ID: 1153560303

View in Genome Browser
Species Human (GRCh38)
Location 18:6365708-6365730
Sequence GCATTTTTGCAGAAGATGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 303
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 288}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153560303 Original CRISPR GCATTTTTGCAGAAGATGGA AGG (reversed) Intronic
903758259 1:25679091-25679113 GGATTTATGCAGAAGAGAGAAGG + Intronic
904972828 1:34432484-34432506 GCATTTCTCCAGCAGATAGAAGG + Intergenic
905441041 1:37996781-37996803 GCTTTATTGCAGAATCTGGAAGG + Exonic
907138758 1:52164668-52164690 GCATGTCTGCAAAGGATGGATGG - Intronic
908450376 1:64248352-64248374 GCATTTTATCAGAAGAAGGCAGG + Intronic
908773424 1:67616650-67616672 GCAATTTTTCAGAATATTGAAGG + Intergenic
913010227 1:114675957-114675979 GCATTTTTCCAAAATGTGGAAGG + Exonic
919567459 1:199206853-199206875 GCAGAGATGCAGAAGATGGAAGG + Intergenic
920670300 1:207998970-207998992 GCATTTGAGCAGAAGTTTGAGGG - Intergenic
921116077 1:212093003-212093025 GCATTTTTTCATAAGTTTGATGG + Intronic
921453506 1:215338930-215338952 GCATTTTTCCAGAATGTGAAAGG - Intergenic
922428006 1:225517601-225517623 TCATTATTGGAGGAGATGGAGGG + Intronic
1063123992 10:3124198-3124220 GCATTTCTGCAGCAGATGTGGGG + Intronic
1063952490 10:11237065-11237087 GCAATGGTGTAGAAGATGGAAGG + Intronic
1064831716 10:19476084-19476106 GCATTTTTGCCAAAGATTGGGGG + Intronic
1064969739 10:21052753-21052775 GCATTTCTACAGAACATGGCTGG - Intronic
1066974465 10:42354008-42354030 TAATTTTTGTAGAAGATGTAAGG - Intergenic
1067687352 10:48474929-48474951 GCATCATTGCAAAAGATTGATGG - Intronic
1069965001 10:72107510-72107532 GTATTTTTAAAGTAGATGGAAGG - Intronic
1070448684 10:76535229-76535251 GCATTTTTGTGAAAGAAGGAGGG + Intronic
1070983239 10:80666929-80666951 GCCTGTTTGCAGAAGAAAGAGGG + Intergenic
1071188631 10:83075070-83075092 GCATTTTTGGAGAAAAGTGAGGG + Intergenic
1072245815 10:93542933-93542955 GCAGATTTGCAGGAGAGGGAAGG + Intergenic
1072469584 10:95699812-95699834 ACATTTTTGAAGAAATTGGAAGG + Intergenic
1073938511 10:108664600-108664622 TGATATTTGCAGAAAATGGAAGG - Intergenic
1075468454 10:122670122-122670144 GGATTTTAGCAGGTGATGGATGG + Intergenic
1076197759 10:128532419-128532441 GCATTTGTGCAGGAGCCGGAGGG - Intergenic
1077528793 11:3085517-3085539 GCAACTTTGCAGGAGGTGGAAGG - Intergenic
1077656872 11:4027934-4027956 TCATTTTTGGAGAAGAATGATGG + Intronic
1078429310 11:11275699-11275721 TGATTTTTGTAGAAGATGTAAGG + Intronic
1078527638 11:12112236-12112258 GCATCTTTTCAGAGGCTGGAAGG - Intronic
1079453382 11:20616950-20616972 GCAGTTTTACAGAGGATGTATGG + Intronic
1082041126 11:47685903-47685925 GCATTTTTGCATAACATTAAAGG + Exonic
1084930973 11:72555618-72555640 GCATTTTTTCAGAAGTTTGCTGG + Intergenic
