ID: 1153550862

View in Genome Browser
Species Human (GRCh38)
Location 18:6260383-6260405
Sequence GGGAAGAATCAATATCATTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 304
Summary {0: 1, 1: 1, 2: 6, 3: 25, 4: 271}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153550862_1153550863 -9 Left 1153550862 18:6260383-6260405 CCTTAATGATATTGATTCTTCCC 0: 1
1: 1
2: 6
3: 25
4: 271
Right 1153550863 18:6260397-6260419 ATTCTTCCCACCCATGAGCATGG 0: 58
1: 7507
2: 8084
3: 6742
4: 5183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153550862 Original CRISPR GGGAAGAATCAATATCATTA AGG (reversed) Intronic
902660639 1:17899889-17899911 TGGAAGAATTAATATCATTAAGG + Intergenic
905056452 1:35098332-35098354 GTGAAGAATCAGTGTCATTTTGG + Intronic
906337000 1:44941681-44941703 GGGAAAAGTCAATATCATAAAGG + Intronic
907423848 1:54366047-54366069 GGGCTGAATTAGTATCATTAAGG + Intronic
907854224 1:58285708-58285730 AGGAAGAATCAATATGAAAATGG + Intronic
908910531 1:69067606-69067628 AGGAAGAATCAATATAAAAATGG - Intergenic
908943445 1:69464909-69464931 AGGAAGAATCAATATGAAAATGG - Intergenic
909087153 1:71181586-71181608 GAGAGGAAACAATATCCTTAAGG - Intergenic
909535939 1:76736217-76736239 AGGAAGAATCAATATAAAAATGG - Intergenic
909613935 1:77585270-77585292 GGAAAGTATAAATATCTTTATGG - Intronic
909724564 1:78818825-78818847 GGGAAGAATGGAAATCATTATGG - Intergenic
910685946 1:89916725-89916747 GGGAAAAATAAAGATCATGAAGG - Intronic
910857954 1:91714899-91714921 GGGCAGAATCCATATGATCAAGG + Intronic
911007084 1:93237554-93237576 GGGAAGAAGCAATGTCCTTAGGG - Intronic
911837718 1:102642842-102642864 AGGAAGAATCAATATGAAAATGG + Intergenic
912161068 1:106985911-106985933 GGGAAGAAAAAACATAATTATGG + Intergenic
912790543 1:112645262-112645284 GGGAAGAATCAAATTCAATGAGG + Intronic
915299140 1:154942077-154942099 GGGAAGAATCACTAGAGTTAGGG - Intergenic
918649406 1:186942226-186942248 GGGGGGAAGCAATTTCATTATGG - Intronic
919164714 1:193877373-193877395 AGGAAGAATCAATATGAAAATGG - Intergenic
919218914 1:194599807-194599829 GGGAAAAATAAATATCTTTATGG - Intergenic
920209511 1:204317777-204317799 GGTAAGAATAAATATTATTTTGG + Intronic
920593862 1:207248961-207248983 GAGAAGAATCAGAATCATTGAGG + Intergenic
1063333097 10:5181605-5181627 AGGAAGATTAAATATCATTTTGG - Intergenic
1063429042 10:5973238-5973260 TGGACAAATCAATATCACTAAGG - Intronic
1064170446 10:13027416-13027438 GGGAAGACTTCATATTATTATGG - Intronic
1064700551 10:18015702-18015724 GAGAAGAATCATCATGATTATGG - Intronic
1065406216 10:25368771-25368793 AGGAAGAATCAATATGAAAATGG - Intronic
1065580050 10:27161792-27161814 GGTAAGAATCAATTTCACTTGGG - Intronic
1066602301 10:37122857-37122879 GGTAAGAATCAATTTCACTAGGG + Intergenic
1068184600 10:53568753-53568775 GAAAAGAATCAACATCATGAGGG + Intergenic
