ID: 1153558111

View in Genome Browser
Species Human (GRCh38)
Location 18:6339036-6339058
Sequence GAACAAACCCACAAATATAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 382
Summary {0: 1, 1: 0, 2: 4, 3: 34, 4: 343}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153558111 Original CRISPR GAACAAACCCACAAATATAT TGG Intronic
900039714 1:448492-448514 CAACAAAAGCAAAAATATATGGG + Intergenic
900061146 1:683468-683490 CAACAAAAGCAAAAATATATGGG + Intergenic
902320102 1:15656447-15656469 GAAGCAACCAACAAATATTTTGG + Intronic
904695627 1:32329319-32329341 GAACAAACACCCATATTTATTGG + Intronic
906923942 1:50094290-50094312 AACAAAACCCACAAATTTATAGG - Intronic
908871306 1:68616139-68616161 GCACAGAACCACAAATATTTAGG - Intergenic
909764651 1:79340458-79340480 GACCAAACTGACAAATGTATAGG - Intergenic
910272701 1:85414172-85414194 AAACAGATCCACACATATATAGG + Intronic
910969717 1:92844011-92844033 GAACATACCCCCAAATTAATGGG - Exonic
911043729 1:93611773-93611795 GAACAAAACTAAAAATATAGAGG - Intronic
911285543 1:95987739-95987761 GTCCAAACACAGAAATATATTGG + Intergenic
911966404 1:104377412-104377434 GAATAAACACAAAAATAAATGGG + Intergenic
911999563 1:104813906-104813928 AAACAAAACCAAAAAGATATTGG - Intergenic
916409560 1:164532181-164532203 AAACAAAAACACAAATAAATTGG - Intergenic
916670104 1:167009663-167009685 GATCAAACATACATATATATTGG - Intronic
917725360 1:177822550-177822572 GAATAAAGCCACAAGTTTATTGG + Intergenic
918222463 1:182448191-182448213 AAACAAACAAACAAATAAATTGG - Intergenic
919481729 1:198098228-198098250 CACCAAACCCAAAAATATAGTGG - Intergenic
920413151 1:205778303-205778325 AAACAAACAAACAAATAAATAGG - Intergenic
921231245 1:213073983-213074005 GTACACACTCAGAAATATATCGG + Intronic
921279698 1:213553859-213553881 GAACAACCCCACAAAAAAAATGG - Intergenic
921513723 1:216064432-216064454 GAGAAAACCCACAAAAACATGGG + Intronic
921655214 1:217726702-217726724 AAAAAAACACACAAAAATATGGG - Intronic
921883670 1:220281541-220281563 GACCAAAGCCAGAAATAAATGGG + Intergenic
922666351 1:227472842-227472864 GAACAAGCCCTCAGATATGTAGG + Intergenic
923806964 1:237268083-237268105 AAACAAAACCACAGATATATGGG - Intronic
924007878 1:239632189-239632211 AAACAAACAAACAAAAATATGGG - Intronic
1063355978 10:5398607-5398629 AAACAAACAAACAAACATATTGG + Intronic
1063517089 10:6707123-6707145 GAACACATCCAAAAATATTTAGG + Intergenic
1063617328 10:7612057-7612079 TACCAAACCCACAAATGAATTGG + Intronic
1063679566 10:8173955-8173977 AAACAAACTCATAAATATAAGGG + Intergenic
1063845399 10:10122141-10122163 AAATAAACCTACAAATATTTGGG + Intergenic
1064788155 10:18922422-18922444 AAACAAACAAACAAATATCTAGG - Intergenic
1065394509 10:25219610-25219632 AAACATACACAGAAATATATAGG - Intronic
1068389586 10:56377295-56377317 AGACAAATCCACAAATATAGTGG - Intergenic
1068422877 10:56819931-56819953 AAACACAGGCACAAATATATAGG - Intergenic
1068899244 10:62247299-62247321 GATGAAACTCATAAATATATAGG + Intronic
1069327538 10:67249886-67249908 GAAAAAACCCACACAGACATGGG + Intronic
1070040488 10:72773300-72773322 GAAAAAACCCACAGAAATCTTGG + Intronic
1071225593 10:83524833-83524855 TAAAATACCCACAAAAATATTGG + Intergenic
1073679161 10:105683253-105683275 GATAAAACCCACAAAAATGTAGG + Intergenic
1073988224 10:109233632-109233654 GAACACACACACAAGTATATAGG - Intergenic
1075251770 10:120884331-120884353 GAACAGACCCATGAATATTTGGG + Intronic
1076067501 10:127460348-127460370 CAAAAAACCCAAAAATATGTAGG - Intergenic
