ID: 1153553255

View in Genome Browser
Species Human (GRCh38)
Location 18:6284591-6284613
Sequence GCAGGCTGTTCCCAAGCCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153553242_1153553255 26 Left 1153553242 18:6284542-6284564 CCGCCGCAGCGCCGCCACCTTGG No data
Right 1153553255 18:6284591-6284613 GCAGGCTGTTCCCAAGCCCCCGG No data
1153553251_1153553255 9 Left 1153553251 18:6284559-6284581 CCTTGGAGGGGACGCACTGGCCG No data
Right 1153553255 18:6284591-6284613 GCAGGCTGTTCCCAAGCCCCCGG No data
1153553249_1153553255 12 Left 1153553249 18:6284556-6284578 CCACCTTGGAGGGGACGCACTGG No data
Right 1153553255 18:6284591-6284613 GCAGGCTGTTCCCAAGCCCCCGG No data
1153553248_1153553255 15 Left 1153553248 18:6284553-6284575 CCGCCACCTTGGAGGGGACGCAC No data
Right 1153553255 18:6284591-6284613 GCAGGCTGTTCCCAAGCCCCCGG No data
1153553244_1153553255 23 Left 1153553244 18:6284545-6284567 CCGCAGCGCCGCCACCTTGGAGG No data
Right 1153553255 18:6284591-6284613 GCAGGCTGTTCCCAAGCCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153553255 Original CRISPR GCAGGCTGTTCCCAAGCCCC CGG Intronic