1068504756 10:57886473-57886495 AGGAAGAATCAATATCAAAATGG + Intergenic
1069149121 10:64933416-64933438 GTGTAGAATAAATAGCATTAGGG - Intergenic
1070252922 10:74788757-74788779 GGGAACAATCAATATCCTCTTGG - Intergenic
1070418457 10:76212343-76212365 GGAAAGAAGAAAAATCATTATGG + Intronic
1071386887 10:85130278-85130300 AGGAAGAATCAATATCATGAAGG + Intergenic
1071395586 10:85220132-85220154 TGGAAGAATCAATATTAAAATGG + Intergenic
1072285626 10:93911777-93911799 CGGAAGAACCAATGTCATGATGG - Intronic
1073038702 10:100583661-100583683 TGGAAGACTCAATATTGTTAAGG - Intergenic
1074247446 10:111709108-111709130 GGGAACAATCAAGATCATCTTGG + Intergenic
1074284328 10:112083874-112083896 AGGAAAAATGAATAGCATTATGG - Intergenic
1074984405 10:118644041-118644063 GGGAAGAACCAGGATCATAAAGG - Intergenic
1077908486 11:6553879-6553901 CAGAAGAGTCAGTATCATTAAGG + Intronic
1079723849 11:23854257-23854279 AGAAAGAATGAATATCTTTACGG - Intergenic
1079859147 11:25645374-25645396 AGGAAGAATCAATATGAAAATGG - Intergenic
1080921549 11:36714318-36714340 GGGAAGAATGAGTTTCATTTTGG - Intergenic
1081197840 11:40183176-40183198 GGGAAGAATGAATTTAATCAAGG + Intronic
1081222864 11:40483475-40483497 GGGAACAACCAATATGATTTAGG + Intronic
1081347569 11:42009307-42009329 AGGAAAAATCATTATCCTTAGGG + Intergenic
1082129659 11:48472493-48472515 TGGAAGACTTAATATAATTAAGG - Intergenic
1082563185 11:54643389-54643411 TGGAAGACTTAATATAATTAAGG - Intergenic
1084418441 11:69048443-69048465 AGGAGGATTCAATATCATTAAGG - Intergenic
1085813784 11:79713472-79713494 AGGAAGAATCAATATTAAAATGG - Intergenic
1086482602 11:87258984-87259006 GGGAAGAACCAGGATCATAAAGG + Intronic
1088680393 11:112236657-112236679 GGGAAGGAAAAAAATCATTATGG + Intronic
1089131307 11:116214436-116214458 GGGAAGAAACATCATTATTATGG + Intergenic
1089663674 11:120002729-120002751 GGTAAGAATAAACAACATTAAGG - Intergenic
1089769027 11:120789394-120789416 GGGCAGAATCAAAATCAGTGGGG - Intronic
1090410532 11:126505842-126505864 GGGAATACTCAATATTGTTAAGG + Intronic
1091623045 12:2104175-2104197 AGGAAGAATCAATATCAAAATGG - Intronic
1091980850 12:4862557-4862579 GGGAAGAAACCATATCAGCAGGG + Intergenic
1092663991 12:10773699-10773721 GTGAAAAATCAATAACATAAAGG + Intergenic
1093838640 12:23868346-23868368 GGGAAGAATAAACAACTTTAAGG + Intronic
1095528818 12:43160473-43160495 TGGAAGAATCAATATAACTGGGG + Intergenic
1096010601 12:48210933-48210955 GTGAAGAATCATTAGCTTTATGG - Intergenic
1096035396 12:48464463-48464485 AGGAAGAATCAATATTATTATGG + Intergenic
1096308463 12:50499530-50499552 TAGAAGACTCAATATCATGAAGG - Intergenic
1097317409 12:58186823-58186845 AAGAAGAAACAATATCTTTAAGG - Intergenic
1098670408 12:73221396-73221418 GGGAAAAATCAGTATAATTTTGG + Intergenic
