ID: 1153549554

View in Genome Browser
Species Human (GRCh38)
Location 18:6247326-6247348
Sequence AGCAGGAGCCAGTCTAGGGT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 237}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153549544_1153549554 7 Left 1153549544 18:6247296-6247318 CCAACACTCACCCCCATACACCG 0: 1
1: 0
2: 0
3: 33
4: 385
Right 1153549554 18:6247326-6247348 AGCAGGAGCCAGTCTAGGGTCGG 0: 1
1: 0
2: 1
3: 29
4: 237
1153549548_1153549554 -6 Left 1153549548 18:6247309-6247331 CCATACACCGCCTGCAAAGCAGG 0: 1
1: 0
2: 0
3: 4
4: 114
Right 1153549554 18:6247326-6247348 AGCAGGAGCCAGTCTAGGGTCGG 0: 1
1: 0
2: 1
3: 29
4: 237
1153549543_1153549554 22 Left 1153549543 18:6247281-6247303 CCAACAATATGCTTTCCAACACT 0: 1
1: 0
2: 2
3: 26
4: 185
Right 1153549554 18:6247326-6247348 AGCAGGAGCCAGTCTAGGGTCGG 0: 1
1: 0
2: 1
3: 29
4: 237
1153549547_1153549554 -5 Left 1153549547 18:6247308-6247330 CCCATACACCGCCTGCAAAGCAG 0: 1
1: 0
2: 1
3: 4
4: 69
Right 1153549554 18:6247326-6247348 AGCAGGAGCCAGTCTAGGGTCGG 0: 1
1: 0
2: 1
3: 29
4: 237
1153549545_1153549554 -3 Left 1153549545 18:6247306-6247328 CCCCCATACACCGCCTGCAAAGC 0: 1
1: 0
2: 0
3: 7
4: 163
Right 1153549554 18:6247326-6247348 AGCAGGAGCCAGTCTAGGGTCGG 0: 1
1: 0
2: 1
3: 29
4: 237
1153549542_1153549554 30 Left 1153549542 18:6247273-6247295 CCATTTATCCAACAATATGCTTT 0: 1
1: 0
2: 2
3: 38
4: 361
Right 1153549554 18:6247326-6247348 AGCAGGAGCCAGTCTAGGGTCGG 0: 1
1: 0
2: 1
3: 29
4: 237
1153549546_1153549554 -4 Left 1153549546 18:6247307-6247329 CCCCATACACCGCCTGCAAAGCA 0: 1
1: 0
2: 0
3: 10
4: 98
Right 1153549554 18:6247326-6247348 AGCAGGAGCCAGTCTAGGGTCGG 0: 1
1: 0
2: 1
3: 29
4: 237

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153549554 Original CRISPR AGCAGGAGCCAGTCTAGGGT CGG Intronic
900417563 1:2542121-2542143 AGCAGGAGCCTGACCCGGGTGGG - Intergenic
902754098 1:18537719-18537741 AGCAGGAGCCCGGCTGGAGTGGG - Intergenic
902834324 1:19036863-19036885 AGCAAGAGACAGGCTGGGGTGGG - Intergenic
904557494 1:31374711-31374733 AGCAGCAGCCTGTCCAGGGTGGG + Intronic
904564500 1:31420177-31420199 TGTAGGAGCCATTCTGGGGTGGG + Intronic
904613960 1:31739901-31739923 AGAAGGAGTCAGGCAAGGGTGGG - Intronic
904900920 1:33856389-33856411 AGCAGGAGCCAGTGGAGGCCAGG - Intronic
905515168 1:38557443-38557465 AGCAGAAGCAAGTCTAGGAGGGG - Intergenic
905607605 1:39317145-39317167 AAAAGGAGTCAGTCTAAGGTGGG - Intronic
906277017 1:44524066-44524088 AGCAGCAGCCTGGCTAGAGTGGG + Intronic
907778059 1:57538217-57538239 AACAGGAGCCAGTCTAAGCCAGG - Intronic
