ID: 1153552545

View in Genome Browser
Species Human (GRCh38)
Location 18:6276494-6276516
Sequence AATTGCAAACATATGAGCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 193}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153552545 Original CRISPR AATTGCAAACATATGAGCTA AGG Intronic
907099108 1:51811557-51811579 AATTAGAAACATATGACTTAGGG - Intronic
907315950 1:53572732-53572754 TATTGGACACATATGAGCTCTGG + Intronic
910086465 1:83409126-83409148 AATTACAAATATATAAGTTATGG - Intergenic
911302907 1:96197503-96197525 AATTACAAACATAGTTGCTATGG - Intergenic
911890694 1:103367965-103367987 ACTAGAAAAGATATGAGCTAAGG - Intergenic
912424382 1:109573977-109573999 CATTGCAATCATAAGAGCCATGG + Exonic
917546157 1:175970508-175970530 AAGTGCAAACACATGAGATCAGG + Intronic
917562529 1:176174122-176174144 AATTTCAAACTTGTGAACTAAGG + Intronic
917603430 1:176601016-176601038 AATTTCTAACATATGAACTTTGG - Intronic
918291276 1:183110549-183110571 AATTGCAAACATAACACATATGG + Exonic
918444935 1:184608401-184608423 AAGTGCTAACATATGGGCTATGG + Intronic
919874226 1:201850480-201850502 AAATGCAAATATAGCAGCTAAGG + Intronic
921381035 1:214524767-214524789 AATCTCTAACATATCAGCTATGG + Intronic
922051396 1:221993962-221993984 AATTCCAAGCATATGCCCTATGG - Intergenic
924861139 1:247923705-247923727 AATTAAAAACATAGGAGCAATGG - Intergenic
1063259681 10:4372795-4372817 AATTGAAAACATCTGTGCAAAGG + Intergenic
1063603530 10:7503402-7503424 AATTGGAAACCTATGACCTTTGG - Intergenic
1063976086 10:11416737-11416759 AATTTTAAACCTATGCGCTAAGG + Intergenic
1064369983 10:14742709-14742731 AATTGCTAAAATATGAAATATGG - Intronic
1064791967 10:18967625-18967647 AATTGCCAGCATAAGAGATATGG + Intergenic
1066557426 10:36629738-36629760 TTTTGCAAACATATGGTCTAAGG + Intergenic
1068212790 10:53943110-53943132 AATAGCAAACAGATGAATTATGG - Intronic
1068527848 10:58150964-58150986 AATTGCAAAAATATGTGCTTTGG - Intergenic
1069486024 10:68824195-68824217 AAGTGCAAAAAAATTAGCTAGGG + Intergenic
1071355815 10:84792901-84792923 AGTTGCAAACATATCTGATAAGG - Intergenic
1072123782 10:92427879-92427901 AAATCCAAACAAGTGAGCTAAGG + Intergenic
1074419913 10:113299661-113299683 AATTGGAAACATAAAAGCCAAGG + Intergenic
1081071654 11:38617439-38617461 AATTGGAAATATCTGGGCTAAGG + Intergenic
1082054183 11:47799449-47799471 AATTGCACGTATATGAGATAGGG - Intronic
1087311057 11:96544064-96544086 ATGTGAAAACATACGAGCTAGGG - Intergenic
1090599214 11:128353076-128353098 ACTTTCAAACACATGAACTAAGG + Intergenic
1090810605 11:130238305-130238327 AAATGAAAACAGATTAGCTAAGG - Intronic
1091890594 12:4051019-4051041 AGTAGCAAACAAATGAGCCAGGG - Intergenic
1095514264 12:42988914-42988936 AATTGCAAATATATGAAATAAGG - Intergenic
1095847723 12:46763866-46763888 AATTGCAAAACTTTGAGCTATGG + Intergenic
1096759867 12:53832171-53832193 AATTCCAGACATTTGAGCTTGGG - Intergenic
1097779111 12:63683536-63683558 AATTGCCAACATTTCAGTTATGG + Intergenic
1098210368 12:68157576-68157598 AATTTCCATCATATGAGCAAGGG + Intronic
