ID: 1153553262 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 18:6284612-6284634 |
| Sequence | GGTCGCTTTTCTTCCACATC AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1153553251_1153553262 | 30 | Left | 1153553251 | 18:6284559-6284581 | CCTTGGAGGGGACGCACTGGCCG | No data | ||
| Right | 1153553262 | 18:6284612-6284634 | GGTCGCTTTTCTTCCACATCAGG | No data | ||||
| 1153553254_1153553262 | 10 | Left | 1153553254 | 18:6284579-6284601 | CCGGCTGCGCACGCAGGCTGTTC | No data | ||
| Right | 1153553262 | 18:6284612-6284634 | GGTCGCTTTTCTTCCACATCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1153553262 | Original CRISPR | GGTCGCTTTTCTTCCACATC AGG | Intronic | ||