1076965937 11:84405-84427 CAACAAAAGCAAAAATATATGGG + Intergenic
1077498952 11:2900381-2900403 GAACAAAGACCCAAAGATATGGG + Intronic
1079196265 11:18330115-18330137 TAACAAACCAACAAATACATAGG - Intronic
1079218366 11:18536272-18536294 GGACAAACCCAAAAGTATAAAGG - Intronic
1079561711 11:21829504-21829526 GAAGAAGCCCACATATATTTGGG - Intergenic
1079921190 11:26436420-26436442 GAGCAGACCCTCAAACATATTGG - Intronic
1080808167 11:35675543-35675565 GAACAAACAAACAAAAATAGAGG - Intronic
1081035504 11:38139597-38139619 GAAAAAAGCCCCAAATAAATGGG - Intergenic
1081192142 11:40116935-40116957 AAAGAAACCCACATTTATATGGG - Intronic
1082301210 11:50508872-50508894 GAAAAAACACAGAAATATAGAGG - Intergenic
1083129744 11:60614080-60614102 AAAAAAACCCACAAATAAATAGG - Intergenic
1085213427 11:74804086-74804108 GAAAAAACCCACACAGATATGGG - Intronic
1085817855 11:79760039-79760061 GAACAAACACACACAGAAATTGG + Intergenic
1085937504 11:81166623-81166645 AAAAAAACCCTCAAAAATATGGG + Intergenic
1087065429 11:94023638-94023660 GAACAAACGCACTATCATATGGG - Intronic
1087495190 11:98882140-98882162 ACACAAACACACATATATATGGG - Intergenic
1088334784 11:108691483-108691505 GATCAAACCAAGAAATATGTTGG - Intronic
1088356987 11:108954544-108954566 AAAAAACCCCACAAATATCTGGG - Intergenic
1088452710 11:109998907-109998929 GAACAAAGCCACACATGTCTGGG - Intergenic
1093010231 12:14099754-14099776 GACCAAAGTCACAAATATATAGG + Intergenic
1093040034 12:14367537-14367559 GAACATACACATAAATATTTCGG + Intronic
1093750215 12:22789853-22789875 AAATAAATCCACATATATATGGG - Intergenic
1093869723 12:24274527-24274549 GAACAAACCCAAAAGTAAACAGG + Intergenic
1094165509 12:27438790-27438812 AAACAAACAAACAAATATATAGG + Intergenic
1096026735 12:48371512-48371534 GAACAACCAAATAAATATATGGG + Intergenic
1099380742 12:81949264-81949286 GAGAAAACCCACACAGATATGGG + Intergenic
1099854523 12:88146582-88146604 ACACACACACACAAATATATAGG - Intronic
1100114553 12:91288294-91288316 CAACATACATACAAATATATAGG - Intergenic
1100807892 12:98306864-98306886 AAACAACTCCACAAACATATGGG + Intergenic
1102288255 12:111677256-111677278 GAAAAGACCCAGAAATAGATTGG - Intronic
1103484024 12:121270624-121270646 AAACAAAACCCCAAATGTATTGG + Intronic
1104561557 12:129850049-129850071 TTTCAAATCCACAAATATATGGG - Intronic
1104741071 12:131174695-131174717 CAACAAAAGAACAAATATATGGG + Intergenic
1105617680 13:22034512-22034534 GAAACAACCCACATATATATAGG - Intergenic
1105982353 13:25531116-25531138 ACACACACACACAAATATATAGG - Intronic
1106491694 13:30230333-30230355 GAACAAATGAACAAATAAATGGG + Intronic
1107143215 13:37027437-37027459 GAGCAACCCCACCAATATTTAGG - Intronic
1107411756 13:40164415-40164437 GAAAAAGCCCACGAGTATATGGG - Intergenic
1107743615 13:43481346-43481368 AAATAAACCCATATATATATGGG + Intronic
1108715046 13:53070653-53070675 TACTAAACCCACAAAAATATTGG - Intergenic
1109165712 13:59032084-59032106 GAAAATACACACAAATATTTAGG - Intergenic
1109404720 13:61882161-61882183 GAACAAAACCAAAAAGTTATTGG - Intergenic
1109490661 13:63095212-63095234 AAACACACACACATATATATAGG + Intergenic
1109582189 13:64355340-64355362 GGACAAGTCCACAAATATTTTGG - Intergenic
1109746131 13:66625278-66625300 GAACAAACCAACAAAATTTTAGG + Intronic
1110973806 13:81804104-81804126 GAAAACACACACAAATATACAGG - Intergenic
1111040745 13:82744043-82744065 GATAAAACCAACAAAAATATTGG + Intergenic
