ID: 1153557725

View in Genome Browser
Species Human (GRCh38)
Location 18:6333617-6333639
Sequence ATGGAGAAGCAGGATGCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 581
Summary {0: 1, 1: 0, 2: 1, 3: 38, 4: 541}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153557721_1153557725 3 Left 1153557721 18:6333591-6333613 CCTAATTGTTTATGAATAAGATT 0: 1
1: 0
2: 0
3: 37
4: 403
Right 1153557725 18:6333617-6333639 ATGGAGAAGCAGGATGCAGGTGG 0: 1
1: 0
2: 1
3: 38
4: 541
1153557720_1153557725 27 Left 1153557720 18:6333567-6333589 CCATCTCAAAAAAAAAAAAAAAA 0: 83672
1: 60776
2: 74199
3: 114646
4: 163091
Right 1153557725 18:6333617-6333639 ATGGAGAAGCAGGATGCAGGTGG 0: 1
1: 0
2: 1
3: 38
4: 541

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153557725 Original CRISPR ATGGAGAAGCAGGATGCAGG TGG Intronic
900040533 1:458944-458966 CTAGAGAAGGAGGATGCAGCAGG - Intergenic
900061963 1:693915-693937 CTAGAGAAGGAGGATGCAGCAGG - Intergenic
900343943 1:2202135-2202157 TTGGAGAACCAGGCTCCAGGAGG + Intronic
900409822 1:2507469-2507491 AGGGAGAAGCTGGAGCCAGGGGG + Intergenic
900786675 1:4654373-4654395 ATGGGGAAGGGGGCTGCAGGAGG + Intergenic
901160687 1:7174705-7174727 GTGGACGAGCAGGAGGCAGGTGG + Intronic
901411643 1:9088342-9088364 GTGGAGAAGGAGGAGGGAGGGGG - Intronic
901536144 1:9883987-9884009 ATGGGGAAGGAGGAAGGAGGAGG + Intronic
901640117 1:10688855-10688877 AGGGAGAAGCTGGGAGCAGGAGG - Intronic
902091935 1:13910536-13910558 ATGGTGAAGCAGGAGCAAGGTGG - Intergenic
902344867 1:15809021-15809043 ATGGAGTGGGAGGGTGCAGGAGG + Intergenic
902404762 1:16176566-16176588 TTGGAGGAGGAGGATGGAGGAGG - Intergenic
902539000 1:17139067-17139089 AGGGAGAAGAAGGCTGCTGGGGG + Intergenic
903249400 1:22041665-22041687 ATGGAAAAGCAGGATGCTCAGGG - Intergenic
903471458 1:23590546-23590568 ATGGAGAAGCAGGGAGGAGGAGG + Intronic
903664095 1:24996159-24996181 AGGGAGGAGCAGCATGGAGGGGG - Intergenic
904047726 1:27618720-27618742 ATAGAGAGGCTGCATGCAGGTGG - Intronic
904855069 1:33491567-33491589 ATGGATGAGCAGGAGGAAGGGGG + Exonic
904956334 1:34287121-34287143 ATGGAGAGGCAGGATGCATGGGG + Intergenic
905025232 1:34845138-34845160 AGGGAGATGTAGGATGCTGGGGG + Intronic
905281415 1:36851812-36851834 TTGGAGAAGGATGTTGCAGGTGG + Intronic
905343744 1:37297289-37297311 ATGGAGCAAGAGGAAGCAGGTGG - Intergenic
905872900 1:41415251-41415273 AGGGAGAAGCAGGAAGGTGGAGG - Intergenic
905915073 1:41678914-41678936 AGGGAGAAGAAGGATTCATGGGG + Intronic
905917445 1:41695516-41695538 ATGGAGCTGCATGAAGCAGGAGG - Intronic
907417391 1:54323886-54323908 ATGTACAAGCAGAATGCAGCAGG + Intronic
908432383 1:64071816-64071838 ATGGAGAAGCAGGGTTCTGTGGG + Intronic
908498288 1:64717320-64717342 ATGAAGAAACAGGATGAAAGAGG - Intergenic
910373483 1:86543521-86543543 AGGGAGAAGCAGGGAGCAGGAGG + Intergenic
911063060 1:93764335-93764357 ATGGAGAAAGAGGATGAAGGAGG - Intronic
911068158 1:93810560-93810582 ATGGAGAAGGATGATGCTGCAGG - Intronic
911647691 1:100353157-100353179 AAAGAGAAGCCGGAAGCAGGGGG - Intronic
912348310 1:108987130-108987152 CAGGAGAAGCTGGCTGCAGGAGG - Intronic
912451293 1:109769204-109769226 ATGGAGACTTAGGCTGCAGGTGG + Intronic
912474330 1:109925922-109925944 AGGGAGGAGCAGTATGGAGGGGG - Intronic
912844204 1:113064403-113064425 AGGCAGAAGCAGGAGGCAGGAGG + Intergenic
912972141 1:114293630-114293652 AAGGAGCAGCAGGATCCAAGGGG + Intergenic
915839188 1:159201640-159201662 TTGGAGAGGAAGGATGGAGGTGG + Exonic
916611547 1:166396725-166396747 ATGGTGAAGCAGGATGGGAGGGG + Intergenic
916965676 1:169939942-169939964 ATTGAGAAACAGGAAGCAGTTGG + Intronic
917535174 1:175869311-175869333 GGGGAGAAGCAGGTGGCAGGGGG - Intergenic
918552934 1:185764989-185765011 GTGGTGCAGCAGGATGCAGGAGG - Intronic
918716046 1:187788296-187788318 CTGGAGAAATAGGAAGCAGGCGG - Intergenic
920226640 1:204443814-204443836 AAGGAGAAACAAGATGCAGAGGG - Intronic
921213943 1:212921657-212921679 CTGGAGAAGAAGGAGACAGGAGG + Intergenic
921298184 1:213724025-213724047 GAGCAGAAGCAGGATGCAGTAGG + Intergenic
922307476 1:224356912-224356934 ACGGAGGAGGAGGATGGAGGCGG + Exonic
922615503 1:226958858-226958880 ATGGAGCAGCAGGAAGAAGTAGG + Intronic
922722596 1:227906380-227906402 ATGGAGTAGGAGGAGGGAGGAGG - Intergenic
922722648 1:227906528-227906550 ATGGAGCAGGAGGAGGGAGGAGG - Intergenic
922970440 1:229731900-229731922 ATGGAGAAGCAGAATTTGGGAGG - Intergenic
923216816 1:231856266-231856288 ATGAAGAGGCAGGAAGAAGGTGG + Intronic
923629956 1:235643142-235643164 AGGCAGAAGCAGGAAGCAGCAGG - Intronic
924536169 1:244937523-244937545 GTGGAGAAGCTGGATTCAAGTGG - Intergenic
1063718438 10:8553716-8553738 ATGGAGAAGAAGAATTCGGGTGG + Intergenic
1063720731 10:8578957-8578979 TTGGTGAAGAAGAATGCAGGTGG + Intergenic
1064636260 10:17370984-17371006 ATCCAGCAGCAGGATGAAGGTGG + Intronic
1064731377 10:18334402-18334424 CTGGAGAGGCAAAATGCAGGAGG - Intronic
1065426316 10:25608006-25608028 CTGTAGAAGCAGAATGCAAGGGG - Intergenic
1066336116 10:34480219-34480241 AAGGAGAAGCAAGGTGCAGTAGG - Intronic
1068110799 10:52678594-52678616 ATGGAATAGCAGGATGAATGTGG + Intergenic
1068285172 10:54924142-54924164 ATGGTGAAGCAGGAAGTGGGGGG + Intronic
1069679972 10:70277492-70277514 ATGGAGAAGCAGCATCCATCTGG + Intronic
