ID: 1153560030

View in Genome Browser
Species Human (GRCh38)
Location 18:6362429-6362451
Sequence CTCTGTTAGCAGAAGGAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 326
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 306}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153560030_1153560040 27 Left 1153560030 18:6362429-6362451 CCTCTCTCCTTCTGCTAACAGAG 0: 1
1: 0
2: 1
3: 18
4: 306
Right 1153560040 18:6362479-6362501 CCCCAGCCACCTGGGTCTAGTGG 0: 1
1: 0
2: 3
3: 31
4: 339
1153560030_1153560043 30 Left 1153560030 18:6362429-6362451 CCTCTCTCCTTCTGCTAACAGAG 0: 1
1: 0
2: 1
3: 18
4: 306
Right 1153560043 18:6362482-6362504 CAGCCACCTGGGTCTAGTGGAGG 0: 1
1: 0
2: 1
3: 24
4: 228
1153560030_1153560032 -9 Left 1153560030 18:6362429-6362451 CCTCTCTCCTTCTGCTAACAGAG 0: 1
1: 0
2: 1
3: 18
4: 306
Right 1153560032 18:6362443-6362465 CTAACAGAGCCCCTCTCTGCTGG 0: 1
1: 0
2: 0
3: 12
4: 171
1153560030_1153560036 18 Left 1153560030 18:6362429-6362451 CCTCTCTCCTTCTGCTAACAGAG 0: 1
1: 0
2: 1
3: 18
4: 306
Right 1153560036 18:6362470-6362492 CTGCTCCTTCCCCAGCCACCTGG 0: 1
1: 1
2: 8
3: 67
4: 827
1153560030_1153560037 19 Left 1153560030 18:6362429-6362451 CCTCTCTCCTTCTGCTAACAGAG 0: 1
1: 0
2: 1
3: 18
4: 306
Right 1153560037 18:6362471-6362493 TGCTCCTTCCCCAGCCACCTGGG 0: 1
1: 0
2: 5
3: 127
4: 2800

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153560030 Original CRISPR CTCTGTTAGCAGAAGGAGAG AGG (reversed) Intronic
901211166 1:7526810-7526832 CTCTGTTAGCAGATGGGGCTGGG + Intronic
901310749 1:8267722-8267744 CTCTATTAGCAGCATGAGAATGG - Intergenic
902557509 1:17255626-17255648 GTGTGTTAGGAGAATGAGAGGGG - Intronic
902755224 1:18545006-18545028 CTCTGTGAGCAGAGGGCGAGAGG + Intergenic
903874742 1:26465958-26465980 CTCTGTTGGCACCTGGAGAGAGG - Intronic
904558609 1:31381944-31381966 GTCTGTTAGCAGAAGCAGATGGG - Intergenic
905994694 1:42371404-42371426 CTCTAGTAGCAGAACCAGAGAGG + Intergenic
908313296 1:62907242-62907264 CTCCATAAGCACAAGGAGAGGGG + Intergenic
909684766 1:78335441-78335463 CTTTCTTAGAGGAAGGAGAGTGG + Intronic
911650368 1:100381193-100381215 CTCTGGAAGCAAAAGGAGAAAGG - Intronic
911654481 1:100427834-100427856 CTTTGTTAGAATTAGGAGAGAGG + Intronic
915492768 1:156260544-156260566 CTCTGGGAGCAGAAGGCTAGAGG + Exonic
917472306 1:175336457-175336479 CACTGTTAGCAGAGCGAGAGAGG + Intronic
919067724 1:192714299-192714321 CTCTTCAAGCAGAAGGAAAGAGG - Intergenic
920692895 1:208160143-208160165 CTCTGGTAGCAGAAGGAGTGAGG - Intronic
921374890 1:214463625-214463647 CTTTGTAAGCAGGTGGAGAGAGG + Intronic
922980725 1:229824417-229824439 CTCTGTCAGAACAAAGAGAGGGG - Intergenic
923288024 1:232515694-232515716 CTTTGTGGGCAGAAGCAGAGGGG - Intronic
924386807 1:243506745-243506767 GTCTATTTGCAGAAGAAGAGAGG - Intronic
1063914939 10:10871782-10871804 CACTGGGAGCTGAAGGAGAGAGG + Intergenic
1064158692 10:12925041-12925063 CTCTGTGTGTTGAAGGAGAGGGG + Intronic
1064321241 10:14306984-14307006 CTATGTTAGGAGTAGGAGTGTGG - Intronic
1065627834 10:27649639-27649661 CTCAGTGAGCAAGAGGAGAGTGG - Intergenic
