ID: 1153553262

View in Genome Browser
Species Human (GRCh38)
Location 18:6284612-6284634
Sequence GGTCGCTTTTCTTCCACATC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153553251_1153553262 30 Left 1153553251 18:6284559-6284581 CCTTGGAGGGGACGCACTGGCCG No data
Right 1153553262 18:6284612-6284634 GGTCGCTTTTCTTCCACATCAGG No data
1153553254_1153553262 10 Left 1153553254 18:6284579-6284601 CCGGCTGCGCACGCAGGCTGTTC No data
Right 1153553262 18:6284612-6284634 GGTCGCTTTTCTTCCACATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153553262 Original CRISPR GGTCGCTTTTCTTCCACATC AGG Intronic