910527930 1:88202245-88202267 AACAGGAGGCAGTATAGGGTAGG - Intergenic
910548825 1:88453130-88453152 GGCAGGTGCCAGTGTGGGGTTGG - Intergenic
911549714 1:99264356-99264378 AGCAGGAGCCAGACTAGGGGAGG + Exonic
912244010 1:107941970-107941992 AGGAGGAGACAGTCTAGGGCTGG - Intronic
912976746 1:114337801-114337823 AGCAGGAGCCAGGGTAGGATGGG - Intergenic
913328045 1:117644891-117644913 TGCAGGTCCCAGTCTAGGGAGGG - Intergenic
914742873 1:150479959-150479981 CACAGGAGCTAGTCTAGGGTAGG - Intergenic
914815790 1:151061060-151061082 AGAAAGAGGCAGCCTAGGGTAGG + Intronic
917150805 1:171942813-171942835 AGCAGGAGCCAGTGCAAGGCTGG + Intronic
920084415 1:203404902-203404924 AGCAGGTGACAGCCTGGGGTTGG + Intergenic
920138375 1:203789093-203789115 AGCAGCAGCCTGTCCAGGTTTGG - Intergenic
920525654 1:206664051-206664073 AACAGGAGCCGGACTAGGGCGGG - Intronic
920575811 1:207059587-207059609 AGCAGGAGCCCCTCCAAGGTAGG - Intronic
921033556 1:211354706-211354728 AGCTGGAGCCAGTGTAGGAAGGG - Intronic
922080162 1:222287910-222287932 ACCAGGAGCTACTCTAGGCTAGG - Intergenic
922229495 1:223673518-223673540 AGCAGGAGGAAGTGTAGGGGAGG + Intergenic
923030491 1:230245800-230245822 AGCAGGAGTCACTCTAGGAGTGG - Intronic
924940716 1:248811163-248811185 CACAGGAGCCAGTCTGGAGTTGG + Exonic
1066661392 10:37740792-37740814 GGCTGGAGCCAGTCCATGGTTGG + Intergenic
1067250509 10:44582419-44582441 AGCAGGAGCCAGAGTAGAGGAGG - Intergenic
1069635802 10:69924035-69924057 TGCAAAAGCCAGTCTAGGGATGG + Intronic
1069749760 10:70737574-70737596 AGGAGGAGCCTGGCTAGGGCAGG - Intronic
1069894831 10:71673870-71673892 TCCAGGAGCCAGTCCTGGGTTGG + Intronic
1070348363 10:75567446-75567468 TTTAGGAGCCAGTCTTGGGTTGG + Intronic
1070371418 10:75785939-75785961 AGCAGGGCCCAAGCTAGGGTTGG - Intronic
1072230692 10:93411750-93411772 AACAGAAGCCAGGCTAGGATGGG - Intronic
1072232522 10:93425469-93425491 ATCAGGTGCCAGTCTAGGTGGGG - Intronic
1073056947 10:100709297-100709319 AGCAGCAGGCAGCCTAGGGTGGG + Intergenic
1073734996 10:106335793-106335815 AGTAGGAGTTAGTCTGGGGTGGG + Intergenic
1074204954 10:111275152-111275174 AGCAGGGGCCATGCCAGGGTAGG + Intergenic
1077066095 11:641474-641496 AGCTGGATCCAGTCCAGGGTAGG - Intergenic
1077898046 11:6468887-6468909 TGCAGGAGCGAGTCTAGATTTGG + Intronic
1079242938 11:18733458-18733480 GGCAGGAGCCAGACTGGTGTAGG + Intronic
1080296504 11:30736211-30736233 AGCAGGTGCTAGTCCAGGGTGGG - Intergenic
1081717772 11:45263060-45263082 AGCAGGAGCCAGGGAATGGTGGG - Intronic
1082764471 11:57156234-57156256 CAGAGGAGACAGTCTAGGGTGGG + Intergenic
1082890398 11:58132914-58132936 TGAAGGATCCAGTCTAGGATAGG + Intronic