1068545668 10:58342452-58342474 CTCTGCTCGCATAAGGAGGGTGG - Intronic
1069710347 10:70483798-70483820 CTCTGTGACCAGCAGGAAAGGGG - Intronic
1070616225 10:77971394-77971416 CTCTGTTAGCAAAGAAAGAGGGG - Intronic
1071085127 10:81861420-81861442 CTATGTAAGCAGGAGGTGAGGGG - Intergenic
1071787097 10:88913400-88913422 CCCTGTTTACAGGAGGAGAGTGG - Exonic
1072457929 10:95592903-95592925 TTCTGTTAGCAGATGGGGTGAGG + Intergenic
1072470520 10:95708907-95708929 CTCTGGTAGCAAAAGAACAGCGG + Intergenic
1072617513 10:97059535-97059557 CAAGGTGAGCAGAAGGAGAGGGG + Intronic
1072705153 10:97675693-97675715 CTCTGTGATCAGAAGGAAATTGG + Exonic
1072744096 10:97928005-97928027 GACTGTTAGGAGCAGGAGAGAGG + Intronic
1073034129 10:100551360-100551382 ATCTGTTAGGAGACAGAGAGGGG + Exonic
1073761038 10:106629082-106629104 ATCTTTTAGCAGAAGGGGAATGG - Intronic
1074769775 10:116725633-116725655 CTTTGCTGGCAGAAGGAGTGGGG + Intronic
1076049007 10:127317780-127317802 CACTGCTAGCAGCATGAGAGTGG - Intronic
1078427778 11:11265594-11265616 ATCTGACAGCAGATGGAGAGGGG + Intergenic
1078460473 11:11511410-11511432 CTCTGTTAGCTGTAGGGGACTGG - Intronic
1078929699 11:15903660-15903682 TTCTGTGAGCAGAGGCAGAGGGG - Intergenic
1079795919 11:24802901-24802923 GTCTGGTAGAAGAAGGAGAAAGG - Intronic
1084298564 11:68229658-68229680 CTTTGTTAGCAGCATGAGAATGG - Intergenic
1086395681 11:86412951-86412973 CTGTCTTATCACAAGGAGAGAGG + Intronic
1087091162 11:94274569-94274591 CTCCAGCAGCAGAAGGAGAGAGG - Intergenic
1087182754 11:95156002-95156024 CCCTGTTACCTGAAGGACAGGGG + Intergenic
1087374770 11:97326860-97326882 CTCTGTTGGCAGGAGAACAGTGG + Intergenic
1087675777 11:101159307-101159329 CTTTGTTAGCAGCATGAGAATGG + Intergenic
1088547954 11:110980675-110980697 TGCTATTACCAGAAGGAGAGGGG + Intergenic
1088748371 11:112823240-112823262 CTGTTATAGCAGAAGGAGACAGG + Intergenic
1089940462 11:122411087-122411109 CTCTGGTTGCAGCAGAAGAGAGG + Intergenic
1090172044 11:124613647-124613669 CTCTGTTAGGGGAGGGAAAGAGG + Intronic
1094631015 12:32173949-32173971 CTCTGTGGGAAGAAGCAGAGTGG - Intronic
1095874691 12:47067918-47067940 CTCTGTTAGCAGATGCTGAGAGG + Intergenic
1097957290 12:65499241-65499263 TTCTGATGGCAGAAGGAAAGGGG + Intergenic
1099135666 12:78896616-78896638 CTCTGTTTACATGAGGAGAGAGG - Intronic
1100378852 12:94043228-94043250 CTTTATTAGCAGAATGAGAATGG - Intergenic
1100762701 12:97826881-97826903 CTCATGTGGCAGAAGGAGAGAGG - Intergenic
1100814966 12:98378006-98378028 CTCTGTCAGTAGAAGGACATTGG + Intergenic
1102172018 12:110849453-110849475 TTCTAAAAGCAGAAGGAGAGAGG + Intronic
1102241945 12:111329968-111329990 CACTGTCGGCAGCAGGAGAGGGG - Intronic
1103024286 12:117560879-117560901 GTCTTATAGCAGAAGGAGAAGGG - Intronic
1104190286 12:126475607-126475629 CTTTATTAGCAGAATGAGAATGG - Intergenic
1106822353 13:33479235-33479257 CTCTTTTAGCAAGAGGAAAGAGG + Intergenic
1108888238 13:55218608-55218630 CTCAATTAGCAAAAGCAGAGAGG + Intergenic
1109189376 13:59307098-59307120 CTTTATTAGCAGAGTGAGAGCGG - Intergenic
1110597853 13:77338715-77338737 CTCTATTAGCAGGAGTAGATAGG + Intergenic