1099061174 12:77911092-77911114 TGGAAGAATGAATACCCTTAAGG + Intronic
1099466711 12:82997136-82997158 GGGAAGTATCAAAATGATGAGGG - Intronic
1100078486 12:90819072-90819094 TAGAAAAATTAATATCATTAAGG - Intergenic
1100413267 12:94344713-94344735 TGGAAGACTCAATATTGTTAAGG + Intronic
1105759507 13:23500757-23500779 GGGAAGTATCAATATTTCTAAGG - Intergenic
1106341578 13:28834063-28834085 TGGAAGACTTAATATTATTAAGG + Intronic
1107452249 13:40520277-40520299 GGGAAAAATCAAACACATTAAGG - Intergenic
1107512405 13:41097757-41097779 AGGAAGAATCAATATGAAAATGG - Intergenic
1107953117 13:45484532-45484554 AGGAAGATTAAATATTATTATGG - Intronic
1108487119 13:50938308-50938330 TGGAAGACTCAATATTTTTAAGG + Intronic
1109010283 13:56932321-56932343 GTGGAGAATCAATACAATTATGG - Intergenic
1109092529 13:58067176-58067198 GAGAAAACTCAATATCAGTAAGG - Intergenic
1109441229 13:62378056-62378078 ATCAAGATTCAATATCATTATGG + Intergenic
1109615819 13:64832558-64832580 AGGAAGAATCAATATGAAAATGG + Intergenic
1111181163 13:84667213-84667235 GGACAGAATCAAAATCATAAAGG + Intergenic
1113190314 13:107738263-107738285 GGCATGAATCAATATCAATTGGG - Intronic
1114685820 14:24530447-24530469 AGGAAGAATCAATATGAAAATGG + Intergenic
1116572651 14:46537406-46537428 GGAAAAAAACAATATCATTAGGG - Intergenic
1116584561 14:46686525-46686547 CATAAGAATCAATAACATTAAGG - Intergenic
1116652447 14:47610723-47610745 GGGGAGAATCAATATTGTGAAGG + Intronic
1117124392 14:52605883-52605905 GGGATGAATCAATTTGATCATGG + Intronic
1117597319 14:57336659-57336681 AGGAAGAAGCATTATAATTAGGG - Intergenic
1121595741 14:95160753-95160775 GAGAAGCACCTATATCATTATGG - Intergenic
1122188114 14:100017555-100017577 GGGCAGTATCAATATTATTCTGG + Intronic
1122253728 14:100461526-100461548 TGGGAGACTCAATATTATTAAGG + Intronic
1122808263 14:104272597-104272619 AGGAAGACTCAATATTGTTAAGG - Intergenic
1123927084 15:25126030-25126052 AGGAAGAATAAATAGCAATAAGG - Intergenic
1125829532 15:42704399-42704421 GGAAAGCATCAAGAACATTAAGG - Intronic
1130016555 15:80191866-80191888 GGGAAGAATCAGTTACATTCTGG + Intergenic
1130715948 15:86334551-86334573 TGGAAGAATCAATTTCAAAATGG + Intronic
1131495050 15:92900969-92900991 TGGAAGCATCACTATCAATAAGG - Intronic
1132637262 16:957484-957506 TGGAAAAATCAAAATCATTAAGG + Intronic
1132890298 16:2200409-2200431 GGGAAGAATCACCCTCATTTTGG - Intergenic
1133468853 16:6054259-6054281 GGGAAGAATTATAATAATTATGG + Intronic
1134287458 16:12874395-12874417 GGGAAGAATGAAAATAGTTAAGG + Intergenic
1138810788 16:60148077-60148099 AGGAAGAATCAATATGAAAATGG + Intergenic
1141258767 16:82431228-82431250 TGGAAGAATCAGTATTGTTAAGG + Intergenic
1144277864 17:13692335-13692357 TGGAAGACTCAATATTGTTAAGG - Intergenic
1144397488 17:14859084-14859106 AGGAAGAATCAATATGAAAATGG + Intergenic