1090570097 11:128036385-128036407 TGCAGGAGGCAGTGCAGGGTCGG + Intergenic
1091027805 11:132157769-132157791 AGGAGGAGCAGGTTTAGGGTTGG - Intronic
1091352051 11:134905699-134905721 TGCAGGAGGCACTCTAGGGAAGG + Intergenic
1096415215 12:51406857-51406879 AGGAGGAGCCAGGCTAGGCCAGG + Intronic
1096845075 12:54401991-54402013 GGCAGGAGCCAGTGTAAGTTTGG - Exonic
1097168753 12:57100133-57100155 AGCTGGAGCCTGTTTAGGGCAGG + Intronic
1098634378 12:72763540-72763562 AATAGTAGCCATTCTAGGGTAGG - Intergenic
1102018009 12:109661220-109661242 GGCAGGAGCCACTCAAGGGCGGG - Intergenic
1102574671 12:113848846-113848868 AGCAGGAGCCAGACTTGGAGAGG - Intronic
1102590104 12:113950441-113950463 AGCAGGTGCCAGTCGGGGGATGG - Intronic
1104375993 12:128266358-128266380 TGCAGGAGCAAGTCTAGAGAGGG + Intergenic
1107406110 13:40115328-40115350 AGCAGGACCCAGCCTAAGCTCGG + Intergenic
1108165331 13:47687152-47687174 AGGAGGAGAGAGTCTAGGGTAGG + Intergenic
1108492863 13:50998870-50998892 AGCAAAGGCCAGTCCAGGGTGGG - Intergenic
1108605917 13:52038512-52038534 AGCAGGAGCCAATGTACAGTGGG + Intronic
1110790766 13:79584339-79584361 AGCAGAAGCCAGTATTGGGTAGG + Intergenic
1114516384 14:23302439-23302461 AGGAGGAGCCAGGCGAGGGCGGG - Exonic
1115694481 14:35881689-35881711 TGCAGGATCCAGTTTGGGGTAGG - Intronic
1115860827 14:37684210-37684232 ACCAGGACCCAGACTAGGATGGG - Intronic
1116777396 14:49196539-49196561 AGCATAAGCCAGTTTAGGTTGGG + Intergenic
1119172442 14:72545387-72545409 AGCAGGAGCCAGTCTGCAGGAGG - Intronic
1119323508 14:73745277-73745299 AGCAGGTGACAGTCAAGGGCAGG - Intronic
1119976748 14:79033103-79033125 AGTAGGAGTCAGTCTAGTGATGG - Intronic
1120713778 14:87818922-87818944 GGCAGGAGCCAGACTGGAGTGGG + Intergenic
1120917207 14:89720646-89720668 AGCAGAAGCCAGTCCACTGTGGG - Intergenic
1121797604 14:96747962-96747984 AGCAGGGGCCAGGCCAGGGAAGG + Intergenic
1123449240 15:20349844-20349866 AGCAGAAGCCAGGAGAGGGTGGG - Intergenic
1124095475 15:26644802-26644824 AGCAGAAGCAAGTCCAAGGTGGG + Intronic
1125390300 15:39185243-39185265 TGCAGGAGCCAGACAAGCGTGGG - Intergenic
1125520692 15:40346374-40346396 AGCTGGAGCCTGCCTAGGGCTGG - Intergenic
1127392236 15:58515303-58515325 AACAGGATCCAGTTTATGGTAGG - Intronic
1128795439 15:70463208-70463230 AACAGGAGCCAGGCTAGGGGTGG - Intergenic
1130222199 15:82029033-82029055 GGCAAGGGCCAGTCTAGGGAAGG - Intergenic
1130919741 15:88334154-88334176 AGCAGGAGACAGGCAAGGCTTGG - Intergenic
1131134181 15:89920714-89920736 AGGAGCAGCCAGGCTAGAGTAGG + Intergenic
1131143831 15:89999647-89999669 ACCAGGAGCTGGTTTAGGGTGGG + Intergenic