1111118008 13:83806373-83806395 GAACAAACACACAAACACAGAGG - Intergenic
1111666514 13:91275412-91275434 TAATAAACACAAAAATATATAGG + Intergenic
1113004555 13:105684860-105684882 GAACAAAACCACACATATTTAGG - Intergenic
1115256750 14:31410916-31410938 TAACAACCCTACAAATAAATTGG + Intronic
1115456166 14:33606035-33606057 GAGCAGACCCACACATTTATAGG + Intronic
1116450735 14:45062229-45062251 AAATAAATCCACAAATACATTGG - Intronic
1116885493 14:50217141-50217163 AAATAAAACCACACATATATGGG + Intronic
1118131652 14:62971691-62971713 GAATAGACCCACATAAATATAGG + Intronic
1118410706 14:65474830-65474852 GAACAAATCCACAAAAATGAAGG - Intronic
1118525846 14:66641571-66641593 GGACAAATCCCCAAATATACTGG + Intronic
1119328013 14:73773549-73773571 GAACAAACACACACATTCATGGG + Intronic
1123911983 15:24977148-24977170 GAACCAAAACACAGATATATGGG + Intronic
1124578659 15:30931727-30931749 AAACAGACCCACATATATATGGG - Intronic
1125072316 15:35570129-35570151 AAACAAACCTACACATATATAGG - Intergenic
1125531705 15:40417879-40417901 GAAAAAAACAACATATATATGGG + Intronic
1126333619 15:47562130-47562152 GAATATACCCACACATACATGGG + Intronic
1128270718 15:66307045-66307067 GAACAAACCAACAATTATTCTGG + Intronic
1130694768 15:86120068-86120090 AAACAAAGCCTCAAATATAGAGG + Intergenic
1130793693 15:87185680-87185702 AAACAAACAAACAAATACATAGG + Intergenic
1132442194 15:101879120-101879142 CAACAAAAGCAAAAATATATGGG - Intergenic
1133100210 16:3474927-3474949 AAACAAACCCATAAATAAATGGG - Intronic
1133468390 16:6050290-6050312 AAACAAACACACAAAAATATGGG - Intronic
1133828011 16:9296143-9296165 GTACAAAAGCGCAAATATATCGG + Intergenic
1134530605 16:14980111-14980133 GAACAAAGCCATAAATATCTAGG - Intronic
1134880198 16:17739580-17739602 GCACACACCCAGAAATAGATTGG + Intergenic
1135091225 16:19519427-19519449 GCACATACACACACATATATAGG - Intronic
1136504075 16:30691527-30691549 AAACAAACAAACAAAAATATTGG + Intergenic
1137658900 16:50186290-50186312 AAACAAAGCGACAAATATGTAGG - Intronic
1138526364 16:57609897-57609919 AATCAAACCCACAAGTATCTAGG - Intergenic
1139865742 16:70060901-70060923 GAACAAAGCCATAAATATCTAGG + Intergenic
1141157374 16:81606736-81606758 GAATAAAGCCACAAATAAATAGG + Intronic
1141849436 16:86634971-86634993 GAAAAATCCCACAAACATCTTGG - Intergenic
1143072284 17:4306636-4306658 AAGCAAAACCACAAATATTTTGG - Intronic
1143228155 17:5325724-5325746 AAAAAAACCGACAAATATTTAGG + Intronic
1144136973 17:12304721-12304743 CAATAAACCCCCAAATATTTGGG - Intergenic
1144356648 17:14452893-14452915 TAAAAAACACACAAAAATATTGG - Intergenic
1144943528 17:18958066-18958088 GAAAAAAACAACAAATATCTTGG - Intronic
1148449151 17:47763314-47763336 AGACAAATCCACAATTATATTGG - Intergenic
1148675983 17:49445369-49445391 AAAAAAACCCAAAAACATATAGG - Intronic
1150039109 17:61839383-61839405 AAAAAAACCCAAAAATACATAGG - Intronic
1150762286 17:67973424-67973446 TAATAAACCCACAATTATCTTGG + Intronic
1152576824 17:81144882-81144904 GCACAAACCCACCAAAATCTGGG + Intronic
1153118740 18:1693713-1693735 GAACAAACAAATAAATAAATAGG - Intergenic
1153172176 18:2328746-2328768 GAACAAATCCACATACATTTGGG + Intergenic
1153351603 18:4086873-4086895 AAACAAATCCACAATTATAATGG - Intronic
1153417351 18:4861879-4861901 GAACAAAACCACTAGTATGTTGG - Intergenic
1153558111 18:6339036-6339058 GAACAAACCCACAAATATATTGG + Intronic
1153620141 18:6969589-6969611 GAACAAATCCACTGTTATATTGG - Intronic
1154154289 18:11931648-11931670 GAAGAAACCTACATATTTATAGG - Intergenic