1071137220 10:82466634-82466656 ATGGAGATCCAGCAGGCAGGTGG + Intronic
1071466168 10:85941907-85941929 AGGGAGAAGTAGGAGACAGGAGG - Intronic
1071718445 10:88120006-88120028 AGGGGGAAGCAGGAAGGAGGGGG + Intergenic
1072546783 10:96446177-96446199 ATGGAGAAGAAAGAGGCATGAGG + Intronic
1072554084 10:96501440-96501462 CTGTAGAAGCAGGAAGCAGGAGG - Intronic
1072577520 10:96713796-96713818 CTGGTGAGGCAGGATCCAGGGGG - Intronic
1072930277 10:99656435-99656457 ATGGAGAATATGGATGGAGGAGG + Intergenic
1072979157 10:100085361-100085383 ACGGAGCAGCAGGATGCAAGGGG - Intergenic
1074298087 10:112209587-112209609 ATGAAGCAGCAGCAGGCAGGAGG - Intronic
1075352402 10:121735384-121735406 ATGCAGAAGAATGATGCAGAAGG + Intergenic
1075705516 10:124497909-124497931 TTGAAGAAGCAGGATGCTGTGGG - Intronic
1075930662 10:126292570-126292592 ATGGAGGAAGAGGAGGCAGGTGG - Intronic
1076966806 11:95167-95189 CTAGAGAAGGAGGATGCAGCAGG - Intergenic
1077096630 11:801787-801809 ACAGGGAAGCAGGATCCAGGAGG + Intronic
1077096648 11:801839-801861 ATAGGGAAGCAGGATCCAGGAGG + Intronic
1077352377 11:2098927-2098949 GTGGAGGGGCAGGATCCAGGAGG - Intergenic
1077700140 11:4433682-4433704 ATGTAGGAGCAGGAAGGAGGAGG + Intergenic
1078022992 11:7670991-7671013 AGGGAGGAGGAGGAGGCAGGAGG + Intronic
1078063824 11:8065001-8065023 ATGTTGAAGCAGGATGCTAGGGG + Intronic
1078087214 11:8241277-8241299 GTGGAAATGCAAGATGCAGGTGG - Intronic
1078355162 11:10627510-10627532 GTGGGGAGGCAGGATTCAGGGGG - Intronic
1078453203 11:11455522-11455544 AAGAAGAACCAGGATGCAGGAGG + Intronic
1079523491 11:21356808-21356830 TTGGGGATGCAGGATGAAGGAGG - Intronic
1080237903 11:30092878-30092900 AAGGAGAAGGAGGAAGGAGGAGG - Intergenic
1080436597 11:32250366-32250388 ATGGAGAAGCAGGTTCAGGGAGG - Intergenic
1081719197 11:45274577-45274599 TCTGAGAAGCAGGGTGCAGGGGG + Intronic
1083271180 11:61573347-61573369 AGGGGGTAGCCGGATGCAGGTGG - Intronic
1083616368 11:64028485-64028507 AGGAAGGAGCAGGAGGCAGGAGG + Intronic
1084314629 11:68337931-68337953 ATGGATAAGCTGACTGCAGGTGG - Intronic
1084362517 11:68677941-68677963 TTGGAGAAAGAAGATGCAGGTGG + Intergenic
1084468452 11:69341066-69341088 ATGGAGAAGCACGTTGGAGAAGG + Intronic
1084472141 11:69368770-69368792 AGGGGGAAGAGGGATGCAGGAGG - Intergenic
1084529303 11:69717582-69717604 AGGGAGAGGCAGGAAGGAGGAGG - Intergenic
1085476843 11:76794431-76794453 GTGGAGAGGCAGGGTGCAGGAGG - Intronic
1086329762 11:85742187-85742209 ATGGAGAACTAGACTGCAGGAGG - Intronic
1088689313 11:112311668-112311690 ATAGACCAGCAGGATGCTGGAGG + Intergenic
1088710972 11:112508239-112508261 ATGGAGAAGCTGGATCCTGAGGG + Intergenic
1088916361 11:114230904-114230926 AGGCAGAGGCAGGAGGCAGGAGG - Intronic
1088973628 11:114795326-114795348 ATAGGGAAGCTGAATGCAGGAGG - Intergenic
1089070519 11:115696109-115696131 ATGTAGGAGCAGGAGCCAGGGGG + Intergenic
1089129605 11:116201298-116201320 ATGGAGAAGCAGGATTGCTGCGG + Intergenic
1089538111 11:119173045-119173067 AAGGAGAAGCAGGGTGAGGGAGG + Intronic
1089760221 11:120717659-120717681 TTGGTGATGCAGGAAGCAGGAGG - Intronic
1090007731 11:123017642-123017664 GTGGAGAAGGAGGAGGCTGGAGG + Intergenic
1090042697 11:123304556-123304578 ATGGAGGAGAAGGATGGAGAGGG + Intergenic
1090234028 11:125133214-125133236 GGGGAGAGGCGGGATGCAGGGGG + Intergenic
1090664992 11:128909019-128909041 ATGAAGGAGCAGGAAGCAGGTGG + Intronic
1091363974 11:135001661-135001683 ACGGAGAAGCAGGAAGGAGAGGG + Intergenic
1091591408 12:1845070-1845092 AGGGAGAAGCAGGGTGGGGGTGG + Intronic
1091998215 12:5011849-5011871 ATGGAGAAGCAGAATCAAAGAGG + Intergenic
1092100990 12:5883614-5883636 ATGGAGAAGCAGGGTGTGGAGGG + Intronic
1092902843 12:13076070-13076092 AGGGGAACGCAGGATGCAGGAGG - Exonic
1092931525 12:13320257-13320279 ATGGGGAAGGAGGGAGCAGGAGG + Intergenic
1093023007 12:14220312-14220334 ATTGAGAGTCAGGATGCAGAGGG - Intergenic
1095153484 12:38823572-38823594 AGGGAGAAGCAGGATACAATGGG - Intronic
1095714152 12:45323419-45323441 GAGAAGAAGCAAGATGCAGGTGG + Intronic
1096639292 12:52981406-52981428 CTGGAGAAGCATTGTGCAGGAGG - Intergenic
1096964121 12:55611495-55611517 ATGGGGAAGCAGCAGGGAGGGGG + Intergenic
1097627332 12:62016579-62016601 ATTTAGAATCAAGATGCAGGTGG + Intronic
1098098956 12:66992289-66992311 ATGAAGAAGCAGGCTGCATTTGG + Intergenic
1100772288 12:97936685-97936707 ATGGGCAAGCAGCATGCATGGGG - Intergenic
1101046323 12:100810103-100810125 ATGATGAAGCAGAATGCAGCAGG + Intronic
1101881723 12:108630266-108630288 GTGGAGGAGCAGGCTGCAGGGGG + Intronic
1102587549 12:113933637-113933659 ATGTAGACCCAGGAAGCAGGGGG + Intronic
1102589243 12:113945240-113945262 ATGGAGGAGCTGGATGGATGGGG + Intronic
1103282518 12:119771689-119771711 AAGGAGAAGCTGGAGGCAGATGG + Intronic
1103637877 12:122323392-122323414 ATGCAGAAGCTGGATGCACTCGG + Intronic
1103858857 12:123995550-123995572 TTGGAGAAGGAGAATGGAGGTGG + Intronic
1104087992 12:125493429-125493451 GTGGAGACAGAGGATGCAGGGGG + Intronic
1105814293 13:24020106-24020128 AGGGAGAAGCTGTATGCAGCTGG - Intronic
1106372897 13:29153718-29153740 GAGGAAAAGAAGGATGCAGGAGG - Intronic
1106799083 13:33237553-33237575 CTGGAGAAGCAAGATGCTGGAGG - Intronic
1108042156 13:46349203-46349225 ATGGGGGAGCCAGATGCAGGAGG + Intronic
1108571026 13:51751401-51751423 GTGGAGAGGCAGGAGGTAGGTGG + Exonic