1110726898 13:78836488-78836510 CTCTTTCAGCAGAAAGAGTGAGG + Intergenic
1111505572 13:89184588-89184610 CTCTATTAGCAGCATGAGAAAGG - Intergenic
1112939110 13:104839475-104839497 AGCTGTAAGAAGAAGGAGAGGGG - Intergenic
1113156251 13:107326278-107326300 CTCATTTATCAGAAGGAGAATGG - Intronic
1113523675 13:110957544-110957566 ATCTGTTGTCAGCAGGAGAGGGG + Intergenic
1113755082 13:112805280-112805302 CTCTGGTACTAGAAGGAAAGGGG - Intronic
1114601031 14:23955531-23955553 CTCTATAAGCTGAAGAAGAGGGG - Intronic
1114605242 14:23990678-23990700 CTCTATAAGCTGAAGAAGAGGGG - Intronic
1114610715 14:24038310-24038332 CTCTGTAAGCTGAAGAAGAGGGG - Intergenic
1117412077 14:55459292-55459314 CTCTCGTAGCAGAGGGAGAGAGG + Intergenic
1118170889 14:63387420-63387442 CTGTGTGTGCAGAAGGACAGTGG - Intronic
1118387555 14:65268943-65268965 CGCTGTGATCAGAAGCAGAGTGG + Intergenic
1118809468 14:69262308-69262330 CTCTGGAAGGAGCAGGAGAGAGG - Intronic
1121515580 14:94547808-94547830 CTTTGTTAGCAGCATGAGAATGG + Intergenic
1121534568 14:94682291-94682313 CGCTGTCACCAGGAGGAGAGGGG + Intergenic
1122260717 14:100520195-100520217 CTCTGTCCACAGAAGGAGTGTGG - Intronic
1122871658 14:104641525-104641547 CTCTGTGAGCGTAAGCAGAGGGG - Intergenic
1127275074 15:57436171-57436193 TTCTGTTAGTAAAAAGAGAGAGG - Intronic
1127787145 15:62365621-62365643 CTTTATTAGCAGAATGAGAACGG + Intergenic
1128290695 15:66476366-66476388 CTCTGCTAGGAGAATGTGAGAGG + Intronic
1128785809 15:70396052-70396074 CTCTATTAGCAGAGGGAGACGGG + Intergenic
1129120671 15:73394559-73394581 CTCTGCTGGAAGAAGGAAAGAGG + Intergenic
1129125645 15:73438651-73438673 CACTGATAGCAGAGGGAGACAGG + Intergenic
1129166946 15:73784072-73784094 CTTTATTAGCAGCAGGAGAATGG + Intergenic
1129171613 15:73811551-73811573 CTCTGTTACAAGAAGAAGGGTGG - Intergenic
1129239113 15:74241215-74241237 CTCAGTCAGAGGAAGGAGAGGGG + Intronic
1129709104 15:77811179-77811201 CTCTGTTGGCAGAAGCAGCTGGG - Intronic
1130894911 15:88162454-88162476 ATCAGCCAGCAGAAGGAGAGGGG + Intronic
1131905030 15:97133756-97133778 CTTTGTTAGCAGCATGAGAATGG + Intergenic
1133218285 16:4306766-4306788 TTCTGGTGGCAGGAGGAGAGAGG - Intergenic
1136655170 16:31705328-31705350 CTCTGTCAGGAACAGGAGAGAGG - Intergenic
1137338833 16:47578468-47578490 CTCTGGTAGAAGAAGGGGTGAGG + Intronic
1139471249 16:67179261-67179283 CTCTGTAAGCAGAGGGCGGGAGG + Intronic
1141159532 16:81619908-81619930 TTCTGTTAGCAGACCGAGAAAGG + Intronic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1141799595 16:86297875-86297897 CTCTGTCTGCAGAAGCAGATTGG + Intergenic
1142152003 16:88516789-88516811 CTCTCTTTGTAGAAGGAGAAGGG + Intronic
1143724389 17:8835455-8835477 CTCTGAGGGCAGAAGCAGAGGGG + Exonic
1144332087 17:14234243-14234265 ATCTGATGGCAGAAGGAGACTGG - Intergenic
1144366852 17:14552887-14552909 GTCTCTTAGAAGTAGGAGAGAGG + Intergenic
1144765408 17:17729883-17729905 CTATGTTAGCAAAGGTAGAGTGG + Intronic
1145845356 17:28033902-28033924 AACTGTTAGCAGAAGGCAAGAGG - Intergenic
1146254937 17:31386425-31386447 TTCTGTGAGCAAAAGCAGAGAGG - Intergenic