1155765950 18:29632980-29633002 CAACAAAACCAAAAATATATAGG - Intergenic
1155796257 18:30041110-30041132 GAACAAACAAACAAAAATAATGG + Intergenic
1156005055 18:32430464-32430486 GAACAAATAAACAAATATATTGG + Intronic
1156288695 18:35724844-35724866 GAACAAAACCTCAGAAATATGGG + Intergenic
1156577941 18:38340458-38340480 GCACACACACACACATATATAGG + Intergenic
1156714055 18:39984643-39984665 TAAAAAAGCCCCAAATATATGGG + Intergenic
1156791896 18:40985535-40985557 GACAAAGCCCAAAAATATATGGG + Intergenic
1156917492 18:42478777-42478799 AAACAAACCAATAAATATAAAGG + Intergenic
1157043742 18:44070091-44070113 AAACATACCCACATACATATAGG - Intergenic
1157955448 18:52092190-52092212 TAAAAAACACAAAAATATATGGG + Intergenic
1158755507 18:60319897-60319919 GAACAAAACCTCTAATATATAGG - Intergenic
1160642741 19:154035-154057 CAACAAAAGCAAAAATATATGGG + Intergenic
1163634104 19:18430509-18430531 AAACATACACACAAATATACCGG - Intronic
1163745267 19:19043073-19043095 GATCCAGCCCACAAATATCTGGG - Intronic
1163967306 19:20758785-20758807 CTACAAACCCCCAAATATATTGG + Intronic
1164250678 19:23471978-23472000 GAAAAAACCCTCAAATATATGGG - Intergenic
1164291762 19:23876036-23876058 GAAAAAACCCTCAAATATATGGG + Intergenic
1164301990 19:23971132-23971154 GAAAAAACCCTCAAATATATGGG + Intergenic
1164323898 19:24175694-24175716 GAGAAAACCCTCAAATATTTGGG + Intergenic
1164709354 19:30344285-30344307 ACACACACACACAAATATATTGG + Intronic
1165887473 19:39088712-39088734 AAACAAACCCACAAAGATCGTGG - Intronic
1166635004 19:44443284-44443306 GAGAGACCCCACAAATATATGGG + Intronic
1166850217 19:45756409-45756431 AAACAAACAAACAAAAATATTGG - Intronic
1167527204 19:49992051-49992073 GAACAATCCTATGAATATATAGG + Intronic
1168508994 19:56959624-56959646 GAACAAATGAACAAATAAATGGG + Intergenic
924989247 2:297507-297529 GAACAAACCTACAATTACAAAGG - Intergenic
926866488 2:17365017-17365039 GAAAAAAACCAAAAATCTATGGG - Intergenic
926879028 2:17520286-17520308 GAAAAAACCCACATAAATAGTGG - Intergenic
927447969 2:23182274-23182296 AGACAAATCCACAATTATATTGG + Intergenic
928714016 2:34039471-34039493 CAACAAACACACAAAAAAATGGG - Intergenic
928745691 2:34411769-34411791 AAACTAACCAACAAATAAATAGG - Intergenic
929660786 2:43781982-43782004 AAACAAACACACAAATGTAGGGG - Intronic
929730829 2:44490012-44490034 ACACACACACACAAATATATGGG + Intronic
929746098 2:44660607-44660629 AAACAAACAAAAAAATATATTGG - Intronic
929886766 2:45885777-45885799 AAACAAATCCACAAATTTGTGGG + Intronic
930810940 2:55539939-55539961 AAACAACCCAACAAATATAATGG - Intronic
931444734 2:62317063-62317085 AAACAAACAAACAAACATATTGG + Intergenic
931753874 2:65354630-65354652 AAAAAAACCAACAAATATAGTGG - Intronic
932496078 2:72146413-72146435 GAACAACCCCAAAAAGAGATGGG + Intronic
933062074 2:77750041-77750063 AAACAGACTCACACATATATGGG - Intergenic
933118842 2:78509794-78509816 CAAGAAAACAACAAATATATGGG - Intergenic
933444557 2:82362958-82362980 GATAAAACTCACAAACATATGGG + Intergenic
935506117 2:103905709-103905731 AAATAAACCCACAAATATATAGG - Intergenic
935707199 2:105867424-105867446 AAACAAACCCACATTTATTTTGG - Intronic
937286418 2:120755882-120755904 GAATAGGCCCACACATATATGGG - Intronic
937698035 2:124830063-124830085 TAACATACCCATAAATATAATGG + Intronic
938153998 2:128912802-128912824 GTACAAACACGCAAATATAAGGG + Intergenic
939033923 2:137108898-137108920 GAACAAAATCACAAATATTAAGG - Intronic