1086498486 11:87427834-87427856 GGAAAGTTGCAGAAGATGGAGGG + Intergenic
1086799104 11:91149283-91149305 CCATTATTGCAGATGCTGGAAGG - Intergenic
1087583813 11:100093104-100093126 GCACTGTTGCAGAACATGTATGG - Intronic
1087821460 11:102717395-102717417 GCATTTTTCAAGAAGAAGAAAGG - Intronic
1088397075 11:109380813-109380835 GCAGTTATGCAGAAAATGAAAGG + Intergenic
1090420021 11:126568276-126568298 GCACTGGTGCAGATGATGGATGG + Intronic
1090646780 11:128772865-128772887 TCCTTTTTCCAGAACATGGATGG + Exonic
1091483594 12:860778-860800 CCATTTTTGCAGAAACTCGAAGG - Intronic
1092534646 12:9376664-9376686 GCACGTTTGGAGAAGATTGAGGG - Intergenic
1092931044 12:13316084-13316106 GCATTTTTACAAAAGAATGAAGG - Intergenic
1094106931 12:26823039-26823061 GCATTTTCGCTGAACTTGGAAGG - Intronic
1094569511 12:31629309-31629331 GCCCTTTTGCAGAACATGAAGGG - Intergenic
1095619470 12:44231987-44232009 TCATTTTTACAGAAGAGGCATGG - Intronic
1098214212 12:68198745-68198767 TCATTTTTTCCGGAGATGGAAGG - Intergenic
1098343335 12:69473817-69473839 GCAGGTTTGGAGGAGATGGAAGG + Intronic
1098593759 12:72246224-72246246 GCATTTTTGCTGAAGGTGTAGGG - Intronic
1098717275 12:73846384-73846406 TAATTTTTGTAGAAGATGTAAGG + Intergenic
1099874821 12:88391592-88391614 GGATGGTTGCTGAAGATGGAGGG + Intergenic
1103434605 12:120915151-120915173 GCTTTTGTGGAGAAAATGGAGGG - Intergenic
1104040992 12:125130536-125130558 GCAATGTTACAGAAGATGAAGGG - Intronic
1105219468 13:18312329-18312351 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1106332830 13:28755015-28755037 GCATCACTGCAGAAGATGGCCGG - Intergenic
1107084535 13:36412373-36412395 GAATTGTTGCAGAAGGTGAAGGG + Intergenic
1107487260 13:40840694-40840716 GAATTTTTGTATAAGATGTAAGG - Intergenic
1109020089 13:57079655-57079677 GCATTTTTGTAGAAATTAGATGG - Intergenic
1109096811 13:58129271-58129293 GCATTTTTGTATAAGGTGTAAGG + Intergenic
1112383980 13:98920782-98920804 TCATCATTGTAGAAGATGGAAGG - Intronic
1112501536 13:99946905-99946927 GCATTTTAGCAGGAAGTGGAAGG - Intergenic
1113265730 13:108615939-108615961 GCATTTGTGCAGAGAAAGGAAGG - Intronic
1114433434 14:22682773-22682795 TAATTTTTGTAGAAGATGTAAGG - Intergenic
1115313883 14:32006374-32006396 GGTTTGTTCCAGAAGATGGAAGG + Intergenic
1115340730 14:32290945-32290967 CCATTGCTTCAGAAGATGGAAGG + Intergenic
1115842335 14:37485998-37486020 GAATTTTTGTATAAGATGTAAGG + Intronic
1116132596 14:40876137-40876159 GAATTTTAGAAGAAGATGTAAGG + Intergenic
1116705532 14:48293719-48293741 GTATTTCTGAAGAAGATGCATGG - Intergenic
1118758545 14:68863468-68863490 GCAGAGGTGCAGAAGATGGAAGG + Intergenic
1120040462 14:79747215-79747237 GTAGTTTTGCAGAAACTGGAGGG + Intronic
1122114562 14:99521303-99521325 GCATTCCTGGAGAAGGTGGAAGG + Intronic
1123005972 14:105324043-105324065 GCTTTTGTGCAGGAGATGGAGGG + Intronic