1109220246 13:59634166-59634188 ATGGAGAGGCCGGCAGCAGGCGG + Intergenic
1111208651 13:85047311-85047333 ATGGAGAAGAATGATGATGGAGG + Intergenic
1113142908 13:107174754-107174776 AGGGAGAAGCAGGATGTGGCTGG + Intronic
1113274974 13:108718525-108718547 ATGCAGCAGCAGGAAGCAGAAGG + Intronic
1113704934 13:112424059-112424081 CAGGAGAAGCAAGATGCAGGAGG + Intronic
1113930724 13:113967600-113967622 ATGTAGGAGAAGGATGTAGGAGG + Intergenic
1113933452 13:113980860-113980882 AGGGAGAAGAAGGGTGGAGGAGG + Intronic
1114563154 14:23607873-23607895 ATGGAGAAACAGGTGGCAGCTGG - Intergenic
1115050766 14:29059935-29059957 ATGGAGAAGCTTGAAGAAGGAGG + Intergenic
1115167462 14:30464876-30464898 AAGGAGGGGCAGGAGGCAGGAGG + Intergenic
1115246541 14:31301593-31301615 AGGCAGAGGCAGGAGGCAGGAGG - Intronic
1115957474 14:38797615-38797637 CTGGAGAAGCAGGTAGCATGGGG - Intergenic
1118604843 14:67495268-67495290 ATGGAGAAGCAAGAAAAAGGAGG - Intronic
1119557043 14:75561202-75561224 CTGGGAAAGGAGGATGCAGGAGG - Intergenic
1119888215 14:78162260-78162282 CTGGAGAAGGAGGGTGCAGATGG + Intergenic
1120930739 14:89845761-89845783 AGGGAGAAGCAGGCTGAAGATGG + Intronic
1121742531 14:96264242-96264264 GGGGAGGAGCAGGATGCAGGCGG - Exonic
1121817353 14:96938835-96938857 ATGGACCAGCAGGATGGGGGTGG - Intergenic
1121928067 14:97947410-97947432 ATGGAATGGCAGGAGGCAGGGGG - Intronic
1122131894 14:99609069-99609091 ATGGAAAAGCCTGAAGCAGGAGG - Intergenic
1122198999 14:100110702-100110724 TGGCAGCAGCAGGATGCAGGTGG - Intronic
1122378885 14:101287454-101287476 ATGTAAAAGAAGGAGGCAGGAGG + Intergenic
1122811208 14:104290242-104290264 AAGCAGCAGCAGGAAGCAGGAGG - Intergenic
1122916200 14:104860122-104860144 ATGGAGATGGAGGATGGAGATGG - Intergenic
1202844535 14_GL000009v2_random:156042-156064 AAGAAGAAGCAGGAAGCTGGGGG - Intergenic
1202913926 14_GL000194v1_random:146283-146305 AAGAAGAAGCAGGAAGCTGGGGG - Intergenic
1202878728 14_KI270722v1_random:36419-36441 AAGAAGAAGCAGGAAGCTGGGGG + Intergenic
1123773031 15:23548288-23548310 AGGGACAAGCAGGAGGCAGAGGG - Intergenic
1124992742 15:34692028-34692050 AAAGAGAAGCAGGAGACAGGAGG + Intergenic
1125227629 15:37413042-37413064 ATTGAGAAGCAGGCAGAAGGGGG - Intergenic
1125377585 15:39047623-39047645 AAAGAGAAAAAGGATGCAGGAGG + Intergenic
1125385311 15:39130676-39130698 ATGAAGAAACAGGAAGCAGCTGG + Intergenic
1126106301 15:45149070-45149092 ATGGGCAAGCAGCAGGCAGGAGG + Intronic
1127066056 15:55239988-55240010 ATGGACTTGCAGGATGGAGGTGG - Intronic
1127834094 15:62776052-62776074 AAGTAGCAGCAAGATGCAGGGGG - Intronic
1128089830 15:64911918-64911940 GCGGAGCGGCAGGATGCAGGAGG + Exonic
1129232253 15:74203315-74203337 CAGGAGGAGCAGGAGGCAGGCGG - Intronic
1129458620 15:75688909-75688931 CTGCAGAAGCAGGGGGCAGGTGG - Exonic
1129651807 15:77496433-77496455 AAGGAGAAACTGGATGGAGGAGG - Intergenic
1129725172 15:77897963-77897985 CTGAAGAAGCAGGGGGCAGGTGG + Intergenic
1130550324 15:84886492-84886514 ATGGAGAAGCAGCAGCCAGTGGG + Intronic
1131437541 15:92435407-92435429 CTGCAGGAGCAGGAAGCAGGAGG + Intronic
1131461957 15:92623729-92623751 ACGGAGAAGCCGGAGGGAGGAGG + Intronic
1132276497 15:100569518-100569540 AAGGAGATTCAGGATGCAGCTGG - Exonic
1132441373 15:101868679-101868701 CTAGAGAAGGAGGATGCAGCAGG + Intergenic
1132783041 16:1638945-1638967 CTGGAGAGGCAGGCTGGAGGAGG - Intronic
1133915986 16:10110461-10110483 ATGGAGAAGCAAGTGGCAAGGGG + Intronic
1133965743 16:10530511-10530533 ATGTTGGAGCAGGATGCTGGGGG - Exonic
1133967665 16:10543363-10543385 GTGGAGAAGCCGGAGGCTGGAGG - Intronic
1134227747 16:12404494-12404516 CAGGAGAAGCAGGAAGCAGCTGG - Intronic
1136539105 16:30918737-30918759 AAGGAGAAGAAGGAAGGAGGAGG - Intergenic
1136540758 16:30926567-30926589 AGGGGGACGCAGGATGCAGCTGG - Intronic
1136544853 16:30949168-30949190 CAGGACGAGCAGGATGCAGGCGG - Exonic
1137379751 16:47986401-47986423 GTGGGGAAGCAGGATGTAGTAGG + Intergenic
1137627186 16:49916618-49916640 ATGGAGAACCAGGAGGCTGCTGG - Intergenic
1138126165 16:54440468-54440490 ATGGAGGAGGAGGAGGAAGGAGG - Intergenic
1139228776 16:65260269-65260291 ATGGAGGAACAGGAGGCAGCAGG - Intergenic
1141202813 16:81910732-81910754 AGGGTGGAGCAGGAGGCAGGCGG + Intronic
1141535576 16:84677564-84677586 ATGCAGCAGCAGGAGGCAGCAGG + Intergenic
1141743571 16:85910756-85910778 ATGGGGAAGTAGGGAGCAGGTGG - Intronic
1142654976 17:1385653-1385675 AGGAAGACGGAGGATGCAGGTGG + Intronic
1142782778 17:2194134-2194156 ATGGAGTTGGTGGATGCAGGGGG + Intronic
1143057400 17:4172564-4172586 CTGGACAAGCCGGATGCAGACGG - Exonic
1143150157 17:4802555-4802577 ATGGAGAAGCAGGAGGTGGTTGG + Intergenic
1143449895 17:7029847-7029869 TCAGAGCAGCAGGATGCAGGTGG - Intronic
1143532905 17:7516072-7516094 CTGGAGAACCAGGAAGCTGGTGG + Intergenic
1143622178 17:8087009-8087031 ATGAAGGAGCAGGATGGAGAAGG + Intronic
1144403888 17:14933815-14933837 ATGGAGAAGCTGTATCCAGATGG - Intergenic
1147971675 17:44221562-44221584 GGAGAGAAGCAGGAGGCAGGAGG - Exonic
1148137097 17:45300562-45300584 AAGGACAAGCAGGATGTATGGGG - Intronic
1148283041 17:46363764-46363786 ATGGAGAAACAGGTAGGAGGTGG - Intergenic
1148305258 17:46581689-46581711 ATGGAGAAACAGGTAGGAGGTGG - Intergenic
1148795322 17:50194215-50194237 GGGGAGAAGCATGATGGAGGTGG + Intronic