939141984 2:138364842-138364864 GAATAAACCCAGAATTATTTTGG + Intergenic
940714858 2:157209889-157209911 GTACAAATCCACAATTATAGTGG - Intergenic
941224765 2:162834050-162834072 AAACAAACCAACAAATATGTTGG + Intronic
942023608 2:171891738-171891760 GAAAATAGCCAAAAATATATCGG - Intronic
943857571 2:192817542-192817564 GAAAAAATACACAAATATACTGG + Intergenic
944523762 2:200597742-200597764 AAACAAACCCACAAATGTCAGGG - Intronic
944609827 2:201391326-201391348 GAACAAATGAACAAATAAATGGG + Intronic
945516273 2:210766689-210766711 GAAGGAACCCACAATTACATAGG - Intergenic
946096928 2:217282383-217282405 AAACAAACTTACAAAAATATTGG + Intergenic
947076850 2:226354471-226354493 GAACAAATGCACAAGGATATTGG + Intergenic
1169122416 20:3105173-3105195 GAACTAACCCACGAATACACAGG - Intergenic
1170865092 20:20147752-20147774 CAAAAAACCAACAAATAAATTGG - Intronic
1174064526 20:47854878-47854900 GAACAAACCCACAAACTGAATGG - Intergenic
1174168650 20:48602973-48602995 AAACAAACCTACACAAATATGGG + Intergenic
1174211592 20:48883248-48883270 GATCAAAACCACAAATAGAAAGG + Intergenic
1174492538 20:50911224-50911246 CAACAAAACCAAAAATAGATGGG - Intronic
1174692561 20:52522305-52522327 AAACAAACCAACAAAAAAATAGG - Intergenic
1176361262 21:5998588-5998610 GACAAAATCCACAAAAATATGGG + Intergenic
1177274894 21:18897621-18897643 TAACAAACCTACATATATACTGG - Intergenic
1178071546 21:28973398-28973420 ACACAAAGCAACAAATATATAGG + Intronic
1178241469 21:30906352-30906374 GAACAAAAGCACAAGTAAATTGG - Intergenic
1179072498 21:38084721-38084743 GAAAAAACCAATAAATAAATGGG - Intronic
1179762256 21:43539962-43539984 GACAAAATCCACAAAAATATGGG - Intronic
1181042696 22:20199840-20199862 GAACAGACACACAAGTATATGGG - Intergenic
1181042701 22:20199891-20199913 GAACAGACATACAAGTATATGGG - Intergenic
1182885184 22:33767774-33767796 ACACAAACACACACATATATGGG + Intronic
949159599 3:864586-864608 ACACACACACACAAATATATTGG - Intergenic
949227617 3:1712859-1712881 AAACAACCCCAGAAATATCTTGG - Intergenic
949723039 3:7012734-7012756 AAACAAACACACAAATAAACTGG - Intronic
951363859 3:21756660-21756682 GAGCAAAAGCACAAGTATATGGG + Intronic
951757616 3:26108696-26108718 AAAAAAAACCACAAAAATATAGG + Intergenic
952703821 3:36355665-36355687 AAAAAAACACAAAAATATATTGG - Intergenic
955115337 3:55993017-55993039 ACACAAACCCACAAATACTTTGG - Intronic
955233881 3:57122943-57122965 AAACAAACAAACAAATATAAGGG - Intronic
956262789 3:67363425-67363447 GCAGAAACCCACAAATACAGGGG - Intronic
956772799 3:72540708-72540730 GAACAAAAGCAAAAATATAGGGG + Intergenic
957037470 3:75307912-75307934 GAAAAAACTCCCAAATATTTGGG - Intergenic
957882807 3:86243193-86243215 GTATAAACACACAAATGTATAGG + Intergenic
958080932 3:88745275-88745297 GAAGAAACTCACAATTATTTTGG - Intergenic
959908691 3:111738605-111738627 TAACATACACACAAATATAGAGG - Intronic
960752343 3:120969558-120969580 CAACAAAACCAAAAATAAATGGG - Intronic
962127734 3:132640008-132640030 ACACACACACACAAATATATAGG + Intronic
964676148 3:159282518-159282540 CAAAAAACACAAAAATATATAGG - Intronic
964975177 3:162609880-162609902 AAACAGACCCACACATATATGGG + Intergenic
965128967 3:164670023-164670045 GAACAACCCCATCAAAATATGGG + Intergenic
965429351 3:168567412-168567434 GAAGAAGCCCACAAATACTTAGG + Intergenic
965780498 3:172280867-172280889 GAAAAAACCCACACACATAGAGG - Intronic
967070780 3:185960798-185960820 AAACAATCCCACAAATACAAAGG + Intergenic
967466028 3:189806943-189806965 GAACAAACTTACAAAGAAATAGG - Intronic