1146901638 17:36592673-36592695 CTCTGTTCGCCCCAGGAGAGTGG - Intronic
1148743886 17:49907871-49907893 CACTGTGCCCAGAAGGAGAGAGG - Intergenic
1148813555 17:50310639-50310661 CTCTGTTAACAGAAACGGAGAGG - Intergenic
1150465408 17:65388490-65388512 CTGTGTGAACAGAAGGATAGTGG - Intergenic
1150919498 17:69468334-69468356 TTCTGGTGGCAGATGGAGAGTGG - Intronic
1152900722 17:82939566-82939588 CTCTGATAGGAGGAGGAAAGAGG + Intronic
1153560030 18:6362429-6362451 CTCTGTTAGCAGAAGGAGAGAGG - Intronic
1156023008 18:32620923-32620945 CTTTATTAGCAGAATGAGAATGG + Intergenic
1157615880 18:48987439-48987461 ATCTGGGAGCAGAAGGAGAAAGG - Intergenic
1157776934 18:50403202-50403224 CTCTCTCAGCAGGAGGAGGGGGG - Intergenic
1158240043 18:55367346-55367368 GTATGTTTGCAGAAGGAGGGAGG - Intronic
1159178982 18:64876890-64876912 CTTTATTAGCAGAATGAGAATGG - Intergenic
1160280330 18:77484346-77484368 TTCTGGTAGCAGCAGGAGAAAGG + Intergenic
1160294790 18:77628102-77628124 CTCTATTAGCAGCATGAGAATGG - Intergenic
1160741311 19:687325-687347 CTGTGTTGGCAGAAGGAACGGGG - Intronic
1161456781 19:4373616-4373638 CTCTGGCAGCAAAAGGACAGTGG + Intronic
1164063541 19:21695167-21695189 CTCTCTCAGCAGGAGGAGAGGGG + Intergenic
1164820126 19:31243602-31243624 CTCAAATAGCAGAAGCAGAGGGG + Intergenic
1165272772 19:34724775-34724797 CTCTCTCAGCAGGAGGAGGGGGG - Intergenic
1165649607 19:37474346-37474368 CATTGTTAGCAGGAGCAGAGAGG + Intronic
1166088543 19:40492881-40492903 CTCTGGTAGCAGATGGTGAGTGG + Intronic
1166884887 19:45954316-45954338 CTCTGCTTCCAGAAGGGGAGGGG - Intronic
1167283656 19:48586442-48586464 CTCTGTATCCAGAAGCAGAGAGG + Intronic
1202647014 1_KI270706v1_random:152498-152520 CTCTCTTCGGAGGAGGAGAGGGG - Intergenic
925001340 2:405219-405241 CTCAGATGGCAGCAGGAGAGAGG + Intergenic
925615419 2:5740615-5740637 CTTTGAGAGCAGAAGGTGAGCGG - Intergenic
925824282 2:7832303-7832325 CTGTGTTACCAGAAGGAGCATGG + Intergenic
926039042 2:9658026-9658048 CTCTGTGAGCAGAAGGTGGAGGG - Intergenic
926618062 2:15019443-15019465 CTCTGTTAGCAGGTGGAAAGAGG + Intergenic
927308032 2:21596185-21596207 CTTTATTAGCAGAATGAGAATGG + Intergenic
928466955 2:31531288-31531310 CTATGGTAGCAGATGGAGAGGGG - Intronic
929162517 2:38846673-38846695 GTCTGTTTGCTGAAAGAGAGGGG + Intronic
929300248 2:40295904-40295926 CTTTGTGAGCAGGAGGAGAAGGG + Intronic
929335806 2:40743756-40743778 TGCTGTTGGAAGAAGGAGAGGGG + Intergenic
930295846 2:49552685-49552707 TTCTGTTAGCTGTAGAAGAGGGG - Intergenic
932432654 2:71685174-71685196 CGCTGTGGGCAGAAGCAGAGTGG + Intronic
932440828 2:71733771-71733793 CTTTGTTAGCAGCATGAGAATGG - Intergenic
934891439 2:98073891-98073913 CTCAGATGGCAGAAGGAGAAAGG + Intergenic
937135190 2:119545574-119545596 CCCTGTTAGCAGAGGGATGGAGG + Intronic
939024638 2:136997609-136997631 TTCTGATAGCAGAAGCATAGAGG + Intronic
941513169 2:166438408-166438430 CTTTATTAGCAGCATGAGAGTGG + Intronic
941915470 2:170810363-170810385 CTCTCTTAGGAAAGGGAGAGAGG - Intergenic
943539086 2:189189234-189189256 CTCTATCAGGAGAAGAAGAGAGG - Intergenic
943605998 2:189977296-189977318 CTCTATTAGGGCAAGGAGAGTGG - Intronic