1123219532 14:106843145-106843167 CAAAATTTGCAGAAGATGGAAGG - Intergenic
1125038329 15:35153267-35153289 CCATTGTTGCAGAAGTTGGCAGG - Intergenic
1125536603 15:40444232-40444254 GCATTTCTGGAGAAGCTGAAAGG - Intronic
1125922423 15:43533156-43533178 GCATTTTTGCCCAGGCTGGAGGG + Intergenic
1127401308 15:58588909-58588931 CCATTTTTGCAAAACATGGTCGG + Exonic
1128234654 15:66059353-66059375 GCATTCCTGCAGAAGAGGAAAGG + Intronic
1128624110 15:69181734-69181756 GGAATTTTGCTGAAGAGGGAGGG + Intronic
1129154247 15:73707894-73707916 GCATTAGTGCAGAGGCTGGAAGG + Intronic
1130799364 15:87245620-87245642 GCATTTTGCCATATGATGGATGG + Intergenic
1131524178 15:93139555-93139577 GCACATTTGCAGAGGATGGCGGG + Intergenic
1131641815 15:94301238-94301260 GCATGCTTGCAGAGGACGGAGGG + Intronic
1135205034 16:20476457-20476479 GAACTTTTGCAGAAGGTTGACGG + Intronic
1135580607 16:23622968-23622990 TGACGTTTGCAGAAGATGGAGGG - Exonic
1138060865 16:53888925-53888947 GCACTGTGGAAGAAGATGGAGGG + Exonic
1139286877 16:65823165-65823187 ACGTTTTTGCAGGAGATTGAGGG - Intergenic
1142640832 17:1285015-1285037 GCATTTGGGAAGCAGATGGATGG + Intronic
1147726993 17:42572036-42572058 GCATTTTGGCAGTAGCTGTATGG + Exonic
1148681621 17:49477326-49477348 GCACCCATGCAGAAGATGGAAGG - Intergenic
1150316836 17:64175946-64175968 CCATTTTTGGAAATGATGGAAGG - Intronic
1150500155 17:65643110-65643132 GCCTTTGTGGAGAAAATGGAGGG + Intronic
1151371042 17:73646258-73646280 GCACTGTGGCAAAAGATGGAGGG - Intergenic
1151994842 17:77602035-77602057 GTATTTGTGCTGAAGATGGTGGG + Intergenic
1153560303 18:6365708-6365730 GCATTTTTGCAGAAGATGGAAGG - Intronic
1153707004 18:7756282-7756304 GCATGTTTACAGAAGAATGAGGG - Intronic
1155638878 18:27988762-27988784 GCATTTCTGTAGATGATGGCTGG + Intronic
1157178984 18:45478630-45478652 GCTATTTTGCAGAAAAAGGAAGG + Intronic
1159377114 18:67606473-67606495 GCCTTTTTGCATGAGATGGTAGG - Intergenic
1159821084 18:73144656-73144678 GGATTTTTGCATATGATGAAAGG + Intergenic
1159846721 18:73469935-73469957 TAATTTTTGCAGAAGGTGTAAGG + Intergenic
1160534132 18:79583302-79583324 ACATTTGTGGAGAAGATGGGTGG - Intergenic
1163501955 19:17681417-17681439 GCATTTCAGCGGGAGATGGATGG + Intronic
1163850221 19:19658672-19658694 GCAGTTTTGGTGAAGATGAAGGG + Intronic
1165984810 19:39758709-39758731 GATATTATGCAGAAGATGGAAGG + Intergenic
1167171868 19:47838833-47838855 GCATGTTTGTATTAGATGGATGG + Intronic
1167171880 19:47839069-47839091 GCATGTTTGCATTAGACGGATGG + Intronic
924992927 2:329384-329406 ACATTTTGGGAGAAAATGGAGGG + Intergenic
925139814 2:1542409-1542431 GCATTTTTGCAGGAGAGTGCTGG + Exonic
926905804 2:17804616-17804638 GCAGTTATGCAGAAGATAGGAGG - Intergenic
927181760 2:20451752-20451774 CCATTTTTGCAGAAGAATGTAGG - Intergenic
927224634 2:20751434-20751456 GCAATTTTTCAAAAGAAGGAAGG - Intronic