1145186162 17:20796000-20796022 AGGAAGAATTAATATCATAAAGG - Intergenic
1146243550 17:31255503-31255525 TGGCAGAATCAATATAATTTTGG - Intronic
1147483289 17:40787580-40787602 GGGAAGAATCAAAATTATTCAGG + Intergenic
1148069996 17:44903164-44903186 GGGAAAAAGCAAAATCTTTATGG + Exonic
1148234346 17:45957761-45957783 GGGAAAACTAAATATCATGAAGG + Intronic
1148410960 17:47466842-47466864 AGGAAGAATTAATATCATAAAGG + Intergenic
1149056401 17:52371762-52371784 GGGAAGAATCAATTTCATAAAGG - Intergenic
1149643704 17:58222715-58222737 TGGAAAAATCTATATCATTAAGG + Intronic
1151095907 17:71497986-71498008 CGGAAGAATAAATAAAATTAAGG - Intergenic
1153550862 18:6260383-6260405 GGGAAGAATCAATATCATTAAGG - Intronic
1156588900 18:38463607-38463629 GGGAAAAAACTATATCATTTGGG + Intergenic
1157020337 18:43773769-43773791 TGGAAGAACTAATATCAGTATGG - Intergenic
1157345674 18:46829581-46829603 GGAAAGAATAAAAATCATTTGGG + Intronic
1159740229 18:72158659-72158681 GGGAAGATGCTATCTCATTATGG - Intergenic
1159840206 18:73390435-73390457 GGGAAGAATGAAAATCAGAACGG - Intergenic
1164085252 19:21895570-21895592 AGGAAGAATCAATATGAAAATGG - Intergenic
926540554 2:14174769-14174791 GGAGAGTAACAATATCATTATGG + Intergenic
928204804 2:29276284-29276306 GGAAAGAAACAATATCTTAATGG - Intronic
929214951 2:39402717-39402739 GAGAAAAATCAATAAAATTAAGG + Intronic
929349720 2:40935486-40935508 GAGGAGAATCCATATCCTTAGGG - Intergenic
929521427 2:42655452-42655474 GGTAAGAAACAATATCATGAAGG - Intronic
929733005 2:44515642-44515664 GGGAAGAAGGATTATCATTTCGG + Intronic
929844339 2:45506507-45506529 GGGAATAAAAAATGTCATTAGGG - Intronic
930484719 2:51997941-51997963 GGGAAGACTCACAATCATTGTGG - Intergenic
931965864 2:67533964-67533986 TAGAAGAGTCAATAACATTAAGG - Intergenic
932283698 2:70515581-70515603 GGGAGGAGGCAATATCCTTAAGG - Intronic
932530849 2:72530760-72530782 GGGCATAATCATTATCATTTAGG + Intronic
933868034 2:86541785-86541807 GAGAAGAGTTAATATCATAAAGG - Intronic
936418468 2:112341820-112341842 GGGAATAATTAAAATCATAAAGG + Intergenic
937470949 2:122173447-122173469 GGGAAGCATCAGGATCAGTAGGG - Intergenic
938401380 2:130994710-130994732 AGAAAGAATCAATCTCCTTAAGG - Intronic
939655999 2:144826117-144826139 GGGAAGAAATAACATGATTATGG + Intergenic
940525845 2:154812214-154812236 GAGAAGAGTCAATATTATAAAGG + Intronic
941179518 2:162241469-162241491 GGGAAGGATGAATTTCACTATGG - Intronic
941337639 2:164265526-164265548 AGGAAGAATCAATATGAAAATGG + Intergenic
942513456 2:176727098-176727120 GGCAATAATCAATACAATTATGG + Intergenic
945449828 2:209980859-209980881 GGGAATAATCAATAGGATTTGGG + Intronic
945528161 2:210914940-210914962 TGAAAGAATCAATATCAAAATGG + Intergenic
1168927523 20:1595104-1595126 GGGGAGAATCACTATGACTAGGG + Intronic
1170650208 20:18232508-18232530 GGTAAAATTCAATAGCATTAAGG + Intergenic