1151401702 17:73859909-73859931 ATGCAGAAGAAAAATGCAGGAGG - Intergenic
1151492495 17:74440809-74440831 ATGGATGAGCCGGTTGCAGGTGG + Exonic
1151580917 17:74978149-74978171 ATGGAGAGGAAGCAGGCAGGTGG + Intergenic
1152437098 17:80283167-80283189 ATGGAAAAGCAGACAGCAGGAGG + Intronic
1152694833 17:81738871-81738893 ATGGAGATGGAGGATGCTGGAGG - Intergenic
1153396716 18:4630306-4630328 ATGCAGAAGCTGGAAGCAGAAGG + Intergenic
1153557725 18:6333617-6333639 ATGGAGAAGCAGGATGCAGGTGG + Intronic
1153930094 18:9870623-9870645 CTGGAGAAGGAGGGTCCAGGAGG - Intergenic
1154056329 18:11016058-11016080 ATGGAGAAGGAGGAAGAATGAGG - Intronic
1155066536 18:22273762-22273784 ATGGAGGAGGAGGAGGGAGGAGG - Intergenic
1155066544 18:22273785-22273807 ATGGAGGAGGAGGAGGGAGGAGG - Intergenic
1155541405 18:26872384-26872406 ATGGAGAACCAGTTTGCAAGTGG + Intergenic
1156896907 18:42256649-42256671 GTGGGGAAGGAGCATGCAGGTGG + Intergenic
1157176530 18:45457363-45457385 AGAGAGAAGCAACATGCAGGGGG + Intronic
1157194517 18:45609919-45609941 CTGGAGATGCAGGATGCAAATGG + Intronic
1157442843 18:47723512-47723534 ATGGAGAAGGAGGATGGAGCTGG - Intergenic
1157744164 18:50120383-50120405 AAGGAGATGCAGGCAGCAGGAGG + Intronic
1157752161 18:50188945-50188967 ATGGTGAAGCAGGATCCACTGGG + Intronic
1157768664 18:50325135-50325157 AAGGAGAAGGAGGAGGAAGGAGG - Intergenic
1158030905 18:52963569-52963591 ATAGTGAAGCAGGATGAAGGTGG + Intronic
1159320769 18:66845050-66845072 ATAGGGAAGAAGGAAGCAGGGGG + Intergenic
1160308216 18:77761095-77761117 AAGGAGAAGCAGGCTGCAGCAGG - Intergenic
1160643609 19:164790-164812 CTAGAGAAGGAGGATGCAGCAGG - Intergenic
1160676460 19:393912-393934 ATGGAGAAGGATGATGGAGAAGG + Intergenic
1160695228 19:480651-480673 ATGGAGAAGGATGATGGAGAAGG + Intergenic
1160695243 19:480779-480801 ATGGAGAATGATGATGCAGAAGG + Intergenic
1160695347 19:481320-481342 ATGGAGAAGGATGATGGAGAAGG + Intergenic
1160739138 19:677825-677847 CTGGAGCACCAGGCTGCAGGTGG - Exonic
1160941388 19:1621909-1621931 GAGGAGAAGGAGGATGCAGATGG + Exonic
1160950836 19:1666515-1666537 AAGGAGAAGAAGGAAGAAGGAGG - Intergenic
1160972231 19:1774726-1774748 ATGGAGAAGGGGGCTGGAGGGGG + Intronic
1162376023 19:10305745-10305767 ATGGGGAAGCAAGATGGAGAAGG + Intronic
1162462151 19:10819653-10819675 AGGGAAAAGGAGGATGGAGGTGG + Intronic
1162523704 19:11195931-11195953 ATGGAGAAGCAGGGAGCAAGCGG + Intronic
1162526379 19:11209154-11209176 ATGGACAAGTGGGAGGCAGGTGG - Intronic
1162930026 19:13952938-13952960 AGGGAGAATCAGGAGGAAGGGGG + Intronic
1163469603 19:17488763-17488785 ATGGGGAAGCATGCTGCATGTGG - Intronic
1164201480 19:23022501-23022523 AAGGAGAAGCAGGTCACAGGAGG - Intergenic
1164741151 19:30576393-30576415 CTGGAGAAGGAGGACCCAGGTGG - Intronic
1165354174 19:35293623-35293645 ATGGAGCAGCAGGGTGCCAGGGG + Intronic
1165416029 19:35694079-35694101 AGGGAGAAGGAGGAGGGAGGAGG - Intergenic
1165834256 19:38744593-38744615 ATGGAGAAGAAACATGAAGGCGG - Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166195623 19:41203808-41203830 AAGGAGAAGAAAGATGCAGGGGG - Intronic
1166901534 19:46067672-46067694 ATGAACAAGCAGAATGGAGGAGG + Intronic
1167058851 19:47130934-47130956 GTGGAGAAGGAGGAGGCTGGCGG + Exonic
1167145070 19:47676492-47676514 AGGGAGAAGGAGGAAGGAGGTGG - Intronic
1167418652 19:49390234-49390256 AAGCCGAAGCAGGATGCAGGAGG + Intronic
1167796158 19:51710471-51710493 ATGGAGGAGCAGGTTTCACGGGG + Intergenic
1168329599 19:55559599-55559621 ATGGGGAAGCAGGGAGCTGGAGG + Intergenic
1202654351 1_KI270708v1_random:5453-5475 AAGAAGAAGCAGGAAGCTGGGGG + Intergenic
925783595 2:7406611-7406633 AGGGAGAAGCAGAGCGCAGGAGG - Intergenic
926105376 2:10146492-10146514 ATGGACCAGCAGGTGGCAGGTGG - Intronic
926366477 2:12138434-12138456 ATGGAGAAGTAGGCTTCAGAAGG - Intergenic
926394848 2:12430406-12430428 AAGGAGAAGAAGGAGGAAGGAGG + Intergenic
926671029 2:15576989-15577011 ATGGAAATGCAGGATGGATGTGG - Intergenic
927131946 2:20067832-20067854 CTGGAGCAGGAGGAAGCAGGGGG - Intergenic
927354119 2:22153348-22153370 TTGGAGATGCTGGATGAAGGAGG + Intergenic
927842540 2:26454806-26454828 ATGGAGCAGGAGGGTGCTGGCGG + Intronic
928215071 2:29354555-29354577 ATTGAGAAGAAGGATGAAGAAGG - Intronic
928826437 2:35427027-35427049 GAGGAGAAGGAGGAGGCAGGAGG + Intergenic
929508772 2:42550496-42550518 ATGGAGCAGCAGAAGGAAGGAGG + Intronic
931366644 2:61624986-61625008 CTGGAGAAGCAGGTTTGAGGTGG - Intergenic
931634549 2:64329748-64329770 ATGGGGCAGCAGGCTGCAGTGGG - Intergenic
931752394 2:65341352-65341374 ATGGAGAAACATGATGGGGGAGG + Intronic
932599044 2:73111831-73111853 ACGTAGAAGCTGGCTGCAGGGGG - Intronic
933201973 2:79461509-79461531 TTGAAGAAGCAGGAACCAGGTGG + Intronic
933855709 2:86412257-86412279 AGGGAGAAGAAGGAAGAAGGAGG - Intergenic
934695830 2:96399630-96399652 AGGCAGAAGGAGGATGCAGGAGG - Intergenic
934964953 2:98713110-98713132 CTGGAGATGGAGGATGCAGTGGG + Intronic
935294239 2:101634951-101634973 CTGGGGAAGGAGGAGGCAGGTGG - Intergenic
935315509 2:101829783-101829805 ATAGAGAACCAGGGGGCAGGGGG - Intronic
935473302 2:103485673-103485695 ATAGAGAAACAGGAGGCATGTGG + Intergenic
935660221 2:105460464-105460486 ATGGAGAAGAAAAATGTAGGAGG + Intergenic
935672735 2:105569849-105569871 AGTGAGGAGCAGGATGCAGAAGG + Intergenic