929347570 2:40905118-40905140 GCTTTTTTGCAGAAATTGGCAGG - Intergenic
929803953 2:45128242-45128264 GGCTTTTTGCAGAGGGTGGATGG - Intergenic
932093619 2:68827935-68827957 GCCTGCTTGCAGAAGATTGAGGG + Intergenic
932182234 2:69657827-69657849 GCATTTATTCACAAGATGAATGG + Intronic
932745958 2:74333776-74333798 GCATTTAGCCAGGAGATGGAAGG - Intronic
934184580 2:89660188-89660210 CCTTCTTTGCAGGAGATGGATGG + Intergenic
934294862 2:91734326-91734348 CCTTCTTTGCAGGAGATGGATGG + Intergenic
934550861 2:95260753-95260775 GCATTCTTGCAGATGAGGCAGGG - Intergenic
934811319 2:97280094-97280116 TAATTTTTGCATAAGATGTAAGG - Intergenic
934826371 2:97427846-97427868 TAATTTTTGCATAAGATGTAAGG + Intergenic
935592951 2:104857251-104857273 GCATTTTTGCAGTCCAAGGAAGG + Exonic
935799066 2:106674642-106674664 TAATTTTTGCATAAGATGTAAGG + Intergenic
936351588 2:111716763-111716785 GCATGTTTTCAGATGAAGGAGGG + Intergenic
939043320 2:137219168-137219190 TCAATTTTGCAGAACATGGCAGG - Intronic
939487198 2:142829391-142829413 TAATTTTTGCACAAGATGGAAGG + Intergenic
940804438 2:158170312-158170334 CCATTTTTGTAAAAGATGTAAGG - Intergenic
941090172 2:161166173-161166195 GTATTTTTCCATAAGCTGGAAGG - Intronic
941119876 2:161515859-161515881 GCATTTTTTCATAAGATTGTTGG - Intronic
942500125 2:176580500-176580522 ACATTTTGGCCAAAGATGGAAGG - Intergenic
942842838 2:180383687-180383709 GCATTTTTTTTTAAGATGGAGGG - Intergenic
943176143 2:184477137-184477159 GTATTGACGCAGAAGATGGATGG + Intergenic
943804464 2:192105723-192105745 ACATATATGCAGAAAATGGAAGG + Intronic
943820217 2:192313232-192313254 TAATTTTTGCAGAAAGTGGAAGG + Intergenic
943847825 2:192674429-192674451 TCATTTTTGAAGAAGATTCATGG + Intergenic
946809406 2:223507671-223507693 GCAATTTCTCAAAAGATGGATGG + Intergenic
948481674 2:238254263-238254285 GCATTCTTCAGGAAGATGGAGGG + Intronic
1169821345 20:9714403-9714425 GCATTTTTACAGAAAATACAAGG - Intronic
1169997490 20:11575078-11575100 TCAGTTTTGCCAAAGATGGAGGG + Intergenic
1170965120 20:21061412-21061434 GTATTTTTACTGGAGATGGATGG - Intergenic
1174916398 20:54658633-54658655 GCATTATTGCAGCACATGGTGGG - Intergenic
1175025800 20:55901391-55901413 TAATTTTTGCATAAGATGTAAGG + Intergenic
1175454646 20:59102852-59102874 GCCTTATTGCAGAAGATGTAAGG - Intergenic
1175693798 20:61086015-61086037 TCATGTTTGTAGAAGCTGGAGGG - Intergenic
1176686311 21:9851327-9851349 GAATATTTTCAGAAGAAGGAAGG - Intergenic
1177040082 21:16097321-16097343 CCATTTTTACATAGGATGGAGGG + Intergenic
1177251681 21:18599632-18599654 TGATTTTTGTAGAAGATGTAAGG + Intergenic
1177982497 21:27931800-27931822 GGATATAAGCAGAAGATGGATGG - Intergenic
1178189421 21:30263465-30263487 GCATCTCTGCAGATGGTGGAGGG + Intergenic
1178278721 21:31262646-31262668 GGATTTTTTCAGTAGTTGGATGG - Intronic