1099708577 12:86189929-86189951 AATTGCATAAATATGAACAAGGG - Intronic
1099810804 12:87579822-87579844 AATTGCCATCATATGAGATGGGG + Intergenic
1103060800 12:117856897-117856919 ATCTTCAAAAATATGAGCTATGG + Intronic
1103989131 12:124786516-124786538 AATGACAAACACATGAGCTGGGG + Intronic
1104602186 12:130161777-130161799 AATTTCAAAGAGACGAGCTAAGG - Intergenic
1104915568 12:132262682-132262704 AGGTGCAGACAGATGAGCTATGG - Intronic
1104915584 12:132262759-132262781 AGGTGCAGACAGATGAGCTATGG - Intronic
1105766728 13:23567138-23567160 AAATGCCAACATTTTAGCTAGGG - Intergenic
1107880622 13:44829212-44829234 AATTTCCAACATATGAACTTTGG + Intergenic
1108755308 13:53494155-53494177 AAAGGCAAATATATGAGCCAAGG - Intergenic
1111883778 13:93992756-93992778 AACTGCCAACATCAGAGCTAAGG - Intronic
1114391482 14:22313113-22313135 AATTTCCAACATATGAACTTTGG + Intergenic
1119207124 14:72802769-72802791 AATAGCACTCACATGAGCTAAGG - Intronic
1119775625 14:77246557-77246579 GTTAGCAAACCTATGAGCTAAGG - Intronic
1120502786 14:85317732-85317754 AGTTGCTAACATATGAACTTTGG + Intergenic
1121854504 14:97254719-97254741 TATTACAAACATATGAGCAGAGG - Intergenic
1126051612 15:44691048-44691070 AATTATAAAAATATGAGCTTTGG + Intronic
1126581537 15:50246685-50246707 ATTTGCAAACAGAAGTGCTAAGG + Intronic
1126733284 15:51706362-51706384 ACTTGCCAGCATATGAGTTAAGG - Intronic
1127524061 15:59774764-59774786 ACTTCCAGACATATGAGCTGGGG + Intergenic
1131327030 15:91457717-91457739 AAAGGTAAACATATGAGGTAGGG - Intergenic
1134770512 16:16805273-16805295 AATTCCAAACATCTGTCCTAAGG - Intergenic
1135641010 16:24119710-24119732 AACTGCAAACAAAAGAGCCAGGG - Intronic
1135667824 16:24350888-24350910 AAATGTACACATATGACCTATGG - Intronic
1135836084 16:25826565-25826587 AATTGCAAAAATAAGAACCATGG + Intronic
1138880106 16:61002932-61002954 ATTTGCAAACACATGAGCTAAGG - Intergenic
1143804275 17:9413526-9413548 AATTGCACAGATAGGAGCTAAGG + Intronic
1146075096 17:29721172-29721194 AATTCCAAACATTTTAGTTAGGG + Intronic
1148452028 17:47784962-47784984 CACTGAAAACAGATGAGCTATGG + Intergenic
1149264466 17:54912361-54912383 CAGGCCAAACATATGAGCTATGG - Intronic
1153552545 18:6276494-6276516 AATTGCAAACATATGAGCTAAGG + Intronic
1155987910 18:32249993-32250015 AATTGCACAAATACTAGCTAAGG - Intronic
1156997752 18:43488244-43488266 AATTTCAAACTTATGAGATATGG + Intergenic
1157465629 18:47942250-47942272 AAAGGCAAACACATGAGCAAGGG + Intergenic
1158495463 18:57951358-57951380 AACTAAAAACAAATGAGCTACGG + Intergenic
1158755693 18:60321642-60321664 AATGGCAAACACAGAAGCTAAGG + Intergenic
1159186367 18:64980426-64980448 AATTATGAACATATAAGCTAGGG + Intergenic
1159293388 18:66450868-66450890 AATAGTAAACATATAAGTTATGG + Intergenic
1162225946 19:9222881-9222903 AATTGAAAACATTTTATCTAGGG - Intergenic
1162648966 19:12070617-12070639 CATTGCAGACATATGAATTAGGG + Intronic
1163562799 19:18030474-18030496 AGTTTCAAACATATGAACTTTGG - Intergenic
1165704233 19:37963966-37963988 AATTGCAAACATATAAGAAGTGG + Intronic