935679627 2:105624750-105624772 AGGGACAAGAAGGAGGCAGGGGG - Intergenic
937019297 2:118635532-118635554 ATGGAGAGACTAGATGCAGGAGG - Intergenic
937516490 2:122661400-122661422 AGGGAGCAGCCAGATGCAGGAGG - Intergenic
937856864 2:126678611-126678633 GTGCAGGAGCAGGATGCAGGGGG - Intronic
938653304 2:133406344-133406366 ATGCAGAAGTAGGCTGCAGGGGG + Intronic
939895289 2:147784251-147784273 ATGGAGAGTCAGGTGGCAGGAGG + Intergenic
940261584 2:151785435-151785457 ATGGGAAAGAAGGAGGCAGGAGG + Intergenic
940317077 2:152336503-152336525 TGGGAGAAGCGGAATGCAGGAGG - Intronic
941399801 2:165016712-165016734 ATGGAGAAGCAGGATTTAATTGG - Intergenic
941911737 2:170770933-170770955 ACGGAGAGGCAGGGTGGAGGCGG - Intergenic
942087590 2:172457889-172457911 ATGAAGAAGCAGAAAGCAGATGG + Intronic
943662148 2:190570597-190570619 ATGGAGCAACAGGATGGAGGAGG + Intergenic
944064703 2:195606631-195606653 ATGGAGAAGCAGGAACAAGAAGG + Intronic
944912799 2:204326928-204326950 AAGGACAAGCAGGATGAATGAGG + Intergenic
946773920 2:223117877-223117899 ATGGAGACACAGGAAGAAGGAGG + Intronic
947594082 2:231399932-231399954 CTGGAGAAGCAGGGTGCGGTGGG - Exonic
947841337 2:233209654-233209676 ATGGAAATGCAGGAAGGAGGAGG - Intergenic
948023634 2:234758201-234758223 ATGGGGAAGAAGGAGGGAGGCGG - Intergenic
948260282 2:236599253-236599275 AGAGAGAAGCAGGCTGCAGTTGG - Intergenic
948332716 2:237182835-237182857 ATGGGGAAGCTGTATGCAGCTGG + Intergenic
948458459 2:238118099-238118121 ATGGAGGAGTTGGATGGAGGAGG + Intronic
948458524 2:238118324-238118346 GTGGAGAAGGTGGATGGAGGAGG + Intronic
948458787 2:238119320-238119342 ATGGAGGAGGTGGATGGAGGAGG + Intronic
948458798 2:238119373-238119395 ATGAAGGAGTTGGATGCAGGAGG + Intronic
948458806 2:238119399-238119421 ATGGAGGAGGTGGATGGAGGAGG + Intronic
948458827 2:238119474-238119496 ATGGAGGAGGTGGATGGAGGAGG + Intronic
948458831 2:238119487-238119509 ATGGAGGAGGTGGATGGAGGAGG + Intronic
948458845 2:238119527-238119549 ATGGAGGAGGTGGATGGAGGAGG + Intronic
948458848 2:238119540-238119562 ATGGAGGAGGTGGATGAAGGAGG + Intronic
948458856 2:238119568-238119590 ATGGAGGAGGTGGATGGAGGAGG + Intronic
948458860 2:238119581-238119603 ATGGAGGAGGTGGATGGAGGAGG + Intronic
948577651 2:238965004-238965026 AGGGGGAAGCAGGAGGGAGGAGG - Intergenic
1170134157 20:13054657-13054679 ATAGAGAAGCAAGATCCAGTTGG + Intronic
1170687684 20:18584326-18584348 ATGGTGGAGCAGGATGCTGCAGG + Intronic
1170907482 20:20528890-20528912 ATGGAGAAAGAGGAGGCAGTGGG - Intronic
1171209361 20:23304860-23304882 TTGGGGAGGCAGGATGCTGGTGG - Intergenic
1171311824 20:24150884-24150906 TGAGAGAAGCAGGAAGCAGGAGG + Intergenic
1172107869 20:32527529-32527551 AAGGAAAAGCAGGTTGAAGGGGG - Intronic
1172172401 20:32946286-32946308 AGGGAGAAGCTGGAAGCTGGTGG + Intronic
1173571297 20:44078190-44078212 AGGGGGAAGCAAGATGGAGGAGG - Intergenic
1173928450 20:46798505-46798527 AGAGAGAGGCAGGAGGCAGGAGG - Intergenic
1174183116 20:48687312-48687334 CGGGAGGAGCAGGCTGCAGGGGG - Intronic
1174396426 20:50249888-50249910 ATAGAGAAGCCGGAAGCAGGAGG - Intergenic
1174536467 20:51255100-51255122 ATGGAAAAGCTCGATGCAGCAGG - Intergenic
1175301627 20:57947272-57947294 AAGGAGAAGCAGCAAGCATGGGG + Intergenic
1175652345 20:60736254-60736276 ATGGAGGAACAGGAGGCAGGAGG - Intergenic
1176030438 20:63008800-63008822 ATGGAGCTGGAGAATGCAGGAGG + Intergenic
1176633281 21:9160958-9160980 AAGAAGAAGCAGGAAGCTGGGGG - Intergenic
1176717399 21:10364660-10364682 AAGGAGAAGCAGGAGGCAATGGG - Intergenic
1176781488 21:13200322-13200344 AAGGAGAAGAAGGAAACAGGAGG - Intergenic
1176963704 21:15188312-15188334 AGAGAGAAGCATGGTGCAGGCGG + Intergenic
1178400157 21:32278679-32278701 ACAGCGAAGCAGGATGCAGTTGG + Exonic
1179336818 21:40464279-40464301 ATGCAGGAGCAGGGAGCAGGTGG + Intronic
1180298625 22:11017580-11017602 AAGGAGAAGCAGGAGGCAATGGG - Intergenic
1180389144 22:12208972-12208994 AAGAAGAAGCAGGAAGCTGGGGG - Intergenic
1180416797 22:12725499-12725521 AAGAAGAAGCAGGAAGCTGGGGG + Intergenic
1180600944 22:17015333-17015355 AAGGAGAAGCAGGAGGCAATGGG + Intergenic
1180982737 22:19886495-19886517 TGTGAGCAGCAGGATGCAGGTGG + Intronic
1181167130 22:20989766-20989788 ATGGGGAGACAGGGTGCAGGTGG + Intronic
1182003613 22:26941027-26941049 AAGGAGAAGCAGGTTGAAAGAGG + Intergenic
1182051831 22:27318157-27318179 GAGGAGAAGCAGGAGGCGGGTGG + Intergenic
1182358230 22:29732164-29732186 CTGGAGAAGCAGCATGCGTGGGG - Intronic
1182519722 22:30878520-30878542 ATGGTTCCGCAGGATGCAGGAGG + Intronic
1182609749 22:31537294-31537316 AGGCAGAAGCAGAATGCAGTGGG - Intronic
1182755881 22:32678546-32678568 AAGGAGGAGGAGGATGAAGGAGG - Intronic
1183385433 22:37511460-37511482 AAGGAGAAGGAGGAGGCGGGAGG + Intronic
1183412823 22:37665522-37665544 ATGGAGACGCAGTCAGCAGGAGG - Intronic
1183708028 22:39487075-39487097 GCGGAGAAGCAGGCTGCAGAGGG + Intronic
1183718179 22:39546541-39546563 CTGGAGGGTCAGGATGCAGGGGG + Intergenic
1184723648 22:46330407-46330429 AAGGAGATGCAGGCTGCAGTGGG + Exonic
1184757687 22:46526161-46526183 ATGGAGGAGCAGGAGGCGGACGG - Intronic
1185150180 22:49159787-49159809 ATGGTGAAGCAGGAAGGATGGGG - Intergenic
949503555 3:4704910-4704932 ATTGAAAAGCAGGATGCACAGGG - Intronic
950008805 3:9707813-9707835 AAGGAGAAGCAAGTTGGAGGAGG + Intronic