971809757 4:31409436-31409458 GGAGAAACCCACACATATGTGGG + Intergenic
972166253 4:36287995-36288017 CAACAAAAACAAAAATATATAGG - Intronic
974069636 4:57111749-57111771 GAACAAAGACAAAAATATTTAGG - Intergenic
974343248 4:60641338-60641360 GAACAAATCAATAAATAAATGGG - Intergenic
974768127 4:66374992-66375014 GCACATACCTACAACTATATTGG - Intergenic
975773183 4:77752392-77752414 GAACAAACAAACTAACATATAGG + Intronic
976903827 4:90211253-90211275 TAAGAAACCCACAAATTTCTGGG - Intronic
977112816 4:92981200-92981222 GCACACACACACATATATATAGG - Intronic
978764821 4:112393233-112393255 GAGAAGACCCAGAAATATATTGG + Intronic
979025223 4:115563039-115563061 GAACAAACTAACAAATTTAGTGG - Intergenic
979701910 4:123678545-123678567 GAATAAACCCATACATACATGGG + Intergenic
980117109 4:128689941-128689963 GAACAGACACACACGTATATAGG + Intergenic
980160623 4:129157554-129157576 GAACAACACAACAAATATAAAGG - Intergenic
980807244 4:137829758-137829780 CAACACACACACATATATATAGG - Intergenic
980825764 4:138070569-138070591 CAACAAAACCAAAAATAAATAGG + Intergenic
981223722 4:142267399-142267421 GAATAAATCTACACATATATGGG + Intronic
981267922 4:142808894-142808916 TAACAAATCCACAATTATTTAGG - Intronic
982844804 4:160237141-160237163 GAACACACACACACACATATGGG + Intergenic
984023497 4:174515602-174515624 CAACAAAACCAAAAATAGATGGG + Intronic
987121720 5:14774403-14774425 GAAAAAAATCACAAATAAATGGG - Intronic
987223975 5:15820546-15820568 GAAGAAACCCACAAACATCCAGG - Intronic
987273092 5:16333293-16333315 GTGAAAACCCACAAATATAGAGG + Intergenic
987779181 5:22410580-22410602 GAACAAAGACCCAAATATACAGG - Intronic
989808725 5:45646052-45646074 AAAAAAACCCAGAAATAAATAGG + Intronic
989823070 5:45818999-45819021 GAACAATTCAACAAATACATGGG + Intergenic
990263709 5:54053317-54053339 GAATAAATCAACAAATAAATGGG + Intronic
990646117 5:57846281-57846303 GAAGAAAACCAAAAATTTATTGG + Intergenic
991280001 5:64902527-64902549 GAATAAACCCATGTATATATGGG - Intronic
991382917 5:66051026-66051048 TAACAAATACATAAATATATAGG + Intronic
992231302 5:74666837-74666859 GAACACACACACATATATATAGG + Intronic
992315143 5:75544685-75544707 TGACAAACCCAGAAATATATGGG + Intronic
992373205 5:76166500-76166522 GAGCAGTCCCACAAATATCTAGG + Intronic
992373212 5:76166578-76166600 GAGCAGTCCCACAAATATCTAGG + Intronic
993776682 5:92008674-92008696 AAATAAAACCACACATATATAGG + Intergenic
994425348 5:99577690-99577712 GAACCATACCAGAAATATATTGG - Intergenic
994435993 5:99734545-99734567 GAACCATACCAGAAATATATTGG + Intergenic
995281514 5:110340789-110340811 AAAAAAACCCAGAAATATAGGGG + Intronic
995603753 5:113828018-113828040 GAAGAAAGACACAAATATGTGGG - Intergenic
996038386 5:118783546-118783568 ATATAAACCCACAAATAAATGGG - Intergenic
996961700 5:129257403-129257425 GAACAGACCCAAACATAAATGGG - Intergenic
997516689 5:134495064-134495086 AAACCAACCAACAAATAAATAGG + Intergenic
998768682 5:145517303-145517325 GAACAACCCCATCAAAATATGGG + Intronic
1001393320 5:171398321-171398343 GAACAAAGCCCTAAATATAAAGG - Intronic
1002734133 5:181370451-181370473 CAACAAAAGCAAAAATATATGGG - Intergenic
1002750408 6:103675-103697 CAACAAAAGCAAAAATATATGGG + Intergenic
1003205531 6:4006983-4007005 CAACAGACCCACACATTTATGGG + Intergenic
1006891239 6:37431055-37431077 GAAAAAACAGATAAATATATAGG - Intergenic
1008347506 6:50446205-50446227 AAACAAACCCCCAAATCTTTGGG - Intergenic
