ID: 1153553251

View in Genome Browser
Species Human (GRCh38)
Location 18:6284559-6284581
Sequence CGGCCAGTGCGTCCCCTCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153553251_1153553262 30 Left 1153553251 18:6284559-6284581 CCTTGGAGGGGACGCACTGGCCG No data
Right 1153553262 18:6284612-6284634 GGTCGCTTTTCTTCCACATCAGG No data
1153553251_1153553253 -9 Left 1153553251 18:6284559-6284581 CCTTGGAGGGGACGCACTGGCCG No data
Right 1153553253 18:6284573-6284595 CACTGGCCGGCTGCGCACGCAGG No data
1153553251_1153553255 9 Left 1153553251 18:6284559-6284581 CCTTGGAGGGGACGCACTGGCCG No data
Right 1153553255 18:6284591-6284613 GCAGGCTGTTCCCAAGCCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153553251 Original CRISPR CGGCCAGTGCGTCCCCTCCA AGG (reversed) Intronic