGCTATGG - Intergenic
1058086017 9:100749177-100749199 GCAAGGCAGCAGCGAGGCTAGGG - Intergenic
1058863377 9:109139252-109139274 GAAAAGCAGAAGCCAGTATATGG + Intronic
1061362441 9:130152186-130152208 GCAAAGCAGGGGAGTGTCTAGGG + Intergenic
1186507878 X:10108609-10108631 GCACAGGAGGAGGCAGTCTCAGG + Intronic
1188886666 X:35559894-35559916 GCAAAAAGGGAGCCAGTGTATGG + Intergenic
1189930481 X:46004052-46004074 GCAAGGCAGCAGCGAGGCTAGGG - Intergenic
1190357189 X:49616912-49616934 GGTCAGCAGGAGGCAGTCTAGGG + Intergenic
1191592852 X:62906687-62906709 GCAAGGCAGCAGCCAGGCTGGGG - Intergenic
1191827264 X:65379007-65379029 GCAAGGCAGCAGCGAGGCTAGGG + Intronic
1192071248 X:67942943-67942965 GCAAGGCAGCAGCGAGGCTAGGG + Intergenic
1192586950 X:72326576-72326598 GAGGAGAAGGAGCCAGTCTAGGG + Intergenic
1192994043 X:76493136-76493158 GAAAAGCAGCAGCCAGTCAGGGG + Intergenic
1193387954 X:80893333-80893355 GCAAGGCAGGAGCGAGGCTAGGG - Intergenic
1195020652 X:100823936-100823958 GCAAAGCATAAGCCAGTTGAGGG - Exonic
1196851449 X:119942849-119942871 GGAAAGGAGGAGCCAGTGAACGG - Intronic
1198858520 X:141044708-141044730 GCAAGGCAGCAGCGAGGCTAGGG + Intergenic
1198904177 X:141542680-141542702 GCAAGGCAGCAGCGAGGCTAGGG - Intergenic
1199906882 X:152241597-152241619 GCAAAGCAGCAGCGAGGCTGGGG - Intronic
1200966151 Y:9040435-9040457 GAGATGCAGCAGCCAGTCTAAGG - Intergenic
1201251642 Y:12064243-12064265 GAAAAGCAGAATCGAGTCTAGGG + Intergenic
1201942302 Y:19473242-19473264 GCAAGGCAGCAGCGAGGCTAGGG - Intergenic
1201954953 Y:19613403-19613425 GCAAGGCGGCAGCCAGGCTAGGG + Intergenic
1202072958 Y:21011504-21011526 GCAAGGCAGCAGCGAGGCTAGGG - Intergenic
1202077658 Y:21053358-21053380 GCAAGGCAGCAGCGAGGCTAGGG - Intergenic
1202085199 Y:21129230-21129252 GCAAGGCAGCAGCAAGGCTAGGG - Intergenic