1008786247 6:55172363-55172385 AAACAAACTAACAAATACATAGG - Intronic
1008991791 6:57611455-57611477 AAATAGACCCACATATATATGGG + Intronic
1009180308 6:60509694-60509716 AAATAGACCCACATATATATGGG + Intergenic
1009733229 6:67637029-67637051 GATAAAACCAACAAATATCTCGG - Intergenic
1011023483 6:82840301-82840323 AAACAAACCCACAGTTATAGTGG + Intergenic
1011273834 6:85607999-85608021 GCTAAAACCCACAAATATATTGG + Intronic
1011636793 6:89382115-89382137 GAAAACACCCCCAATTATATTGG - Intronic
1011900734 6:92292656-92292678 GAACAAATACATAAATGTATAGG - Intergenic
1012211703 6:96526577-96526599 GAAGTACCCCCCAAATATATTGG - Intronic
1012653517 6:101787079-101787101 TAACAAACTCAAAAATTTATAGG - Intronic
1012673194 6:102082628-102082650 GTACATACCCTCAAATATTTGGG + Intergenic
1012783574 6:103593838-103593860 GAAGAAACCCAGAATTATCTGGG - Intergenic
1012914560 6:105155604-105155626 GAACAAAGCCACATAGAAATGGG - Intergenic
1013698862 6:112738537-112738559 GAACAAACATCCAAAGATATTGG - Intergenic
1014447505 6:121545911-121545933 GAACACACACAAATATATATGGG - Intergenic
1014502759 6:122213213-122213235 GACAAAACTCAGAAATATATAGG + Intergenic
1015729058 6:136329723-136329745 GAACAAATAAGCAAATATATTGG - Intergenic
1016301503 6:142636671-142636693 CAAAAAACCCCCAAAAATATGGG - Intergenic
1017484127 6:154887348-154887370 AAACAAACCCCCAAATAGATGGG - Intronic
1019238381 6:170642765-170642787 CAACAAAAGCAAAAATATATGGG - Intergenic
1020239636 7:6383624-6383646 GAACAAAACTACTAATATAAAGG - Intronic
1020789137 7:12603895-12603917 GAAAAAAACCACACATATAAGGG - Intronic
1021537537 7:21722464-21722486 GAACAAACCAACAGAAATATAGG - Intronic
1022402690 7:30055622-30055644 GAATAGACCTTCAAATATATTGG + Intronic
1023121115 7:36909921-36909943 GAATAAACAGACAAATAAATGGG + Intronic
1025950407 7:66140871-66140893 CAAAAAACCTACAAATACATAGG + Intronic
1026921432 7:74158454-74158476 GAACAAACAAACAAAGATAATGG - Intergenic
1028941638 7:96528183-96528205 AAACAACCCCACAAAATTATTGG - Intronic
1031280000 7:119787069-119787091 GAACAACCCCACTAAAAAATGGG - Intergenic
1031287086 7:119884315-119884337 AAACTAACCCAAAAAAATATTGG - Intergenic
1033055643 7:138051115-138051137 AAATAGACCCACAAATATAGTGG + Intronic
1034510510 7:151531009-151531031 AAACAGACCCACACATACATGGG - Intergenic
1034614100 7:152399931-152399953 AAACAAACAGACAAAAATATTGG + Intronic
1035509388 8:163842-163864 CAACAAAAGCAAAAATATATGGG + Intergenic
1037087793 8:14874499-14874521 TATCAAACCCACATAAATATTGG + Intronic
1037218112 8:16483235-16483257 AAACAAACACACATATAAATGGG + Intronic
1037355808 8:18018326-18018348 AAACAAGCCCACAAACATCTGGG - Intronic
1038117970 8:24579164-24579186 AAACAAACAAACAAATAAATGGG + Intergenic
1039348809 8:36738428-36738450 AAACAGACCCACATAAATATAGG + Intergenic
1040883026 8:52229179-52229201 GAATAAGCCCACCAATAGATGGG - Intronic
1042133135 8:65609104-65609126 AACCAAACAAACAAATATATAGG - Intronic
1043696395 8:83224107-83224129 GAACTAAGACAGAAATATATAGG + Intergenic
1044169592 8:89032921-89032943 GAACAAACTTAAAACTATATTGG - Intergenic
1044287692 8:90428249-90428271 TAACAAACACACAAAGATTTTGG - Intergenic
1044336372 8:90988474-90988496 GAACAAGCCCAGAGATATACAGG + Intergenic
1044939307 8:97324475-97324497 AAACAAACAAACAAATAAATCGG - Intergenic
1045292058 8:100842184-100842206 GACAAAACCCACAATTATTTTGG + Intergenic
1045531152 8:102986691-102986713 GAGGAAGCCCACAAATATCTAGG + Intergenic
1046400765 8:113700941-113700963 GAACAAACAAACAAAAATCTAGG - Intergenic