1131158535 15:90089820-90089842 ACCAGAAGCCAGTCTAGGCCTGG + Intronic
1132682571 16:1149198-1149220 TGCAGGGGCCAGTCTAGGCAGGG + Intergenic
1133738243 16:8631897-8631919 AGAAGGATTCAGTCTAGGGGTGG - Intronic
1135920383 16:26644001-26644023 TGCAGGTTACAGTCTAGGGTGGG + Intergenic
1139463029 16:67137755-67137777 AGGAGGAGCCTGTCGAGGGTGGG + Intronic
1139504338 16:67391602-67391624 AGCAAGAGCCAGTCTGGGCACGG + Exonic
1143724871 17:8837927-8837949 AGCGGGAGGCAGTCTAGGCTGGG + Intronic
1146978300 17:37135370-37135392 GGCAGGTGCTAGGCTAGGGTTGG + Intronic
1148655443 17:49279820-49279842 AGCAGAAGCCAGTCAAGCATGGG - Intergenic
1148742078 17:49898601-49898623 AGCAGGAGCCAGGCTGGGCTGGG - Intergenic
1149429800 17:56588600-56588622 AGCAGGAGCCAGACTGAGGAAGG + Intergenic
1149596670 17:57868352-57868374 AGCAGGGGGCAGGCAAGGGTGGG + Intronic
1152570095 17:81117908-81117930 ACCAGGAACCAGGCAAGGGTGGG + Exonic
1152698556 17:81807945-81807967 AGGAGGAGCTGGCCTAGGGTGGG - Intronic
1203170138 17_GL000205v2_random:140853-140875 GGCAGGAGTCAGGCTCGGGTGGG - Intergenic
1153374057 18:4355835-4355857 AGCAGCAGCTAGTCTAGTATGGG - Intronic
1153549554 18:6247326-6247348 AGCAGGAGCCAGTCTAGGGTCGG + Intronic
1154200150 18:12293971-12293993 ACCAGGGGCCAGGCTGGGGTGGG + Intergenic
1155519197 18:26652107-26652129 AGCAGGGGCCAGACTTGGGGTGG + Intronic
1156494393 18:37516417-37516439 GCCAGGAGCCAGGCTAGTGTTGG - Intronic
1158578090 18:58657301-58657323 AGAAGAAGCCAGTCTGTGGTGGG - Intergenic
1158777348 18:60600257-60600279 AGCAGAAGCCAGTCTGTGGTGGG - Intergenic
1158832069 18:61290571-61290593 TGGAGGAGCCAGTGTAGGGTAGG - Intergenic
1159046108 18:63369790-63369812 TGGAGGAGCCAGTGTAGAGTAGG + Intergenic
1159900277 18:74038785-74038807 AGCAAGAACAAGTCTAGGATTGG + Intergenic
1161275733 19:3415796-3415818 ACCTGGTGCCAGTATAGGGTTGG + Intronic
1164705266 19:30314778-30314800 AGCAAGAGGCAGGCTAAGGTGGG + Intronic
1165190467 19:34058714-34058736 AGGAGGAGTCAGTCTGGGGGAGG + Intergenic
1166865695 19:45835440-45835462 AGCAGGAGCCAGGCAAGGCAAGG + Intronic
1167224145 19:48225596-48225618 AGCAGGAGCCAGTCTTGCAAGGG + Intronic
1167270199 19:48502015-48502037 AGGAGGAGCCAGGATAGGGGAGG - Intronic
1168257331 19:55173997-55174019 AACAGGGGCCGGGCTAGGGTAGG + Intronic
926444357 2:12925668-12925690 AGCAGGTGACAGTCTGAGGTGGG - Intergenic
927147692 2:20177816-20177838 AGCAGGAGCCAGGCAAGAGCAGG + Intergenic
931689398 2:64822467-64822489 AGCAGGAGCAAGGCCAGGGGTGG - Intergenic
931867256 2:66426221-66426243 CGCAGGAGCCACTCTGGGGCCGG + Intergenic
932130298 2:69181339-69181361 AGGAGGAGCATGTTTAGGGTAGG + Intronic
