ID: 1153553253

View in Genome Browser
Species Human (GRCh38)
Location 18:6284573-6284595
Sequence CACTGGCCGGCTGCGCACGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153553248_1153553253 -3 Left 1153553248 18:6284553-6284575 CCGCCACCTTGGAGGGGACGCAC No data
Right 1153553253 18:6284573-6284595 CACTGGCCGGCTGCGCACGCAGG No data
1153553241_1153553253 13 Left 1153553241 18:6284537-6284559 CCACACCGCCGCAGCGCCGCCAC No data
Right 1153553253 18:6284573-6284595 CACTGGCCGGCTGCGCACGCAGG No data
1153553244_1153553253 5 Left 1153553244 18:6284545-6284567 CCGCAGCGCCGCCACCTTGGAGG No data
Right 1153553253 18:6284573-6284595 CACTGGCCGGCTGCGCACGCAGG No data
1153553251_1153553253 -9 Left 1153553251 18:6284559-6284581 CCTTGGAGGGGACGCACTGGCCG No data
Right 1153553253 18:6284573-6284595 CACTGGCCGGCTGCGCACGCAGG No data
1153553249_1153553253 -6 Left 1153553249 18:6284556-6284578 CCACCTTGGAGGGGACGCACTGG No data
Right 1153553253 18:6284573-6284595 CACTGGCCGGCTGCGCACGCAGG No data
1153553238_1153553253 26 Left 1153553238 18:6284524-6284546 CCCTCGCTGGCTCCCACACCGCC No data
Right 1153553253 18:6284573-6284595 CACTGGCCGGCTGCGCACGCAGG No data
1153553240_1153553253 14 Left 1153553240 18:6284536-6284558 CCCACACCGCCGCAGCGCCGCCA No data
Right 1153553253 18:6284573-6284595 CACTGGCCGGCTGCGCACGCAGG No data
1153553242_1153553253 8 Left 1153553242 18:6284542-6284564 CCGCCGCAGCGCCGCCACCTTGG No data
Right 1153553253 18:6284573-6284595 CACTGGCCGGCTGCGCACGCAGG No data
1153553239_1153553253 25 Left 1153553239 18:6284525-6284547 CCTCGCTGGCTCCCACACCGCCG No data
Right 1153553253 18:6284573-6284595 CACTGGCCGGCTGCGCACGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153553253 Original CRISPR CACTGGCCGGCTGCGCACGC AGG Intronic