1047634561 8:126746183-126746205 AAACAAATCCACATATCTATAGG + Intergenic
1048489657 8:134880793-134880815 TAACAAAACCACAAATTTAGTGG - Intergenic
1049150193 8:141030060-141030082 GCACATACCCAGAAATATAGAGG - Intergenic
1049604438 8:143522615-143522637 ACACACACACACAAATATATTGG + Intronic
1050021646 9:1290902-1290924 ACACACACACACAAATATATTGG - Intergenic
1050107545 9:2181415-2181437 GAAAAATCCCACAACTCTATTGG - Intronic
1050655554 9:7824749-7824771 AAACAAACCCTCAAATACAATGG + Intronic
1051244230 9:15092917-15092939 AAACAAACACAAAGATATATGGG - Intergenic
1052777631 9:32749272-32749294 GAACAATCTTACAAATATAGTGG - Intergenic
1052961419 9:34300875-34300897 GAAAAAACCCACAACTAAAGTGG + Intronic
1053085945 9:35221963-35221985 AAACAGACCCACACACATATGGG - Intronic
1053730284 9:41047908-41047930 AAACAAACAAACAAACATATGGG - Intergenic
1054698218 9:68384157-68384179 AAACAAACAAACAAACATATGGG + Intronic
1055239055 9:74162250-74162272 AAACAACCCCACTAATAAATGGG + Intergenic
1055321851 9:75089679-75089701 GAAAAAACCCAAGAATACATCGG - Intronic
1055844779 9:80548344-80548366 ATACAAACCCTAAAATATATAGG + Intergenic
1056115570 9:83438185-83438207 GAAGCAAGCCACAAAAATATGGG + Intronic
1056598877 9:88030412-88030434 GAAAAAACCCACACAGACATGGG - Intergenic
1057219713 9:93250170-93250192 GAACACACACACAAATACATAGG + Intronic
1057719254 9:97518894-97518916 GGACAAATCCACAAATATCTGGG + Intronic
1059088368 9:111329445-111329467 TTACAAACTCACAAAGATATGGG - Intergenic
1059448563 9:114355684-114355706 AAACAAACACACATTTATATCGG + Intronic
1059558241 9:115304348-115304370 AAACAAACAAACAAATATAATGG - Intronic
1062134827 9:134920075-134920097 GAACAAAACCATAAAAAGATTGG + Intergenic
1062758585 9:138323057-138323079 CAACAAAAGCAAAAATATATGGG - Intergenic
1186138227 X:6542831-6542853 GTACACACACACATATATATGGG - Intergenic
1186354860 X:8780433-8780455 GAACAAATCCACCATTATATTGG + Intergenic
1186514258 X:10154504-10154526 AAACACACACACATATATATGGG + Intergenic
1187240083 X:17504554-17504576 GAAAAAGCCCAAGAATATATGGG - Intronic
1187964741 X:24600308-24600330 GAACAAACTGACAAATCTACAGG + Intronic
1188693422 X:33158139-33158161 GGACCAACACAGAAATATATAGG - Intronic
1188864070 X:35292763-35292785 GAACAAACTCAAAAATATTTTGG - Intergenic
1189849232 X:45162527-45162549 GTGCAAACCCACAATTATATTGG + Intronic
1189876596 X:45442561-45442583 GTACAAAGCTACAATTATATAGG - Intergenic
1190775417 X:53548795-53548817 AAAAAACCCCAGAAATATATAGG + Intronic
1190822033 X:53982635-53982657 AAACAAATCCCCATATATATGGG + Intronic
1192257690 X:69478399-69478421 AAACAGACCCACACATATATAGG + Intergenic
1192361334 X:70442348-70442370 GAGAAAACCCACACATACATGGG - Intergenic
1192878313 X:75255449-75255471 AAACAAAATCAAAAATATATAGG + Intergenic
1193352149 X:80475868-80475890 TAAAAAACCCCAAAATATATGGG - Intergenic
1193668563 X:84354991-84355013 GCACACACACACACATATATAGG + Intronic
1193753670 X:85379501-85379523 GAACAAACAGAGAAATATAATGG + Intronic
1194722714 X:97359437-97359459 GCACACACACACACATATATAGG - Intronic
1194899291 X:99488699-99488721 GATCAAACCAACAAAAATTTGGG - Intergenic
1195454684 X:105054249-105054271 GAGAAAACCCACATAGATATGGG + Intronic
1195501559 X:105606936-105606958 ATACAAACCTACAACTATATAGG + Intronic
1196486110 X:116209636-116209658 AAATAAACTCACACATATATGGG + Intergenic
1199149014 X:144406844-144406866 GATCAAAGACACAAATAAATGGG + Intergenic