1171176689 20:23056074-23056096 TGGAAGACTTAATATGATTAAGG + Intergenic
1172877492 20:38174555-38174577 GGGATGAATCAAATACATTACGG - Intergenic
1174567445 20:51475668-51475690 GGGAGAAAACAAAATCATTAAGG + Intronic
1179966388 21:44808915-44808937 TCTAATAATCAATATCATTAAGG + Intronic
1183575093 22:38682914-38682936 GGGAAGAACCAGGATCATAAAGG - Exonic
949593055 3:5513666-5513688 AGGAAGAATCAATATGAAAATGG + Intergenic
949993112 3:9595731-9595753 AAGAAGACTCAATATTATTAAGG - Intergenic
952078911 3:29732922-29732944 GTGAATAAGCAATATCATAAGGG - Intronic
952226184 3:31378853-31378875 TGGAAGACTCAATATTGTTAAGG - Intergenic
952626210 3:35407167-35407189 GGGAAGCATCAATATGTTTCTGG + Intergenic
952640257 3:35585376-35585398 AGGAAGATTCATTATCATAAAGG - Intergenic
953900821 3:46842203-46842225 TGGAAGACTTAATATTATTAAGG + Intergenic
955522796 3:59791450-59791472 GGGCACAAGCAATGTCATTAGGG - Intronic
957175906 3:76809266-76809288 TGGCAGAATTCATATCATTATGG + Intronic
958577600 3:95973062-95973084 GGGAAGCCTCAAAATCATGATGG - Intergenic
958624119 3:96602936-96602958 AGGAAGAATCAATATGAAAATGG - Intergenic
958891503 3:99788488-99788510 GGGATGAATGAATTTAATTATGG - Intronic
959322215 3:104891085-104891107 GGGAAGAATTAAGAGCATTCAGG + Intergenic
960003213 3:112754413-112754435 GGGAAGAGTCACAATTATTAGGG - Intronic
962135324 3:132725463-132725485 TGGTAGAATAAATATCATTTGGG + Intergenic
962763238 3:138537678-138537700 GGAAAGAATCAATATTAATTGGG + Intronic
964061708 3:152532707-152532729 AGGAAGAATCAATATCATTATGG - Intergenic
964161968 3:153656404-153656426 AGGAAGAATCAATATCAAAATGG + Intergenic
964682290 3:159355640-159355662 AGGAGGAATCAATATTATTAAGG - Intronic
965191848 3:165540648-165540670 TGGAAGAATCAATATCATACTGG + Intergenic
966102900 3:176295286-176295308 GAGAAAAATAAATATCATCATGG + Intergenic
966127421 3:176596084-176596106 AGAAACAATAAATATCATTATGG - Intergenic
967274542 3:187761025-187761047 AGGGAGAATCAAGATCATTTAGG + Intergenic
969332285 4:6482078-6482100 GGGATGATTCAATATCAGAAAGG - Intronic
972249249 4:37281947-37281969 GGGAATCATAAATATCATGAAGG - Intronic
972820638 4:42697895-42697917 AGGAAGAATCAATATGAAAATGG - Intergenic
973736984 4:53881514-53881536 AGGAAGAATCAATATGAAAATGG + Intronic
974541019 4:63235906-63235928 GGGAAGAAAGAATTTCCTTATGG - Intergenic
974639251 4:64608010-64608032 GTGAATAAAAAATATCATTAGGG + Intergenic
976349130 4:84040612-84040634 TGGAAGAATCAATTTCAATGAGG + Intergenic
977978190 4:103291865-103291887 GTGAAGAATAAATATAATAATGG + Intergenic
978676024 4:111317236-111317258 AGGAAGAATCAATATTGTGAAGG - Intergenic
978679782 4:111366214-111366236 AGGAAGAATCAATACCCTTCAGG - Intergenic
978684183 4:111418999-111419021 GGTATGGAACAATATCATTATGG + Intergenic