1168566610 19:57429931-57429953 GATTGAAAACATTTGAGGTATGG + Intronic
927766323 2:25812118-25812140 AATTGCAAAAATAGTACCTAGGG - Intronic
930797233 2:55406239-55406261 ATTTGCAAAGATATGAAATAAGG + Intronic
930980072 2:57513665-57513687 AATTGCCAACATTTGAGGAAAGG + Intergenic
932874678 2:75438642-75438664 AACTGAAAACAAATGAACTATGG + Intergenic
936721198 2:115254476-115254498 AATTGCAAGCACATGAGATTTGG - Intronic
937612267 2:123876223-123876245 AATTGTAAACATATCAGACATGG + Intergenic
938650680 2:133379994-133380016 AATTGCAGAAATATGAGAGAGGG + Intronic
938650731 2:133380778-133380800 ATGTGCAAACATATTACCTAGGG - Intronic
940348248 2:152650599-152650621 AATTGCGAACAAAAGACCTAAGG - Intergenic
941053816 2:160764941-160764963 AATTACAAAAATATCAGATATGG - Intergenic
943169650 2:184381713-184381735 AATTGGAAAAATATCTGCTAAGG - Intergenic
945003735 2:205379140-205379162 AATTTGAAACACATGAGCAATGG + Intronic
945177136 2:207054125-207054147 TATTGCAAACATTAGAGCAAAGG + Intergenic
945427701 2:209727232-209727254 AATTTCAAAGATATGAAGTATGG - Intronic
945958021 2:216104529-216104551 AATTGCAAAACTGTGAGCAAAGG - Intergenic
946574927 2:221064378-221064400 AATTTCTAACATATGAACTTCGG + Intergenic
947638002 2:231689846-231689868 AATTGCACACATATGTGCTAAGG - Intergenic
947778688 2:232737405-232737427 AATTGCAGACATTAGAGCTTAGG + Intronic
948331793 2:237173628-237173650 AATTGCAAATATATCTGATAAGG - Intergenic
1171094625 20:22319554-22319576 AAGTGTAAACAAATGAGCTCTGG + Intergenic
1174255830 20:49254241-49254263 GATTGCAAACTTATGACCTCAGG + Intronic
1174707874 20:52675520-52675542 TATTGCAAAAATATGACCTTTGG - Intergenic
1174972860 20:55296752-55296774 AATTGCAAAGAAGAGAGCTAAGG + Intergenic
1178635707 21:34300621-34300643 AATTGCAAACACCTTAGCTTGGG + Intergenic
1178723272 21:35028948-35028970 CACTGCAGACAGATGAGCTAGGG - Intronic
1179163985 21:38920823-38920845 GGCTGCAAACAGATGAGCTAGGG + Intergenic
1183514560 22:38256866-38256888 AATTGCAAAAATAGAATCTAGGG + Intronic
1183849784 22:40575593-40575615 AATTTCAAATAGTTGAGCTATGG - Intronic
951141200 3:19162974-19162996 AATTGAAAAAATATTATCTATGG - Intronic
951774268 3:26291454-26291476 CATTTCAAACACATGAGCTATGG - Intergenic
952231453 3:31435178-31435200 ACTTGCAAACAGAAGATCTAAGG - Intergenic
953270477 3:41438029-41438051 AATAGTAAACAAATGAACTAGGG - Intronic
953596835 3:44323485-44323507 AATTGCAAACATTGGAAATAAGG - Intronic
955180733 3:56666800-56666822 AATTGCAAACAAAGTAGCAAAGG + Intronic
955614885 3:60796475-60796497 AATATAACACATATGAGCTATGG - Intronic
956660977 3:71596921-71596943 AATTGGAAACATATGCCATAGGG + Intergenic
958024112 3:88029747-88029769 AATTAAAAATAAATGAGCTAAGG + Intergenic
963562638 3:146885591-146885613 ATTAGTAAATATATGAGCTATGG + Intergenic
963788615 3:149560176-149560198 GAATGCAAACATATGAAATAGGG + Intronic
964317866 3:155463283-155463305 AATTAGAAACATATCACCTATGG - Intronic
964934773 3:162069742-162069764 AATTGCAAATATATCAGTTAAGG - Intergenic
967475567 3:189913046-189913068 CATAGCTACCATATGAGCTAGGG + Intergenic