934571755 2:95377056-95377078 AGCAGGAGCCACTCCAAGGTGGG - Intronic
936808996 2:116373076-116373098 ATGAGGAGACAGTCCAGGGTTGG + Intergenic
937339599 2:121082652-121082674 GGCAGGGGCCAGGCTAGGGCTGG + Intergenic
939064397 2:137465189-137465211 AGCAGGAGGCAGAGTAGGGTGGG + Intronic
939469237 2:142598617-142598639 AGAAGTAGTCAGTCTAGAGTAGG + Intergenic
940048695 2:149437721-149437743 AGCAGGAGCCAGGCCAGAGCAGG - Exonic
941802816 2:169679382-169679404 AGCAGGTGCCAGTGTCGGCTGGG + Intronic
942449493 2:176100163-176100185 TGCAGGAGCCAGGCTAGACTCGG - Exonic
942803379 2:179901854-179901876 AGCAGGAGCAAGTGCAGGGTGGG + Intergenic
944011289 2:194978298-194978320 TGGAGGACCCAGTGTAGGGTAGG + Intergenic
944417722 2:199495628-199495650 AGCCAGAACCAGTCTATGGTTGG - Intergenic
946168541 2:217879874-217879896 AGCTGAAGCCAGTCCTGGGTGGG - Intronic
946193399 2:218019601-218019623 AGAAGGAGGAAGTTTAGGGTGGG - Intergenic
946335158 2:219031065-219031087 AGGAGGGGCCAGTCTGGGGACGG + Intronic
946498295 2:220218553-220218575 AGGAGCAGCCAGTTTGGGGTGGG + Intergenic
948456720 2:238107875-238107897 AGCAGGAGTCGGTCTAGAATGGG - Exonic
948462521 2:238137216-238137238 AGCAGGGGCCAGGCTGGGCTGGG + Intergenic
948834464 2:240619545-240619567 TGCAGCAGCCTGTCTAGGATGGG - Intronic
1169252123 20:4068862-4068884 AGCAGGAGACAGGGTGGGGTGGG + Intergenic
1169373358 20:5045430-5045452 AGAAGGCGCCAGGCCAGGGTCGG + Intergenic
1173067821 20:39729783-39729805 AGCAGGAGCAAGTGGGGGGTGGG - Intergenic
1173570379 20:44071871-44071893 TGCCGGGGCCAGTCTACGGTCGG + Intergenic
1173786662 20:45798516-45798538 GGCAGAAGCCAGTCGAGGGTAGG - Intronic
1174058309 20:47814953-47814975 AGGAGGAGCCAGTGGAGGGTGGG + Intergenic
1174160259 20:48545497-48545519 AGGAGGAGCCAGTTGAGGGTGGG - Intergenic
1174553235 20:51376269-51376291 AGCAGGAGCAAGAGAAGGGTGGG + Intergenic
1174799358 20:53550248-53550270 AGCAGGAGCAAGAGTTGGGTGGG + Intergenic
1175375150 20:58518986-58519008 AGCAGGGGACAGGCCAGGGTGGG + Intergenic
1175492232 20:59387022-59387044 AACTGGAGCCAGTCAGGGGTCGG + Intergenic
1175933318 20:62503601-62503623 AGCAGGAGCCAGGACAGAGTGGG + Intergenic
1176016348 20:62935560-62935582 AGCAGGAGTTAGCCTAGGGAAGG + Intronic
1176216863 20:63952152-63952174 GGCAGGAGACAGCCCAGGGTCGG + Intronic
1176284835 21:5013877-5013899 GGCCGGAGCCAGTCTGTGGTCGG + Intergenic
1176326128 21:5502649-5502671 GGCAGGAGTCAGGCGAGGGTGGG - Intergenic
1176401629 21:6318302-6318324 GGCAGGAGTCAGGCGAGGGTGGG + Intergenic
1176435528 21:6670802-6670824 GGCAGGAGTCAGGCGAGGGTGGG - Intergenic
1176459790 21:6997872-6997894 GGCAGGAGTCAGGCGAGGGTGGG - Intergenic