1178357253 21:31919384-31919406 GCATTTGCACAGAAGTTGGAAGG + Intronic
1180817070 22:18797189-18797211 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1181203259 22:21231534-21231556 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1181368913 22:22401058-22401080 CCACTTTAGGAGAAGATGGATGG - Intergenic
1183229181 22:36570237-36570259 GCATGTGTGGACAAGATGGAGGG + Intronic
1203223660 22_KI270731v1_random:63890-63912 CCTTCTTTGCAGGAGATGGATGG + Intergenic
1203267169 22_KI270734v1_random:22910-22932 CCTTCTTTGCAGGAGATGGATGG - Intergenic
949238350 3:1838760-1838782 GTATTTTTGCAGAAAATCCATGG - Intergenic
949645561 3:6089633-6089655 GCATTTATTTAGTAGATGGAGGG - Intergenic
951174779 3:19586546-19586568 TCATTGTTACAGAAGTTGGAGGG + Intergenic
951487939 3:23235072-23235094 GCAATTATGAACAAGATGGAAGG + Intronic
952694985 3:36254453-36254475 TAATTTTTGCATAAGATGTAAGG - Intergenic
952815451 3:37443295-37443317 GAAATTTTGCAGGAAATGGAAGG - Intergenic
954241647 3:49298546-49298568 GCATTGCTGCAGAAAATGTAAGG - Exonic
955259567 3:57373047-57373069 GCATTTTTGGACATGATGAAAGG - Intronic
956519608 3:70089517-70089539 GCATTTTTTAGGCAGATGGACGG + Intergenic
958700117 3:97578339-97578361 GCATTTTTCAAGAAGGAGGAAGG + Intronic
959501409 3:107109967-107109989 TCATTTCTGCATAAGATGGCAGG + Intergenic
959525882 3:107376171-107376193 GCATTTTTGCAAAAAATGGATGG + Intergenic
960233963 3:115259936-115259958 TTATTTTTGCATAAGATGTAAGG - Intergenic
960327042 3:116310073-116310095 GCATTTCTGCAGTAGATAAAAGG - Intronic
960950869 3:122997666-122997688 GCATCTTTGCTGCAGAGGGAGGG - Intronic
961093735 3:124137479-124137501 GCATTTGTGCAGAGGATGTAAGG + Intronic
962430904 3:135318898-135318920 CCATTTGTGCAGAAGATGATTGG - Intergenic
962642022 3:137397484-137397506 TAATTTTTGCACAAGATGTAAGG - Intergenic
964030461 3:152132705-152132727 GAATTTTTGCAAAAGATTTAGGG + Intergenic
964054708 3:152439449-152439471 GCATTTTTGTAGAGGATGTTTGG + Intronic
964640065 3:158899807-158899829 GCATTTAACCAGAGGATGGATGG + Intergenic
964769155 3:160206201-160206223 TCACTTTGACAGAAGATGGATGG - Intergenic
964938139 3:162120013-162120035 GGATTTTAGCAGAAGGTGGCAGG + Intergenic
971672947 4:29587336-29587358 GTAAATTTGCATAAGATGGAAGG + Intergenic
974145321 4:57939685-57939707 ACATTTTTGAAGAAAATAGATGG + Intergenic
975663991 4:76715925-76715947 GCATTTTTGCATATGGAGGAGGG + Intronic
979530324 4:121763989-121764011 GAGCTTTTGCAGAAGATGGGCGG - Intronic
980862914 4:138521131-138521153 TCACTCTTGCAGTAGATGGAAGG - Intergenic
982435692 4:155382122-155382144 GAATGTTTGTAGAATATGGAGGG - Intergenic
983429640 4:167632129-167632151 TCATTTTTGCAGAAGATTTAAGG - Intergenic
983699549 4:170575135-170575157 TTATTTTTGCATAAGATGTAAGG - Intergenic
984212666 4:176869753-176869775 GCATTTTTTCAGAAGAGAGAGGG + Intergenic