943738505 2:191385002-191385024 CCTTGTTAGCAGAAGGGGAGAGG + Intronic
943836319 2:192518132-192518154 CTCTGGTGGCAGAAGAAGGGGGG - Intergenic
944005761 2:194903302-194903324 CTCACTTAGCAGAAGGGGTGAGG - Intergenic
944317263 2:198296236-198296258 CTCTGGAAGGAGGAGGAGAGAGG + Intronic
944458279 2:199917838-199917860 CTCTATTAGCAGCATGAGAATGG - Intronic
945892258 2:215442564-215442586 CTCTGTTTGCTGGAGGACAGAGG + Intergenic
948871208 2:240799147-240799169 GTCTGTCTGCAGAAGGAAAGGGG + Intronic
948871216 2:240799185-240799207 GTCTGTCTGCAGAAGGAAAGGGG + Intronic
948871228 2:240799245-240799267 GTCTGTCTGCAGAAGGAAAGGGG + Intronic
948887398 2:240891121-240891143 GTCTGTGAGAGGAAGGAGAGGGG - Intronic
1170704509 20:18733176-18733198 CTCAGTGGGCAGAAGGAGGGTGG + Intronic
1173943557 20:46932402-46932424 CTCTGTTAGATGTAGGTGAGGGG + Intronic
1174296265 20:49547449-49547471 CTCTGTAAAATGAAGGAGAGAGG - Intronic
1174590840 20:51643540-51643562 CTCTCGCAGCAGAAGGAGCGAGG - Intronic
1174647009 20:52095154-52095176 TTCTGTTACCAAGAGGAGAGGGG - Intronic
1175468981 20:59212296-59212318 ATCTGTAAGCAGAAGGCCAGAGG + Intronic
1176604855 21:8820276-8820298 CTCTCTTCGGAGGAGGAGAGGGG + Intergenic
1178274942 21:31228731-31228753 CTTTGTTAGCAGCATGAGAATGG - Intronic
1178889653 21:36510414-36510436 CTCTGGTGTCAGTAGGAGAGTGG + Intronic
1179052841 21:37903462-37903484 CTTTGTTAGCAGCATGAGAATGG + Intronic
1179799037 21:43802366-43802388 CTCAGGTTGCAGCAGGAGAGAGG + Exonic
1180347145 22:11711881-11711903 CTCTCTTCGGAGGAGGAGAGGGG + Intergenic
1180354893 22:11829971-11829993 CTCTCTTCGGAGGAGGAGAGGGG + Intergenic
1180383358 22:12162360-12162382 CTCTCTTCGGAGGAGGAGAGGGG - Intergenic
1180572219 22:16736868-16736890 TAATGTTAGCAGAAGGAGTGTGG + Intergenic
1183236220 22:36620250-36620272 ATCTGTTTGCAGAGGGAAAGTGG + Intronic
1183280009 22:36927031-36927053 CTCTGCCAGCAGCAGTAGAGAGG - Intronic
1183310962 22:37109331-37109353 ATCAGTGAGCAGAAGGTGAGGGG - Intronic
1184386263 22:44176737-44176759 CTCTTTTAGCAGCATGAGAATGG - Intronic
1185014449 22:48334955-48334977 CTCTGTGAACTGAAGGAAAGAGG + Intergenic
1185023660 22:48395322-48395344 CGATGTTACCAGGAGGAGAGGGG + Intergenic
1185194806 22:49462444-49462466 CTGCGTTAGCAGAGGGGGAGCGG - Intronic
949932478 3:9089699-9089721 TTCTGTTAGTAGAAGGAGGAAGG - Intronic
950572088 3:13807602-13807624 CTCAGTTTGCAGAAGGGAAGAGG - Intergenic
950658523 3:14452291-14452313 CTCTGTAAACAGAAGTAGCGTGG + Intronic
950769631 3:15301224-15301246 CTAGGTAAGCAGATGGAGAGTGG - Intronic
951064289 3:18246413-18246435 CTGTGTAAGCAGAACAAGAGAGG - Intronic
952577648 3:34794406-34794428 CTCAGTTGGCAGAAGGAGGTGGG - Intergenic
953492031 3:43360705-43360727 CTCTGTTACCAGAAGGTCAAAGG - Intronic
954468460 3:50672661-50672683 CTCTGTAGTCAGATGGAGAGAGG + Intergenic
957934162 3:86920967-86920989 CTCTGTGACCAGAATGAGATTGG + Intergenic
959054783 3:101556658-101556680 CTCAGTTTACAGAAGGGGAGTGG - Intergenic
959211334 3:103386666-103386688 CTCTGTTACCAGATGGTGTGGGG - Intergenic