950126474 3:10512953-10512975 ATGGAGAAGCAGGAAGCACATGG - Intronic
950569153 3:13789289-13789311 AAGCAGCAGCAGGATGCAAGTGG + Intergenic
950703265 3:14765082-14765104 ATGGACAAGGTGGATGCATGTGG + Intronic
950828202 3:15847776-15847798 AAGGTGAAGCTGGAGGCAGGTGG - Intronic
951884712 3:27513116-27513138 AGGGAGAAGGAAGAAGCAGGAGG + Intergenic
952321832 3:32284907-32284929 ATGCAGACGCAGGATTCATGTGG + Intronic
952482010 3:33771265-33771287 ATGGGGTTGCAGGAAGCAGGTGG + Intergenic
955663582 3:61327186-61327208 GTGGAGAAGCAGAAAGCTGGTGG + Intergenic
956250481 3:67229699-67229721 ATGGAGAAGAATCATCCAGGTGG + Intergenic
957261392 3:77906519-77906541 ATGGAGAAGGAGGCTGAAGAAGG + Intergenic
959407431 3:105977373-105977395 TTGGAGAAGCAGGAGGTAGATGG - Intergenic
959795881 3:110427863-110427885 ATGGAGAAGAAGGAGGCTGAGGG - Intergenic
960044872 3:113186899-113186921 ATGGAGGAGCAGGAGGCTGAGGG + Intergenic
960539409 3:118847253-118847275 ATTGAGAGTCAGGATGCAGAGGG - Intergenic
960547539 3:118933811-118933833 ATTGAGAAGCAGGAAGTAGAAGG - Intronic
960610500 3:119550936-119550958 AAAGAGTAGCAGGATGGAGGGGG - Intronic
961673822 3:128552909-128552931 ATGGAGCAGCAGGAAGGATGGGG + Intergenic
961724584 3:128918518-128918540 ATGGAGGAGGAACATGCAGGAGG + Intronic
961857794 3:129890348-129890370 ATGGATAGACAGGAAGCAGGTGG + Intronic
961884092 3:130084368-130084390 ATGGAGAGGAAGGAGACAGGAGG + Intronic
961966187 3:130905680-130905702 ATGATGAAACAGGATGTAGGAGG - Intronic
962141228 3:132792762-132792784 ACGAAGAATCAGGATGCAAGTGG - Intergenic
962210142 3:133470985-133471007 ATGGAGGAGCATGGTGCAGGTGG + Intronic
963975964 3:151480882-151480904 CTGGAGATGCAGGTTGCTGGGGG - Intergenic
964845409 3:161039405-161039427 ATGGGGAAGCAGTAAGGAGGGGG + Intronic
965460636 3:168957775-168957797 ATGTAGAAGAAGGATGCTTGGGG - Intergenic
966098451 3:176236298-176236320 ATGAAGAAGTAGAATGCAGTAGG + Intergenic
966831844 3:184017134-184017156 ACGGAGAGGCTGGAGGCAGGTGG - Intronic
967049260 3:185767189-185767211 CTGAAGAAACAGGCTGCAGGTGG - Intronic
967241023 3:187439685-187439707 GTGGAGATCCAGGAAGCAGGAGG + Intergenic
968478521 4:824062-824084 GTGGGAGAGCAGGATGCAGGTGG - Intronic
969632673 4:8347468-8347490 ATGGAGAAACAGGCAGCAGCTGG - Intergenic
970150592 4:13085547-13085569 ATGATGAGGCAGGAAGCAGGGGG - Intergenic
970167485 4:13254741-13254763 ATGCAGAGGCAGGAATCAGGTGG - Intergenic
971406489 4:26325299-26325321 ATGTAGAAGCTGGATAAAGGTGG - Intronic
971825880 4:31621998-31622020 ATGGGGGAGCAGAATGCTGGTGG - Intergenic
972156782 4:36172886-36172908 AAGGAGCAGCAGGATGGAGGTGG - Intronic
973771772 4:54213437-54213459 CTGGAGCTGCAGGGTGCAGGCGG + Intronic
974519100 4:62957865-62957887 ATGGAGAAGCAGATTGCAAATGG + Intergenic
974570413 4:63639311-63639333 ATGGATGAGCAAGATGCATGTGG + Intergenic
977818794 4:101447454-101447476 CTAGAGAAGCAGGATGCAGTAGG + Intronic
978404477 4:108364724-108364746 ATGGGGAAGCAGGAGGAGGGTGG - Intergenic
979025707 4:115571853-115571875 ATGGAGAAGAAGGATGTACATGG + Intergenic
980171292 4:129293185-129293207 CTGGACAAGAAGGATGCTGGTGG + Intergenic
980253291 4:130346056-130346078 GTGGAGAAGCATGAAGCATGAGG - Intergenic
984269542 4:177534208-177534230 CTGGAGAAGCAGGAGGGAGTAGG + Intergenic
985031392 4:185794260-185794282 ATGGAGAAGGAGGAGGAGGGAGG + Intronic
985327425 4:188787345-188787367 AAGGAAAAGAAGGAGGCAGGAGG - Intergenic
986522320 5:8633015-8633037 TTGGAGGAGGAGGATGAAGGGGG + Intergenic
986777608 5:11032142-11032164 ATGGAGAAGTAGGAAGCACCAGG - Intronic
986795306 5:11204413-11204435 ATGCAAAAGAAGGATGCAGTGGG + Intronic
987034566 5:14006886-14006908 AGGCAGCAGCAGGAGGCAGGAGG - Intergenic
987736283 5:21847587-21847609 ATGCAGAAGAAGGAAGCAGAAGG - Intronic
990258618 5:53997647-53997669 ATCCAGGAGCAGGATGAAGGAGG + Intronic
990994491 5:61717906-61717928 AAGGAGAAGCAGGTGGAAGGTGG - Intronic
990995190 5:61726220-61726242 ACGGAGAAGCAAAAGGCAGGAGG + Intronic
991985264 5:72278559-72278581 ATGAAGAAGCAGGATGGGGTTGG - Intronic
992016993 5:72585492-72585514 TGGGAGAACCAGTATGCAGGAGG - Intergenic
992199329 5:74368331-74368353 AAGGAGGAGGAGGAGGCAGGGGG + Intergenic
992366852 5:76101066-76101088 AGGGAGATGCAGGATGTATGAGG + Intronic
992735398 5:79714245-79714267 CAGGAAAACCAGGATGCAGGTGG - Intronic
994148753 5:96423821-96423843 ATGGAGAATCAGGATTTGGGGGG - Intronic
995853635 5:116572667-116572689 ATGGGGAAGCAGGACCCCGGAGG - Intronic
996268746 5:121577024-121577046 AGGGAGATGCAGGCTGCAGTGGG + Intergenic
996337485 5:122400633-122400655 ATGGAGAAGCAGAACACAGCTGG + Intronic
996403207 5:123085237-123085259 ATGGAGAAGGGGGTTGGAGGCGG - Intergenic
996635102 5:125679616-125679638 ATGGGAAAGAAGCATGCAGGAGG + Intergenic
997209289 5:132068113-132068135 CTCGAGCACCAGGATGCAGGTGG + Intergenic
997262307 5:132474612-132474634 ATGAAGAAGGAGGAGGCAGAAGG - Intronic
997345479 5:133188420-133188442 ATGCAGAAGGGGGATGCAGTGGG - Intergenic
997676222 5:135715060-135715082 TTGGAGAGGCAGGAGACAGGAGG + Intergenic
997780745 5:136655666-136655688 ATGAAAAAGCAGGATAAAGGTGG - Intergenic
997987703 5:138516565-138516587 ATGGAGATGGAGGTTGCAGTGGG + Intronic
998179842 5:139928987-139929009 ATAGAGAACCAGGATAAAGGGGG - Intronic