968979699 4:3840366-3840388 AATGGCCCACATATGAGCAAAGG + Intergenic
969266436 4:6067003-6067025 AAATGCAACCATATGAGAAAAGG + Intronic
970226209 4:13859902-13859924 AGTTACAACCATAGGAGCTAGGG - Intergenic
972105413 4:35479560-35479582 TAGTGCAAATATATCAGCTATGG + Intergenic
972512142 4:39777777-39777799 AATAGAAAACCTATGTGCTATGG + Exonic
973873030 4:55185792-55185814 AATTCCAAACATAGCAGCTAAGG + Intergenic
974854933 4:67449772-67449794 AATTGAAAACTTATGTTCTATGG + Intergenic
977035829 4:91952046-91952068 AATTTCAAACAAAGGAGCTAAGG - Intergenic
977083061 4:92558078-92558100 AATTGCAAGCATTTGAGAGAGGG - Intronic
978058271 4:104301276-104301298 AATAGCCAACATATGACATATGG + Intergenic
978302327 4:107284743-107284765 ATATGCAAACACATGAGTTATGG + Intergenic
979156174 4:117392948-117392970 CCTTGCAATCATAAGAGCTAAGG + Intergenic
980479716 4:133372858-133372880 TATTGCATACCTATGAACTATGG + Intergenic
980815868 4:137945629-137945651 AAATACAAATATTTGAGCTAGGG - Intergenic
982898217 4:160961750-160961772 ATTTGCCAACAGAGGAGCTAAGG + Intergenic
983118033 4:163843950-163843972 AATTGAAAAAAAATGAGCAAGGG - Intronic
983993453 4:174151502-174151524 AATTGAAAACATATTATCCATGG - Intergenic
984451062 4:179902753-179902775 AAATTCAAATATAAGAGCTATGG - Intergenic
984593949 4:181646241-181646263 AATGGCAAAAATAAGAACTAAGG - Intergenic
986085848 5:4445222-4445244 GATTGCAAACAGCTCAGCTAAGG + Intergenic
987154987 5:15080013-15080035 AATGGCTAACTTATAAGCTAAGG + Intergenic
988167178 5:27608842-27608864 AAATGAAAAACTATGAGCTAAGG - Intergenic
989748644 5:44863817-44863839 AATGGCAATCATATGGGCTGTGG + Intergenic
990040239 5:51370645-51370667 AATAGCCATGATATGAGCTATGG + Intergenic
990368281 5:55091854-55091876 ACGTGCAAACAAATGAACTAGGG - Intergenic
990570646 5:57075073-57075095 AATTGCATACTTAAGAGCTTTGG + Intergenic
992981059 5:82172755-82172777 AATTCCAAAAATATGAACTATGG - Intronic
992984098 5:82209838-82209860 CATAGCAGACATATGAGATATGG - Intronic
993606336 5:89994759-89994781 TATTGTAAGCATATGAGTTAGGG - Intergenic
993972112 5:94432330-94432352 AAGTGCAAACATATTACCTGGGG - Intronic
994164462 5:96594294-96594316 AACTGCAAGCAAAGGAGCTATGG - Intronic
996253498 5:121368862-121368884 AAAGGCAAACATATGACCTGAGG - Intergenic
997173940 5:131754630-131754652 CATTGCACACTTCTGAGCTAGGG - Intronic
999042037 5:148425124-148425146 TTTTTCAAACATATGAGCCAAGG - Intronic
999158923 5:149478841-149478863 AGTTTCCAACATATGAGCTTTGG + Intergenic
1000678336 5:164151699-164151721 ACTTGAAAGCATATGGGCTAGGG - Intergenic
1002885319 6:1288729-1288751 AATTGAAAAAAAATGAGCAAAGG - Intergenic
1005110045 6:22271254-22271276 AAATGAAAAAATATGAGCAACGG - Intergenic
1008405932 6:51118403-51118425 ATTTGCAAACACAGGAGCCAAGG - Intergenic
1008767549 6:54937701-54937723 AATTGTAGACACATGAGCTTGGG - Intronic
1008787605 6:55188152-55188174 AATTGAAAAAATATGACCTGTGG + Intronic
1009850925 6:69197565-69197587 AATTGTAAACATCTAAGATATGG - Intronic
1011828976 6:91347224-91347246 AATTGCAAGCATATTAGTTAAGG + Intergenic