959914307 3:111798879-111798901 CTTTATTAGCAGCATGAGAGTGG - Intronic
960350912 3:116591560-116591582 GTCAGTGAGCAGGAGGAGAGGGG - Intronic
961511085 3:127404153-127404175 CCCTGGTACCAGATGGAGAGGGG - Intergenic
961554934 3:127691029-127691051 CTCTGGTGGCAGGAGAAGAGAGG - Exonic
963580612 3:147122548-147122570 CTGTATATGCAGAAGGAGAGTGG - Intergenic
964834345 3:160920702-160920724 CCCTTTTAGCAGTAGGAGGGTGG + Intronic
964931079 3:162023981-162024003 CTCTGTTATCAGAAGGACTTTGG - Intergenic
965425584 3:168518653-168518675 CTTTATTAGCAGAATGAGAATGG - Intergenic
967324741 3:188227982-188228004 TGCTGTTAGGAGAGGGAGAGAGG + Intronic
969883684 4:10196638-10196660 CTCTGTCAGCAGAAGGTGGGGGG + Intergenic
970413861 4:15837314-15837336 CTCTGTTATCAGAAAAAGAAAGG - Intronic
970417255 4:15871556-15871578 CTCTGGAAGGAAAAGGAGAGTGG + Intergenic
970560693 4:17279352-17279374 CTCTATAAGGAGAAGGAGATGGG - Intergenic
972199203 4:36693086-36693108 CTCTCTTACCAGAAGGAGGAGGG - Intergenic
973288121 4:48442139-48442161 TTCTGTTAGCGGTAGAAGAGGGG + Intergenic
973373267 4:49270661-49270683 CTCTCTTCGGAGGAGGAGAGGGG - Intergenic
973387739 4:49524547-49524569 CTCTCTTCGGAGGAGGAGAGGGG + Intergenic
974467014 4:62270788-62270810 ATCTCTTAGCAGAATGAGAATGG + Intergenic
975406886 4:73999899-73999921 CACAGATAACAGAAGGAGAGAGG - Intergenic
975495258 4:75029637-75029659 CTTTGTTAGCAGCATGAGAATGG + Intronic
979112027 4:116770831-116770853 CTCTATTAGCAGAACGAGGAGGG - Intergenic
980726485 4:136768153-136768175 TTATGTTAGTAGAAGGAGAAAGG + Intergenic
981594020 4:146398905-146398927 CTGTGTAAGCAGCAGGAGAACGG + Intronic
981937587 4:150251943-150251965 CTCTGTCTGGAGAGGGAGAGAGG - Intronic
982050789 4:151499601-151499623 CTTTATTAGCAGCATGAGAGTGG - Intronic
982160772 4:152567314-152567336 TGCTGTTATCAGAAGGAGATTGG - Intergenic
984571285 4:181397395-181397417 CTTTATTAGCAGCATGAGAGTGG - Intergenic
985300411 4:188482410-188482432 CTATGTCTGCAGGAGGAGAGTGG + Intergenic
985359493 4:189156497-189156519 TTCTGATAGTAGAAGTAGAGGGG - Intergenic
986640456 5:9867284-9867306 CTTTATTAGCAGCATGAGAGTGG - Intergenic
986749670 5:10775873-10775895 CTCTGCTGGCAGGTGGAGAGTGG - Intergenic
987134955 5:14891794-14891816 GCCTGTTAGCAGGAGGTGAGTGG + Intergenic
989523753 5:42429059-42429081 CTTTGTTAGCAGCATGAGAATGG - Intronic
990336358 5:54776568-54776590 CTTTCTTAGCAGAATGAGAATGG - Intergenic
991215132 5:64151434-64151456 CTTTGTTGGCAGATGGGGAGGGG - Intergenic
991414559 5:66379141-66379163 CATTGTAGGCAGAAGGAGAGGGG + Intergenic
993748476 5:91633025-91633047 CTGTGTCAACAGAAGGAAAGTGG + Intergenic
994542434 5:101116888-101116910 CTTTGTTAGCAGCATGAGAATGG + Intergenic
995345917 5:111117331-111117353 CTCTTTTAGCAAATTGAGAGAGG + Intronic
996250939 5:121331294-121331316 CTTTATTAGCAGAATGAGAATGG + Intergenic
996681755 5:126235335-126235357 CTTTGTTATCAGAAAGAGAAAGG - Intergenic
999695614 5:154186239-154186261 CTGCTTTAGCACAAGGAGAGGGG + Intronic
1000382191 5:160639115-160639137 AGCTGTGAGCAGAAAGAGAGAGG - Intronic
1001171832 5:169426826-169426848 CACTCATAGCAGAAGGAGAAGGG + Intergenic