978730201 4:112017370-112017392 GGGAATATTCAATATGAATAAGG - Intergenic
978900034 4:113937929-113937951 AGGAAGAATCAATATGAAAATGG + Intronic
979011751 4:115379516-115379538 CAGGAGCATCAATATCATTAGGG + Intergenic
980031640 4:127838876-127838898 GGGAAGAATAAATATTAAAAAGG - Exonic
980305662 4:131058235-131058257 TGGAAGAATCAATATAATTAAGG + Intergenic
981897487 4:149820110-149820132 GTGAAGAATCAACTTCATTTGGG - Intergenic
982004510 4:151050987-151051009 GGCAAAAATAAATATAATTAGGG + Intergenic
983145690 4:164211993-164212015 GAGAAGAAAGAATATTATTATGG + Intronic
983352207 4:166604113-166604135 GGAAAGAATCAATCAAATTAAGG + Intergenic
984112957 4:175643089-175643111 GGGAAGAATCGGTCTGATTATGG - Intronic
984657450 4:182334332-182334354 GGGGAGAATTAATATTCTTATGG - Intronic
985028539 4:185763993-185764015 AGGAAGTATAAATATTATTAAGG + Intronic
986956100 5:13151780-13151802 AGGAAGAATCAATATGAAAATGG - Intergenic
987635188 5:20530275-20530297 AGGAAGAATCAATATGAAAATGG + Intronic
988573436 5:32395428-32395450 GAGTAAAATCAATATAATTAAGG + Intronic
989514926 5:42330851-42330873 AGGAAGAGTCAATATTATAAAGG + Intergenic
990103067 5:52217038-52217060 AGGAAGAATCAATATGAAAATGG - Intergenic
991218763 5:64188048-64188070 AAGAAGATTCAATATCAGTAGGG + Intronic
993882112 5:93375385-93375407 TGGAAGACTCAATATTGTTAAGG + Intergenic
994230159 5:97302575-97302597 AGGAAGAATCAATATGAAAATGG - Intergenic
995224006 5:109683587-109683609 GGGCAGAACCCATATCATAAAGG - Intergenic
996267246 5:121556333-121556355 AGGAAGAATCAATATGAAAATGG - Intergenic
1000738035 5:164930056-164930078 AGGAAGAATCAATATGAAAATGG - Intergenic
1001817773 5:174684732-174684754 TGGAAGCAGCAATATCATCAAGG + Intergenic
1001890569 5:175334823-175334845 GGGAATAATCAAAATCATTGGGG - Intergenic
1002892209 6:1344880-1344902 GGGTAGACTCAATATTGTTAAGG + Intergenic
1004234574 6:13862706-13862728 AGGAAGAATGAAAAACATTATGG + Intergenic
1004379417 6:15119359-15119381 GGGAAAACTCGACATCATTAAGG - Intergenic
1006833866 6:36985460-36985482 GGGAAGAAGCAATAGAATTGGGG - Intronic
1008078121 6:47167206-47167228 GGCAAGAATCACTAGTATTAGGG - Intergenic
1008548945 6:52609139-52609161 AGGAAGAATCAATATGAAAATGG - Intergenic
1009800895 6:68534879-68534901 GGACAGAATCAATATGATCATGG + Intergenic
1010163241 6:72883990-72884012 TGTAAGAATCAATATTCTTAAGG + Intronic
1011120510 6:83946948-83946970 AGGAAGAATCAATATGAAAATGG + Intronic
1011887430 6:92114094-92114116 GAAAAGAATAAATATCAATATGG - Intergenic
1012212549 6:96539670-96539692 GGAAAGAATAAATATAAATAAGG + Intronic
1012542188 6:100373896-100373918 GAGAATAATAAATAACATTAAGG + Intergenic
1013177338 6:107689121-107689143 GTGATGAATCATTATCATCATGG - Intergenic
1013901243 6:115158883-115158905 GGTAAGAAAAACTATCATTATGG - Intergenic