998400478 5:141846226-141846248 ATGGAGACGCACGGTGCAGCTGG + Intergenic
998763832 5:145462330-145462352 ATGTAGGAGCAGTATGCATGGGG + Intergenic
1001086196 5:168701636-168701658 AAGGAGAAGCAGGAGCCAGAAGG - Intronic
1001291483 5:170465895-170465917 ATGGAGCAGGAGGAAGCAGCAGG + Intronic
1001490143 5:172149315-172149337 AGGGTGAATCAGGAGGCAGGGGG - Intronic
1001630283 5:173169972-173169994 AGGGAGAAGGAGCAGGCAGGGGG - Intergenic
1001992883 5:176132831-176132853 AGGTAGAAGCAGGGTGCTGGCGG + Intergenic
1002447036 5:179296102-179296124 ATGGTGAAGCAGGAGGATGGGGG + Intronic
1002733314 5:181360001-181360023 CTAGAGAAGGAGGATGCAGCAGG + Intergenic
1002751226 6:114117-114139 CTAGAGAAGGAGGATGCAGCAGG - Intergenic
1003004310 6:2366968-2366990 GTGGAAAAGCAGGGGGCAGGGGG - Intergenic
1003037752 6:2659855-2659877 ATGGAGAAGAAGGAGCCAGACGG + Intergenic
1004226534 6:13789817-13789839 ATGGAGAAGAGGGAGGGAGGAGG + Exonic
1004332628 6:14735620-14735642 AAGGAGAGAGAGGATGCAGGCGG + Intergenic
1004683450 6:17918795-17918817 AGGGCCAAGCAGGATGCAGGTGG - Intronic
1005040901 6:21599228-21599250 CTGGAGAAGCTGGCTGCATGTGG + Intergenic
1005266204 6:24114668-24114690 ATGGAGATGAGGGCTGCAGGAGG - Intergenic
1005286302 6:24330729-24330751 ATGGAGAAACAGGATCCACAGGG + Intronic
1005810028 6:29508404-29508426 GTGGAGAGGCAGCAGGCAGGGGG + Intergenic
1006345905 6:33482300-33482322 TTGCAGAAGCTGGATGCATGGGG - Intergenic
1007107738 6:39295235-39295257 ATGGGGAAGCAGGGGGCAGAGGG + Intergenic
1007116191 6:39344998-39345020 ATGGAGAAGCTGGATGGAAAAGG - Intronic
1007714514 6:43848026-43848048 ATGAAGAAGGAGGAGGAAGGTGG + Intergenic
1008834685 6:55811190-55811212 TTAGAGAAGAAGGAGGCAGGGGG + Intronic
1011484746 6:87829964-87829986 AAGGAGAAGGAGGAAGAAGGAGG - Intergenic
1011989327 6:93493392-93493414 ATGGAGAAGGAGGATACACATGG - Intergenic
1012861714 6:104568079-104568101 ATGGAGAGGCAGGGTGCAAAGGG + Intergenic
1013470516 6:110460165-110460187 AGGGAGCATCAGGATGCAGCGGG - Intronic
1013761859 6:113528131-113528153 GTGGAGATTCAGCATGCAGGAGG - Intergenic
1014190341 6:118488663-118488685 AGGGAGAGGCAGGAGGCATGGGG + Intronic
1014736592 6:125101350-125101372 ATGGAGAAGTAGGAGTTAGGAGG - Intergenic
1015225509 6:130852776-130852798 ATGGAGATGCAGGAGGAAGGAGG - Intronic
1016254642 6:142089114-142089136 TGGGAAAAGCAGGTTGCAGGTGG - Intergenic
1016524886 6:144990455-144990477 GTGGAGAAGCTGGGTGTAGGAGG + Intergenic
1016739580 6:147513148-147513170 ATGGAGAGGCAGGTGGCAGCTGG + Intronic
1017013988 6:150085135-150085157 AAGGAGAAGCAGGAAAGAGGAGG + Intergenic
1017662473 6:156687593-156687615 CTGGAGAAGCCGGCGGCAGGGGG + Intergenic
1018118465 6:160612056-160612078 TTGGCAATGCAGGATGCAGGTGG + Intronic
1018120867 6:160634247-160634269 TTGGCAATGCAGGATGCAGGTGG + Intronic
1018279570 6:162171226-162171248 ATGGAGAAACTGGAAGGAGGAGG + Intronic
1018907071 6:168081705-168081727 AGGGAGAAGCTGGATGCAAAAGG + Intergenic
1019099876 6:169620879-169620901 CTGGAGGAGCAGAGTGCAGGAGG - Intronic
1019237564 6:170632323-170632345 CTAGAGAAGGAGGATGCAGCAGG + Intergenic
1020895648 7:13935802-13935824 TTGGAGATGCATGATGCAGTGGG + Exonic
1021625627 7:22590302-22590324 AGGGAGAATGAGGAGGCAGGAGG - Intronic
1022762534 7:33371433-33371455 ATTGAGATGTAGGATGAAGGAGG + Intronic
1023149129 7:37183196-37183218 AAGGAGAAGGAGGAAGGAGGAGG + Intronic
1024046021 7:45586215-45586237 ATGGAGGAACAGGCTGCATGCGG + Intronic
1024599802 7:50970348-50970370 AGGGAGGAGCAGGAAGCAAGAGG - Intergenic
1024962915 7:54996330-54996352 ATGGGGAGGGGGGATGCAGGGGG - Intergenic
1026529528 7:71185077-71185099 AGGGAGAAGAAGGAAGGAGGAGG - Intronic
1026735558 7:72946421-72946443 AAGGGGAAGCAGGATGCGGAGGG + Intronic
1026785896 7:73301351-73301373 AAGGGGAAGCAGGATGCGGAGGG + Intergenic
1027108168 7:75418587-75418609 AAGGGGAAGCAGGATGCGGAGGG - Exonic
1028952114 7:96648238-96648260 AAGGAGTAGCAGGATATAGGTGG + Intronic
1029120821 7:98266856-98266878 CTGGAGACGGAGGCTGCAGGAGG + Intronic
1029124625 7:98287685-98287707 ATGGAGAATTAGGAAGCAGGAGG + Intronic
1029423678 7:100484153-100484175 ATGGAGAAGGGGGATGAAGCAGG + Intronic
1030088169 7:105835057-105835079 GGGGAGAGGCAGGGTGCAGGAGG + Intronic
1030400230 7:109040178-109040200 ATGGAAAAGCAGGAGACATGGGG + Intergenic
1030583100 7:111384314-111384336 AAGGAGAAGGAGGAGGGAGGAGG + Intronic
1030769774 7:113459819-113459841 ATGGAGAAGTAGGAAGTAGTGGG - Intergenic
1031837404 7:126694941-126694963 ATGGAGAAACAGAATGTAAGTGG + Intronic
1032256257 7:130299419-130299441 ATGCAAGAGCAGGAGGCAGGAGG - Intronic
1032441639 7:131946643-131946665 ACGGAGGAGGAGGAGGCAGGGGG + Intergenic
1033140468 7:138821888-138821910 ATGGAGAGACAGGAGGCAGCGGG + Intronic
1034643747 7:152625924-152625946 ATGGGGAAGCAGGAACAAGGGGG + Intergenic
1034747096 7:153532409-153532431 GAGGAGGAGCAGGATTCAGGTGG - Intergenic
1034978910 7:155463435-155463457 AAGGAGGAGCAGGAGGAAGGAGG - Exonic
1035510203 8:174288-174310 CTAGAGAAGGAGGATGCAGCAGG - Intergenic
1035695362 8:1591746-1591768 CTGGAGATCCAGGATGCAGTTGG - Intronic
1036114421 8:5943355-5943377 ATGAAGATGCAGGAAGAAGGTGG - Intergenic
1036197770 8:6735559-6735581 AAGGAGAAACAAGATGCAAGTGG - Intronic
1036599130 8:10242937-10242959 ATGAATGACCAGGATGCAGGTGG - Intronic