1001172813 5:169437134-169437156 CTCTGTTACCAGATTAAGAGAGG + Intergenic
1001175962 5:169469148-169469170 CTCTGTCAGCACAAAGAGAGTGG + Intergenic
1001663908 5:173416700-173416722 CTTTGTTAGCAGCATGAGAATGG + Intergenic
1001896189 5:175383514-175383536 CTTTGTTGGCAGAGTGAGAGTGG - Intergenic
1002451354 5:179320620-179320642 CTGTGCTATCAGAAGGAGAAGGG - Intronic
1002721789 5:181265734-181265756 CTCTGGCTGCAGTAGGAGAGAGG + Intergenic
1004813629 6:19288322-19288344 CTTTGTTAGCAGCATGAGAATGG - Intergenic
1006338471 6:33432972-33432994 ATCTGTGAGCAGCAGGAGAGGGG + Intronic
1006683581 6:35814432-35814454 GGCTGTTAACAGAAGGAGAAGGG + Intronic
1006812952 6:36832291-36832313 TTCTGTCAGCAGGAAGAGAGTGG - Intronic
1008646470 6:53519474-53519496 CTGTGCTAGCAGGAGGAGATGGG - Intronic
1010653706 6:78486250-78486272 TTCTGTTAGCAGAAGCTGAGAGG - Intergenic
1010712913 6:79196100-79196122 CTTTATTAGCAGCAGGAGAATGG - Intergenic
1011084466 6:83523789-83523811 ATCTGTTAGGAGAAAGAGACAGG + Exonic
1011326884 6:86158251-86158273 CACTATTAGAGGAAGGAGAGAGG + Intergenic
1011384573 6:86781287-86781309 CTGTGTTAACAGAAGCATAGCGG - Intergenic
1011501939 6:88000177-88000199 CTCTCTTAGCAGAATGAGCTTGG - Intergenic
1011927858 6:92670760-92670782 ATCTGATAGCAGAAGGTGAGAGG - Intergenic
1013912054 6:115287688-115287710 CTGTGGTAGCAGTAGGAGAATGG - Intergenic
1014325416 6:119986948-119986970 CTGTCTTATCAGAAGGACAGAGG - Intergenic
1014673467 6:124336164-124336186 TTCTGTTAACAGAAGAATAGAGG - Intronic
1015548864 6:134391465-134391487 TTTTGCTAGCAGAATGAGAGGGG + Intergenic
1016747194 6:147593256-147593278 CTCTGTTAGGATAGGGAGACAGG - Intronic
1019866738 7:3718747-3718769 CTCTGTTAAGAGTGGGAGAGCGG - Intronic
1021629042 7:22625476-22625498 CCCTGTCAGCAGAGGCAGAGAGG + Intronic
1022600592 7:31755348-31755370 CTCTATCAGCTGAAGGGGAGGGG + Intronic
1022770196 7:33462814-33462836 CTCTTTTTGCAAAATGAGAGTGG + Intronic
1023016734 7:35975957-35975979 CTTTATTAGCAGAAAGACAGTGG - Intergenic
1023998133 7:45174485-45174507 CCCGGGTAGCAGAAGGAGCGTGG - Intronic
1024397720 7:48888398-48888420 GACTGTTAGGAGAATGAGAGTGG - Intergenic
1024757811 7:52556898-52556920 CTCTTTTAGCTGAAAGAGAATGG + Intergenic
1025959508 7:66207412-66207434 CTCTGATCTCAGAAGAAGAGGGG + Intronic
1030563399 7:111120212-111120234 CTCTATTAGCAGCATGAGAACGG - Intronic
1034165333 7:149021133-149021155 CTCTGTTAGAAGAATCTGAGTGG + Exonic
1038037645 8:23700082-23700104 CTGTGTTAGAAGAGGGTGAGAGG + Intergenic
1039071530 8:33653175-33653197 CTTTATTAGCAGCATGAGAGTGG + Intergenic
1042058839 8:64795344-64795366 CTCAGTTTCCATAAGGAGAGTGG + Intronic
1042059978 8:64806037-64806059 CTGTGTTCTCAGAAGCAGAGAGG - Intergenic
1042485436 8:69341581-69341603 CTCTGTTAGCAGAGCTAGGGCGG + Intergenic
1042776031 8:72432408-72432430 CTCTATTAGCAGCATGAGAATGG - Intergenic
1042835048 8:73072108-73072130 CTGTGTGAGAGGAAGGAGAGGGG + Intronic
1044090978 8:88001094-88001116 GCCTGTTGGCAGTAGGAGAGAGG - Intergenic
1045471469 8:102516063-102516085 TGCTGTTAGAAGAAGGACAGTGG - Intergenic