1014130648 6:117828083-117828105 GGAAAAAAGCACTATCATTATGG - Intergenic
1015077777 6:129182592-129182614 TGGAAAAAACAATGTCATTATGG + Intronic
1015368036 6:132419360-132419382 TGGAAGACTCAATATCAAGATGG - Intergenic
1016308258 6:142706044-142706066 CAGAAGAATCACTAGCATTATGG + Intergenic
1016554291 6:145318159-145318181 AGGAAGAATCAATATTAAAATGG - Intergenic
1016667477 6:146658677-146658699 GTGAATAATCAGTATGATTAAGG - Intronic
1017074576 6:150605698-150605720 GGAACTCATCAATATCATTAAGG - Intronic
1017142424 6:151203933-151203955 GGGAAGAATCAACTTTTTTAGGG - Intergenic
1020916316 7:14198258-14198280 GAGAAGAAAAAATTTCATTAGGG + Intronic
1021189822 7:17607432-17607454 TGGAAGAATCAATATTAAAATGG + Intergenic
1021281267 7:18721602-18721624 GGCTAGAATCAATATCATCATGG - Intronic
1021673183 7:23053092-23053114 TGGAAGACTCAATATTGTTAGGG - Intergenic
1023229822 7:38015219-38015241 TGGAAGACTCAATATTTTTAAGG - Intronic
1028441053 7:90861268-90861290 GGGAAGATTCAAGATCAGAAAGG - Intronic
1028444659 7:90907515-90907537 AGGAAGATTCAATCTCATCATGG - Intronic
1029051267 7:97690856-97690878 GAAAAGAATCAATAGCATTATGG - Intergenic
1030013436 7:105194639-105194661 TGGAAGATTCAATATTATTAAGG + Intronic
1030791508 7:113734806-113734828 GGGGAGAATTGACATCATTACGG + Intergenic
1030831217 7:114224361-114224383 AGGAAGACTCAATATCACTCAGG - Intronic
1031199542 7:118662117-118662139 TGGAACAATTAATATAATTATGG - Intergenic
1031411686 7:121447311-121447333 GGGAAGAAAAAATATGTTTAGGG + Intergenic
1031419892 7:121538770-121538792 GGGCATAATTAATACCATTAAGG - Intergenic
1031650557 7:124284498-124284520 GGGAATATTAAATTTCATTAAGG - Intergenic
1031892921 7:127315783-127315805 AGGAAGAATCAATATTAAAATGG + Intergenic
1032304270 7:130718030-130718052 GAAAAGAAGCAGTATCATTAAGG + Intergenic
1033293060 7:140104891-140104913 AGGAAGAATCAATATGAAAATGG - Intronic
1033710891 7:143942478-143942500 AGGAAGGATCAATATCAAAATGG + Intergenic
1037537640 8:19840316-19840338 CAGAAGATTCAATATTATTATGG + Intronic
1039832757 8:41229496-41229518 AGGAAGAATCAATATGAAAATGG + Intergenic
1041655248 8:60342958-60342980 AGGAAGAATCAATATTAACATGG + Intergenic
1041998106 8:64088188-64088210 AGGAAGAATCAATATTGTGAAGG + Intergenic
1042098465 8:65246188-65246210 GGTTTGAATCAATGTCATTAGGG - Intergenic
1042196471 8:66235173-66235195 AGGAAGAATCAATATGAAAATGG + Intergenic
1042837946 8:73093804-73093826 GGGAAGAATAAATAAAATAACGG + Intronic
1042953342 8:74223182-74223204 GGAAACAATAAATGTCATTATGG - Intergenic
1046085106 8:109423724-109423746 TGGAAGACTCAATATCACAATGG - Intronic
1046258049 8:111726831-111726853 GGGAAGATCCACTATCATCATGG + Intergenic
1048093439 8:131265367-131265389 GAGAAGAATCATTACCATTCAGG + Intergenic
1048317635 8:133374155-133374177 GAGATGAATGAATATTATTATGG - Intergenic