1036604389 8:10292986-10293008 GTGGAGAAGCAGCAAGGAGGAGG + Intronic
1036669788 8:10775350-10775372 TTTGAGAAGCAGCATGCTGGAGG - Intronic
1037528385 8:19750050-19750072 TTGGGGATCCAGGATGCAGGGGG - Intronic
1038025935 8:23590816-23590838 GTGGAGAGACAGGGTGCAGGAGG + Intergenic
1038238383 8:25784446-25784468 ATGGAGGAGGAGGAAGGAGGTGG - Intergenic
1038352993 8:26797786-26797808 ATGGAGAAGGGGGATTCAAGAGG + Intronic
1041134817 8:54746890-54746912 AAGGAGAAGCAGGTTGGATGAGG - Intergenic
1041535696 8:58923200-58923222 ATGGAGGAACAGGAGTCAGGAGG + Intronic
1042159219 8:65875112-65875134 ATCCAGAAGCAGGATGGAGTGGG + Intergenic
1042404643 8:68390147-68390169 AGAAAGAAGCAGGATGCAGTGGG + Intronic
1044620763 8:94188642-94188664 ATGGAGGGGCAGTCTGCAGGTGG - Intronic
1044725104 8:95188300-95188322 GTGGAGAAGCAGAAGGCAGCAGG + Intergenic
1044785692 8:95789874-95789896 AAGGAAAAGGAGGAAGCAGGAGG - Intergenic
1045490206 8:102662463-102662485 AGGAAGAAGCAGGCTGAAGGGGG + Intergenic
1047667091 8:127104071-127104093 ACCCAGAAGCAGGATTCAGGGGG + Intergenic
1048057926 8:130886411-130886433 ATTGAAAAGCAGGATACATGCGG + Intronic
1048106222 8:131413201-131413223 AAAGGGAAGCAGGAGGCAGGAGG + Intergenic
1048327679 8:133451690-133451712 ATGGAGTAGCGGGCTGCAGATGG - Intergenic
1048468540 8:134687084-134687106 GGGGAGCAGCAGGAGGCAGGAGG - Intronic
1048873268 8:138816165-138816187 AAGGAGAAGAAGGAGACAGGAGG + Intronic
1048989707 8:139754145-139754167 ATGGAGCAGCAGCAGGCTGGGGG - Intronic
1049265502 8:141665869-141665891 ATGGAGAAGCTGAGTGGAGGAGG + Intergenic
1049544930 8:143226140-143226162 GGGGAGGCGCAGGATGCAGGGGG - Intergenic
1050331218 9:4548356-4548378 AGGCCGAAGGAGGATGCAGGTGG + Intronic
1050388169 9:5111770-5111792 AAGGAGAAGGTGGATGCAGCCGG - Intronic
1050690400 9:8221172-8221194 AAGGAGAAGCAGGGTGGGGGAGG + Intergenic
1050714654 9:8509173-8509195 ATTGAGAAGCAAGAGGCAGAGGG + Intronic
1051399468 9:16664059-16664081 TTCGAGAAGCAGGATAAAGGTGG - Intronic
1052406837 9:28072033-28072055 ATGTAGAAGGAGGATGAAGATGG - Intronic
1052612890 9:30799440-30799462 CAGGAGAAGCAGGGTGCATGAGG - Intergenic
1052619580 9:30889152-30889174 ATAGAGAAGAAGGGGGCAGGAGG - Intergenic
1052973573 9:34396384-34396406 ATGAGGAAGGAGGATGTAGGTGG - Intronic
1053027823 9:34745233-34745255 ATGGAGCAGCAAGAATCAGGAGG - Intergenic
1053450679 9:38191883-38191905 CTGGAAAACCAGGAAGCAGGGGG + Intergenic
1054918775 9:70521281-70521303 GTGGAGAAGAATGATGTAGGTGG - Intergenic
1055144506 9:72916541-72916563 GTGGAGATGAAGGATTCAGGAGG + Intronic
1055632659 9:78239198-78239220 ATGGACAAGCAATATGTAGGAGG - Intronic
1055973001 9:81930376-81930398 AATGTGAAGCAGGATTCAGGGGG + Intergenic
1055974754 9:81945468-81945490 AATGTGAAGCAGGATTCAGGGGG + Intergenic
1056254852 9:84788675-84788697 ATGGAGACACAGCATGCATGAGG + Intronic
1056934197 9:90903368-90903390 ATGGATAATCAGGCTGCAGAGGG - Intergenic
1057564993 9:96159855-96159877 ATGGGAAAGCAGGATACAGCAGG + Intergenic
1057838484 9:98466044-98466066 CTGGAGCAGAAGGAAGCAGGAGG - Intronic
1057977058 9:99616921-99616943 AGGGAGCAGAAGGATGCAGCAGG + Intergenic
1058551474 9:106120035-106120057 ATGAAGAAGCAGGAAGCAAGGGG - Intergenic
1059324159 9:113493520-113493542 GTGGGGAGGCAGGATGCTGGGGG - Intronic
1060807294 9:126585793-126585815 CTGGAGAAGGAGGAGCCAGGGGG + Intergenic
1062036100 9:134383262-134383284 AGGGTGAGGCAGGATGGAGGTGG + Intronic
1062165347 9:135104808-135104830 CTGGAGGAGCAGGAGGCAGGAGG - Intronic
1062638411 9:137503594-137503616 AAGGAGAAGGAGGAAGAAGGAGG + Intronic
1062757718 9:138312313-138312335 CTAGAGAAGGAGGATGCAGCAGG + Intergenic
1203756122 Un_GL000218v1:128586-128608 AAGAAGAAGCAGGAAGCTGGGGG - Intergenic
1203649738 Un_KI270751v1:104834-104856 AAGAAGAAGCAGGAAGCTGGGGG - Intergenic
1185895405 X:3854157-3854179 AGGGAGAAGAAGGAAGGAGGAGG - Intergenic
1185900522 X:3892581-3892603 AGGGAGAAGAAGGAAGGAGGAGG - Intergenic
1185905638 X:3931012-3931034 AGGGAGAAGAAGGAAGGAGGAGG - Intergenic
1186493868 X:9996550-9996572 AGGGTGAGGCAGGAGGCAGGGGG - Intergenic
1186550981 X:10505379-10505401 ATGAAGAAGCAGAATGGAAGGGG + Intronic
1188310461 X:28610878-28610900 ATTGAGCAGCAGGATGTAGAGGG + Intronic
1189166140 X:38863025-38863047 ATGGCGCAGCAGCAGGCAGGAGG + Intergenic
1190718389 X:53124577-53124599 ATGGAGAAGCAGGAGTTAGAGGG - Intergenic
1192021110 X:67392222-67392244 AGGGAGTGGCAGGATGTAGGAGG + Intergenic
1192234179 X:69285614-69285636 ATGGAGAAGGGGGAAGGAGGAGG + Intergenic
1193236484 X:79113624-79113646 AAGCAGAAGCAGGCTGAAGGTGG + Intergenic
1193772967 X:85609556-85609578 ATTGAGAAGTAGGATGGTGGTGG + Intergenic
1196398684 X:115291478-115291500 AAGGAGAAGCAGGAACAAGGAGG + Intronic
1197267246 X:124388004-124388026 ATGGGAAAGCAGGTGGCAGGGGG + Intronic
1197412708 X:126138858-126138880 ATGGGCAACCAGGATGCGGGGGG + Intergenic
1198033301 X:132776639-132776661 AAAGAGCGGCAGGATGCAGGGGG - Intronic
1198292050 X:135249188-135249210 ATGGAGCATCAGGAGGAAGGTGG - Intronic
1198392870 X:136193961-136193983 TTCAAGAAGCAGGATGCAGCTGG - Intronic
1199851135 X:151725537-151725559 ATGGTGAAGCAGGATGCTGTGGG + Intergenic
1200133250 X:153862718-153862740 AAGGAGAAGGAGGCGGCAGGGGG - Exonic
1201719262 Y:17078940-17078962 ATGGAGAAAAAGGATGTATGTGG + Intergenic