984577821 4:181472308-181472330 GTATTATGGCAGAAGGTGGAAGG + Intergenic
985075541 4:186210355-186210377 ACATTTTCGCAGTAGGTGGAAGG - Intronic
986142077 5:5040392-5040414 CCATTTTAGAAGAAGAAGGAAGG + Intergenic
989967375 5:50480745-50480767 GAATTTTTGAAGAATATTGAAGG + Intergenic
991936280 5:71804279-71804301 GCAGTTTTGCATACTATGGATGG - Intergenic
992339641 5:75809550-75809572 GCATTTTTGCAGATGTTTGCTGG + Intergenic
992923236 5:81550024-81550046 GCATTTGTCTTGAAGATGGAGGG - Intronic
992982606 5:82192016-82192038 GCATTTGTGCAGGATTTGGAAGG + Intronic
993529066 5:89003229-89003251 TCCATTTTGCAGAGGATGGATGG + Intergenic
994435147 5:99719960-99719982 GTAGTTTTGCTGAAGATGTAAGG - Intergenic
994586102 5:101711415-101711437 TAATTTTTGTAGAAGATGTAAGG + Intergenic
995383842 5:111566755-111566777 TGATTTTTGCATAAGATGTAAGG + Intergenic
996193230 5:120571067-120571089 GCATTTGAGCAGAGGATGGAGGG + Intronic
996443765 5:123520320-123520342 ATATTCTTCCAGAAGATGGATGG - Intronic
996800839 5:127400834-127400856 GCATTTTTGAAGCAGAAGTAAGG - Intronic
997802744 5:136882882-136882904 CCATTTTCACAGAAGGTGGATGG + Intergenic
998973323 5:147616325-147616347 ACATTTGTTTAGAAGATGGATGG + Intronic
1000462597 5:161541520-161541542 CAATTTATGCAGAAGATGCAAGG - Intronic
1000676043 5:164123820-164123842 GCTATTTTGCAGAAGCTGCAAGG + Intergenic
1000881570 5:166703817-166703839 TCATTTATGTATAAGATGGAAGG - Intergenic
1001024673 5:168214076-168214098 GCTTTTTTGCAGGGGCTGGAGGG - Intronic
1001892098 5:175348205-175348227 GCATATTTGCAGAAGGCTGAGGG - Intergenic
1002028435 5:176411454-176411476 GCATTTGAGCAGAAGCTGAAGGG - Intronic
1002374645 5:178779947-178779969 GCAATGTTACAGAAGATGAAGGG + Intergenic
1002697385 5:181100034-181100056 GCATCTTTGCCGCAGATGGCGGG + Intergenic
1002940094 6:1708331-1708353 GCGTGTTTGGAGAAGCTGGAGGG + Intronic
1006019589 6:31110236-31110258 GCATTTCTGGAGAAGATGCCCGG - Intergenic
1006108598 6:31730795-31730817 GCCTTTGTGGAGAAAATGGAGGG + Exonic
1006790308 6:36696822-36696844 CCATGGTTGCAGAAGAAGGAAGG - Intergenic
1006909691 6:37555833-37555855 TCATTTTTGCAGGAGAAGGTGGG + Intergenic
1006981579 6:38152142-38152164 GCCTTTGTCCAGAGGATGGAGGG - Intronic
1009764144 6:68047588-68047610 ATATTTTTCCAGAACATGGATGG + Intergenic
1011715559 6:90101687-90101709 GCATTTTTGCAGAAATTGACAGG - Intronic
1012155840 6:95819285-95819307 AGAGTTTTGCAGGAGATGGAGGG - Intergenic
1012206947 6:96473245-96473267 TAATTTTTGTAGAAGATGTAAGG + Intergenic
1013567074 6:111376664-111376686 GCATCTTTGTGAAAGATGGAGGG + Exonic
1017697698 6:157034665-157034687 GCATTTTTACCTAAGTTGGAAGG - Intronic
1018649597 6:165981720-165981742 GCATTTTTACAGAAGTTTGATGG - Intronic
1021320904 7:19209943-19209965 ACATTTTTTTGGAAGATGGAGGG - Intergenic