1048870242 8:138791259-138791281 AGGAAGAATCAATAACAGGAAGG + Intronic
1050214298 9:3305282-3305304 GGGAAAAAGCAATGTCATTAAGG + Intronic
1051703048 9:19845115-19845137 TGGAAGAATCAATATTGTTAAGG - Intergenic
1052062075 9:23972806-23972828 GGGAAGAAACAGTAACATTTTGG - Intergenic
1052574526 9:30275084-30275106 AGGAAGAATCAATATGAAAATGG - Intergenic
1052678564 9:31658442-31658464 AGGAAGAATCAATATTAAAATGG - Intergenic
1053102018 9:35378910-35378932 AGGAAGAAACACTATCTTTATGG - Intronic
1053414007 9:37934814-37934836 GGCAGAAATCAATTTCATTAGGG - Intronic
1055416059 9:76084634-76084656 GGGAAGATTCAAAATCATGTAGG + Intronic
1057005433 9:91553683-91553705 AGGAAGATTCAATATTATCAAGG + Intergenic
1057112854 9:92490549-92490571 AGGTGGAATCAATATCATAAAGG + Intronic
1058936176 9:109771763-109771785 GGGAAGAAAGAAAATCATGAAGG + Intronic
1059017514 9:110535609-110535631 AGGAAGAATCAGTATTACTATGG - Intronic
1061381124 9:130258384-130258406 GGGAAGCCTCAAAATCATGATGG - Intergenic
1062117254 9:134816152-134816174 GTCCAGAATCAATATCATAAGGG - Intronic
1186143147 X:6598368-6598390 CGGAAGAGTCATTATCATCAAGG + Intergenic
1187636099 X:21230046-21230068 AGGAAGAATCAATATGAAAATGG - Intergenic
1188062701 X:25620127-25620149 GAGAAGAATCAACATAATTTGGG + Intergenic
1188642138 X:32519540-32519562 GGGAAGAATAATTATCTTTCTGG + Intronic
1189128413 X:38473082-38473104 AGGAAGATTCATTATCATGAAGG - Intronic
1189874557 X:45422115-45422137 GGGAAGCCTCAAAATCATGATGG - Intergenic
1191121746 X:56913235-56913257 AGGAAGAATCAATATCACTCAGG - Intergenic
1191598254 X:62972169-62972191 GAGAAGAATCAATATCAATATGG + Intergenic
1191629095 X:63301622-63301644 AGGAAGAATCAATATTAAAATGG + Intergenic
1191642949 X:63447961-63447983 AGGAAGAATCAATATGAAAATGG - Intergenic
1193193375 X:78600483-78600505 TGGAAGAATCAATGTCAAAATGG + Intergenic
1194755347 X:97732574-97732596 GAGAATAGTCAAGATCATTAGGG - Intergenic
1195003862 X:100668110-100668132 GGACAGAATAAATATGATTATGG + Intronic
1195375568 X:104224237-104224259 GGGAAGTATCCATATTATAATGG + Intergenic
1195496800 X:105545655-105545677 GGTGAGCATCAATATAATTAAGG - Intronic
1195883095 X:109613025-109613047 GGGAAGAGTCAAACCCATTAGGG - Intergenic
1196461742 X:115939299-115939321 GTGAAAAAAAAATATCATTAAGG - Intergenic
1197322610 X:125051236-125051258 AGGAAGAATCAATATGAAAATGG + Intergenic
1198973936 X:142313943-142313965 TGCAAGAGTCAATATTATTAAGG + Intergenic
1199178043 X:144815733-144815755 TGTAAGAATCAATATTGTTAAGG + Intergenic
1199197667 X:145050336-145050358 TGGAAGAGTCAATATTGTTAAGG + Intergenic
1199222499 X:145333796-145333818 GGGAAGAATTGTTATCATTTTGG + Intergenic
1200726860 Y:6681858-6681880 TGGAAGAATCAATATTAAAATGG - Intergenic
1200728012 Y:6697634-6697656 TGGAAGAATCAATATTAAAATGG - Intergenic