1012232661 6:96778301-96778323 AAATGCAAAGAAATCAGCTATGG + Intergenic
1013852130 6:114528660-114528682 AGATGCCAACATTTGAGCTAAGG - Intergenic
1014161976 6:118180106-118180128 ATATGCATACATATGGGCTATGG - Intronic
1016316701 6:142797526-142797548 CATTGCATACATATGTGCTTGGG + Intronic
1016436281 6:144041055-144041077 TTTTGCAGACATATGAGCTGAGG + Intronic
1016722385 6:147316462-147316484 AATTGTAAGCATTAGAGCTATGG + Intronic
1020485212 7:8713036-8713058 AATGGCAAATATAAGAGTTATGG - Intronic
1020904629 7:14049962-14049984 AATTGTAAACATATTTGCGAAGG - Intergenic
1021218466 7:17945718-17945740 AATTACATACAGATAAGCTAGGG - Intergenic
1021539092 7:21737117-21737139 GATTTCAAACATTTGAGCTGGGG + Intronic
1022611431 7:31878228-31878250 AATCCCAAACATATGAACCATGG + Intronic
1022938036 7:35201181-35201203 AATTGCCAACATTTCAGTTATGG + Intergenic
1023508766 7:40927823-40927845 AACTACAAACATACGAGCTCAGG - Intergenic
1027303348 7:76865613-76865635 AATTACAAATATATAAGTTATGG - Intergenic
1029340543 7:99940314-99940336 AATTGCAAGTATAAGGGCTATGG - Intergenic
1031983429 7:128145732-128145754 AATTGCAAAAATATTATCAAAGG + Intergenic
1037997421 8:23363363-23363385 AATTGAAAACATCTGGGCTGAGG + Intronic
1039078152 8:33710926-33710948 AATTGCTATCACATTAGCTAGGG - Intergenic
1039644313 8:39263822-39263844 GATTTCAAATATATTAGCTATGG - Intronic
1040867285 8:52060996-52061018 AATAGAAAAGATATGAGCAAAGG - Intergenic
1041057433 8:54001227-54001249 TATTTCAAACATATGGTCTATGG + Intronic
1042408018 8:68427818-68427840 AATTGCAAAGAAATGTGCAAAGG - Intronic
1042801749 8:72725953-72725975 ATTTGCAAAGATATGTGATAAGG + Intronic
1042891783 8:73620303-73620325 AATTGTAAACATTTGCTCTATGG - Intronic
1044314930 8:90739135-90739157 AATTGCTAACATTTGAACTTTGG + Intronic
1044841923 8:96344263-96344285 AATTGGAAAAATATGAGATGTGG - Intergenic
1045413033 8:101938364-101938386 ACTTCCAAACCTCTGAGCTATGG - Intronic
1048491685 8:134900111-134900133 AACTTTAAACATAAGAGCTAAGG + Intergenic
1052562315 9:30101259-30101281 AGTGGCAAACATATTAGATAGGG + Intergenic
1053120020 9:35539279-35539301 CATTGCATACATTTGGGCTATGG + Intronic
1054978251 9:71173435-71173457 AATTGTAAACATATGTGGAAAGG + Intronic
1056817111 9:89810046-89810068 CTTTGCAAACATATGAGATGGGG - Intergenic
1059131274 9:111752343-111752365 GATTGAAAGCATATCAGCTAAGG + Intronic
1060319478 9:122543192-122543214 AATAACAAAAATATGAGCAACGG - Intergenic
1188175079 X:26978964-26978986 AATTGCAAGTATATGAAATATGG - Intergenic
1188767426 X:34112747-34112769 AAGTGCAAATAAATGAGCAATGG + Intergenic
1189215369 X:39318569-39318591 AATTTCAAACATATGAATTTTGG + Intergenic
1192895033 X:75433512-75433534 AATTGAAAACATATGATATTAGG + Intronic
1196429114 X:115603412-115603434 AATGGCAGGCATAGGAGCTAAGG + Intronic
1198793664 X:140373171-140373193 AAAGGCAAAAATATGAGCTTGGG + Intergenic
1199516177 X:148678005-148678027 AATTGCAATCCTAGGAACTATGG - Intronic
1201566318 Y:15368570-15368592 GAAAGCAAACATATGAGCTGGGG + Intergenic