1046350673 8:113006761-113006783 CTACCTTAGCAGAAGGAGACTGG + Intronic
1046355526 8:113080050-113080072 CTCTCTTAGGGGAAGGACAGAGG + Intronic
1046957848 8:120080116-120080138 CTCTGCAACCAGAAGGAGTGAGG - Intronic
1048229109 8:132619889-132619911 CACCGTCAGCAGCAGGAGAGAGG + Intronic
1048357660 8:133666827-133666849 CTCTGATGGCAGTACGAGAGGGG - Intergenic
1048386206 8:133914791-133914813 CTCTGTTTGCTGACTGAGAGTGG - Intergenic
1048669667 8:136703792-136703814 CTCTGTTACTTGAAGTAGAGTGG + Intergenic
1048731780 8:137450013-137450035 CACTGTTAGAAAAAGGATAGTGG + Intergenic
1049056433 8:140240840-140240862 CTCTGTTTTAAGAAGGTGAGTGG - Intronic
1051160287 9:14200008-14200030 CTCTGTTAGCAGCAGCAGTAAGG - Intronic
1055661634 9:78509415-78509437 CTCTGATAGGAGAATGAGATGGG + Intergenic
1056039678 9:82650695-82650717 TTCTGAAAGCAGAAAGAGAGAGG - Intergenic
1056932195 9:90888540-90888562 CTATGTTAGAGAAAGGAGAGCGG + Exonic
1056943428 9:90974577-90974599 CTCTCTTAGGTGAAGGTGAGAGG + Intergenic
1058225788 9:102361072-102361094 CTCTGATAGCAGGAGAAAAGTGG + Intergenic
1058560336 9:106221766-106221788 CTCACTTGGCAGAAGGGGAGTGG - Intergenic
1058926284 9:109667155-109667177 CTCTGGAATCAGAGGGAGAGTGG + Intronic
1059936320 9:119314650-119314672 CTCTGTTAGAATAAGTAGGGTGG - Intronic
1059955363 9:119510215-119510237 GTATGTTATTAGAAGGAGAGAGG + Intronic
1060166994 9:121425587-121425609 CACTCATAGCAGAAGGAGAAGGG + Intergenic
1060230316 9:121820926-121820948 CTCTGCTAGCAGCAGGGAAGGGG + Intergenic
1061521732 9:131122238-131122260 CTCTGATAGCAGATTGAGGGAGG + Exonic
1061746790 9:132745987-132746009 TTCTGTGAGCCGAAGGACAGAGG + Intronic
1062214459 9:135381612-135381634 CTCTATTAGCAGCATGAGAACGG + Intergenic
1203696980 Un_GL000214v1:108664-108686 CTCTCTTCGGAGGAGGAGAGGGG - Intergenic
1203552234 Un_KI270743v1:172365-172387 CTCTCTTCGGAGGAGGAGAGGGG + Intergenic
1186057965 X:5671602-5671624 CTTTATTAGCAGAATGAGAATGG - Intergenic
1187764900 X:22630671-22630693 CCCTGTCAGCAGAGGGAGAAGGG - Intergenic
1188054689 X:25527528-25527550 CTTTATTAGCAGAATGAGAACGG - Intergenic
1193080317 X:77400053-77400075 TTCTGTTTGCAGAAGGAGATTGG - Intergenic
1194339924 X:92695012-92695034 CTTTGTTAGCAGCATGAGAATGG - Intergenic
1194455970 X:94104203-94104225 CTTTGTTAGCAGCATGAGAATGG - Intergenic
1195152363 X:102084928-102084950 CGCTTTCAGCAAAAGGAGAGTGG - Intergenic
1196540156 X:116898618-116898640 CTCTGTTATCACAAAGAGAATGG + Intergenic
1196554840 X:117074307-117074329 CTTTATTAGCAGCATGAGAGTGG - Intergenic
1196654085 X:118198851-118198873 CTCTGCAAGCCAAAGGAGAGAGG + Intergenic
1197411222 X:126118796-126118818 CTTTATTAGCAGTATGAGAGTGG + Intergenic
1198535701 X:137583689-137583711 CTCTGGTAGAATCAGGAGAGAGG + Intergenic
1199508106 X:148589098-148589120 CTCTTTCAGCATAAGGAGGGAGG + Intronic
1200648310 Y:5811795-5811817 CTTTGTTAGCAGCATGAGAATGG - Intergenic
1200764049 Y:7065455-7065477 CTCTATTAGCAGTATGAGAACGG + Intronic
1201589879 Y:15603391-15603413 CTTTATTAGCAGAATGAGAATGG - Intergenic
1201921265 Y:19235107-19235129 CTCTGCCATCACAAGGAGAGAGG - Intergenic