1176483351 21:7379650-7379672 GGCAGGAGTCAGGCGAGGGTGGG - Intergenic
1179872346 21:44249598-44249620 GGCCGGAGCCAGTCTGTGGTCGG - Intronic
1179904433 21:44415004-44415026 AGCAGGAACACGTCTAGGGCTGG - Intronic
1179934587 21:44593961-44593983 GGCTGGAGCCAGTCCATGGTTGG - Intronic
1179959323 21:44759320-44759342 AGAAGGAGCCAGGTCAGGGTGGG - Intergenic
1180255434 21:46624278-46624300 AGCAGCAGCAAGTTCAGGGTGGG - Intergenic
1180962522 22:19768406-19768428 CCCAGAGGCCAGTCTAGGGTGGG + Intronic
1181151360 22:20885723-20885745 GGCAGGACGCAGTCTAGAGTAGG + Intronic
1183003261 22:34879325-34879347 AGCAAGACTCAGTCTTGGGTGGG - Intergenic
1183338923 22:37267284-37267306 AGGAGGAGCCAGACCAGAGTCGG - Intergenic
1183394668 22:37564629-37564651 AGCAGGAGGCAGTGTAGCCTGGG + Intronic
1183468524 22:37992922-37992944 AGCAGGAGCTTGCCTAGGGTAGG - Intronic
1183930786 22:41235056-41235078 AGCAGGAGCCTGACTTGGCTTGG - Intronic
1184188245 22:42878606-42878628 TGCAGGCGCCAGTCGAGGGAGGG - Intronic
1185110511 22:48897774-48897796 AACAGAAGCCAGTCTGGGCTGGG + Intergenic
950719516 3:14872747-14872769 AGCCAGAGCCAGTCCATGGTGGG + Intronic
954706151 3:52481668-52481690 AGCAGGAGCCAGTGAAGAGCAGG + Intronic
954920722 3:54188584-54188606 AGCAGGAGCAACCCTATGGTTGG - Intronic
956958936 3:74375257-74375279 AGGAGGAGCCACTCTGGGGCTGG + Intronic
957565323 3:81877701-81877723 ATTAGGAGTCACTCTAGGGTGGG + Intergenic
959628969 3:108486514-108486536 ACCAGGAGCAGGTCTAGAGTGGG + Exonic
960837895 3:121926397-121926419 AGCAGGAGCAAGTGAAGGGTAGG - Intronic
960997498 3:123349697-123349719 AGCAGCAGCCAGTCTGGGGGTGG - Intronic
962763763 3:138542589-138542611 ACCAGGTGCCAGTGGAGGGTGGG + Intronic
962864669 3:139437814-139437836 AGCAGCAGCCAGTCAAGGAAAGG + Intergenic
962895558 3:139710710-139710732 AGCAGGAGCCTATGAAGGGTGGG - Intergenic
964127640 3:153252458-153252480 AGAAGGGGCTAGACTAGGGTAGG - Intergenic
964720282 3:159763556-159763578 AGCAGGAGGCAGGCTGGGATGGG - Intronic
966164981 3:177007026-177007048 AGCAGGAGCAAGGCAGGGGTTGG - Intergenic
966305239 3:178525382-178525404 ACTAGGAGCCAGGCTAGGGGAGG - Intronic
972644585 4:40955211-40955233 AGAAGGAGCCAGCCTTGGGAAGG + Intronic
982292214 4:153791296-153791318 AGCAGCAGCGAGTGCAGGGTCGG - Intergenic
985722382 5:1496534-1496556 CACAGGAGCCAGTCTCGGGCAGG + Intronic
990319454 5:54615331-54615353 ATGAGAAGCTAGTCTAGGGTGGG - Intergenic
990869953 5:60420721-60420743 AGCGGGAGCCAGCGCAGGGTGGG + Intronic
992457167 5:76926493-76926515 AGGAGCAGCCAGTCCAGGGAGGG - Intergenic
995145330 5:108782094-108782116 TGCAGGAACCAGTGCAGGGTAGG - Intronic
996514389 5:124353766-124353788 AGCAGGAGCAAGTCTGGAGCAGG + Intergenic
996600370 5:125255489-125255511 AGCTGGAGCATGTCAAGGGTGGG - Intergenic
998072083 5:139205846-139205868 AGCAGGAGCAAGGCCAGGGGAGG - Intronic
1002049646 5:176562980-176563002 AGCTGGAGCCGGTCTGTGGTTGG + Intronic
1003028530 6:2580013-2580035 ACAAGGAGCCAGTCTGGGGGAGG - Intergenic
1003563953 6:7206768-7206790 GGCAGGAGCCAGGCTTGGGAAGG + Intronic
1004112973 6:12738570-12738592 AGCAGGAGCCAGGCTGGGCATGG + Intronic
1004159898 6:13204155-13204177 AGCAGGAGCCAGCCCATGGAAGG + Intronic
1006420173 6:33928359-33928381 AGCAGAGGCCAGTCTGGGGTTGG - Intergenic
1006879370 6:37325872-37325894 AGCAGGTGGTAGACTAGGGTCGG + Intronic
1007320704 6:41027169-41027191 ATCAAGATCCAGTTTAGGGTTGG - Exonic
1007705975 6:43791691-43791713 AGCATGAGCCAGCCTAGAGGTGG + Intergenic
1008376602 6:50798637-50798659 AGAAGCAGGCAGTCCAGGGTTGG + Intergenic
1008801098 6:55369030-55369052 GGCAGCAGCCAGGCTGGGGTAGG - Intronic
1008913105 6:56757835-56757857 AGCAGGAGGCAGTCCAGGACTGG - Intronic
1009922399 6:70078640-70078662 AGTTGGTGCCAGGCTAGGGTGGG - Intronic
1012900184 6:104996199-104996221 AGCAGGAGTCATTCTGTGGTTGG + Intronic
1013293124 6:108735897-108735919 AGCAGGAGCCTGTCTACACTGGG + Intergenic
1013993143 6:116277961-116277983 GGCAGGAGCCAATGTAGGGCAGG + Exonic
1014109824 6:117608107-117608129 AGCAGCAGCCATGCTAGTGTTGG + Intergenic
1017075396 6:150613019-150613041 AGCAGGGGCCAGACTAGGGAGGG - Intronic
1017108024 6:150906417-150906439 AGCAGGAGCCGGCCCAGAGTGGG + Intronic
1018677729 6:166237097-166237119 AGCCCAAGCCAGCCTAGGGTCGG + Intergenic
1020118264 7:5488376-5488398 AGCAGGAGGCCTTCGAGGGTGGG + Intronic
1022325646 7:29329206-29329228 AACAGAAGCCATTCTTGGGTTGG - Intronic
1023748409 7:43345343-43345365 AGCCAGAACCAGTCTATGGTTGG + Intronic
1024062877 7:45712364-45712386 GGCAGGGGCCAGGCTGGGGTGGG - Intronic
1025942774 7:66086278-66086300 AGCAGGGGCCAGAATAGGGGAGG - Intronic
1029613821 7:101643928-101643950 AGAAGGGGCCAGTGGAGGGTAGG + Intergenic
1032403983 7:131642668-131642690 AGAGGGAGCCAGTCTGGGGAAGG + Intergenic
1032653611 7:133904892-133904914 AGCAGGTGCCAATCTGGGGGAGG - Intronic
1033104774 7:138511254-138511276 AGCAGGAGCCAAAAGAGGGTGGG + Intronic
1033157789 7:138971482-138971504 GGAAGAAGCCAGTCTGGGGTGGG - Intronic
1034396119 7:150826162-150826184 AGCAGCAGCCAGGCAAAGGTCGG + Intronic
1036579807 8:10063459-10063481 AGCAGGAGCCAGCCTCGGGGTGG - Intronic
1038069116 8:23993687-23993709 GTCAGGAGCCAACCTAGGGTAGG - Intergenic
1039321971 8:36442104-36442126 AGCTGCAGCTAGGCTAGGGTGGG + Intergenic
1040554625 8:48467998-48468020 AGCAGGGGCCAGGCTGGGGCAGG - Intergenic
1044259043 8:90097246-90097268 AGGAGGAGGCAGTAAAGGGTGGG - Intergenic
1045395662 8:101758309-101758331 AGCAGGAGACAGCCTATGGAGGG - Intronic
1047296201 8:123572617-123572639 AGCAGGAGCAATCCTTGGGTTGG + Intergenic
1047467287 8:125129247-125129269 AGAAGGAGCCACTGGAGGGTAGG + Intronic
1048910530 8:139130450-139130472 AGCAGGAGTCAGTCTTGGATTGG + Intergenic
1049781408 8:144430675-144430697 AGCAGGTGGCCCTCTAGGGTTGG + Intronic
1051826471 9:21226297-21226319 AGCAGAAGCCATACTGGGGTAGG - Intronic
1051827650 9:21238214-21238236 AGCAGAAGCCATACTGGGGTAGG - Intronic
1052122078 9:24730524-24730546 AGCAGGAGCAAGCCTCCGGTGGG + Intergenic
1052549685 9:29932063-29932085 AGCAGGAGCAAGTCAGTGGTTGG + Intergenic
1056486367 9:87062173-87062195 AGAAGGAGCTAGTTTAGGGGTGG + Intergenic
1057737606 9:97679012-97679034 AACAGAATCCAGTCTAGGATTGG - Intronic
1060070243 9:120540838-120540860 AGCAGGAGCCAGTGCTGTGTGGG - Intronic
1060161926 9:121371725-121371747 AGCCAGAGCCAGTCCATGGTCGG + Intergenic
1060162014 9:121372461-121372483 AGAAGGAGCCAGCCTGGGGAAGG + Intergenic
1060305402 9:122406471-122406493 AGCAGGCGCCAGTTCCGGGTGGG - Intergenic
1060526468 9:124323916-124323938 AGCAGGATTGAGTCTAGGATGGG + Intronic
1061725519 9:132580242-132580264 AGCAGGAGCAAGGCCAGGCTGGG + Intergenic
1061956234 9:133962566-133962588 AGCTGGAGCCAGGCCTGGGTGGG - Intronic
1062217275 9:135396048-135396070 AGCAGGCCCGAGTCTGGGGTCGG - Intergenic
1062318409 9:135979028-135979050 AGCCGGTGCCAGTCTGGAGTTGG - Intergenic
1203435997 Un_GL000195v1:137838-137860 GGCAGGAGTCAGGCTCGGGTGGG + Intergenic
1186196690 X:7116415-7116437 ACCAGGAGGCAGGCCAGGGTAGG - Intronic
1190163366 X:48050608-48050630 TGGAAGAGCCAGTGTAGGGTAGG - Intronic
1190517898 X:51243643-51243665 AGCAGTGGCCAGGCTGGGGTAGG + Intergenic
1192165291 X:68824086-68824108 AGCAGGAGGCAGCCTAGGTAAGG - Intergenic
1193387952 X:80893329-80893351 GGCAGGAGCGAGGCTAGGGGAGG - Intergenic
1193661126 X:84259756-84259778 AGCAGCATCCAGACTGGGGTGGG - Intergenic
1195249161 X:103026178-103026200 AGCAGCAGCGAGGCTAGGGGAGG - Intergenic
1198307704 X:135399264-135399286 AGCCAGAGCCAGTCCATGGTCGG + Intergenic
1199510978 X:148622238-148622260 AGTAGGAGACAGTGTAGTGTAGG + Intronic
1199675958 X:150189621-150189643 AACAGGAGCCAGTGTAAAGTGGG - Intergenic
1199688028 X:150281575-150281597 AGCTGGAGTCATTCTTGGGTGGG + Intergenic
1200337408 X:155364796-155364818 AGGAGCAGGCAGTCTAGGATGGG - Intergenic
1200349062 X:155476431-155476453 AGGAGCAGGCAGTCTAGGATGGG + Intergenic