1021795955 7:24254617-24254639 GAAATATTGCTGAAGATGGAAGG - Intergenic
1021802720 7:24323880-24323902 GCAGTTTTGCAGAAGATTTGAGG - Intergenic
1022037403 7:26547626-26547648 GCCTTTTTTCAGGGGATGGAGGG + Intergenic
1023109843 7:36798745-36798767 ACATTTTTCCAGACGAAGGAAGG + Intergenic
1023127421 7:36969061-36969083 GCATTTTTGAAAAAGTTGCATGG + Intronic
1026139620 7:67694493-67694515 GGATTCTTGCAGAAGTAGGAGGG + Intergenic
1027348145 7:77282904-77282926 GTATTTTTAAACAAGATGGATGG - Intronic
1027503837 7:78989908-78989930 ACATTTTTTCAGTAGATGGATGG - Intronic
1028657389 7:93224990-93225012 GCAAATTTGCAGAAGAGAGAAGG + Intronic
1029875494 7:103746241-103746263 TAATTTTTGCATAAGATGTAAGG - Intronic
1032307419 7:130749189-130749211 ATAATTTTGTAGAAGATGGAAGG - Intergenic
1032999616 7:137489479-137489501 GCATCTTTGCAGGAAATGGAAGG + Intronic
1036860693 8:12346056-12346078 ACATTTTGGCAAAAGATGAAAGG + Intergenic
1038360088 8:26866763-26866785 GCAACTTCGCAGAAGATGTAAGG + Intronic
1038397306 8:27256849-27256871 GCATTCAAGCAGAAGTTGGATGG - Intronic
1038779004 8:30555265-30555287 GCATTCCTGAAGAAGAGGGATGG + Intronic
1039104335 8:33973932-33973954 GCTTCTTTGAAGAAGAAGGAAGG - Intergenic
1039829344 8:41200585-41200607 GCATTTGTGCATGTGATGGATGG - Intergenic
1040320109 8:46288855-46288877 GACTTTTTGCAGAATATGCAAGG - Intergenic
1040409466 8:47139526-47139548 GTATTTTTGGTAAAGATGGAAGG + Intergenic
1041821969 8:62045959-62045981 GAATTTTTGTATAAGATGTAAGG + Intergenic
1042534814 8:69848243-69848265 TAATTTTTGTAGAAGATGTAAGG - Intergenic
1043429170 8:80178031-80178053 GTATTCTTGCAGAATAGGGAAGG - Intronic
1043757873 8:84026743-84026765 GCTCTTTTTCTGAAGATGGAGGG - Intergenic
1044534385 8:93342791-93342813 GCTTTTCTGCAGAAGATGAGTGG - Intergenic
1044591932 8:93921617-93921639 GCATTTTTTAAGAATAGGGAGGG + Intronic
1047242299 8:123101866-123101888 GAATTATTTTAGAAGATGGAAGG - Intronic
1047797507 8:128273081-128273103 AGATTTTAGCAGCAGATGGAGGG - Intergenic
1047987422 8:130249170-130249192 GCAATGGTGCGGAAGATGGATGG - Intronic
1051580021 9:18661561-18661583 GCATTCTTGTATAAGATGGTTGG + Intronic
1051617865 9:19023762-19023784 GCATTTCTGAAGAAGAAAGAAGG + Intronic
1051834527 9:21320461-21320483 TCAATTTTGCAGAAGAGGAAAGG + Intergenic
1051869696 9:21723632-21723654 CCATTTTAGCACAAGTTGGAAGG + Intergenic
1051948845 9:22605880-22605902 GCATTTATTCAGAAGAAGTAAGG - Intergenic
1052475237 9:28951215-28951237 TAATTTTTGCAGAAGGTGTAAGG - Intergenic
1052722544 9:32189828-32189850 GAATTTTTGTATAAGATGTAAGG - Intergenic
1052724453 9:32212996-32213018 GAATTTTTGTATAAGATGTAAGG + Intergenic
1053635340 9:39993350-39993372 GAATTTTTGTATAAGATGTAAGG + Intergenic
1053770592 9:41470950-41470972 GAATTTTTGTATAAGATGTAAGG - Intergenic
1054208547 9:62257348-62257370 GAATTTTTGTATAAGATGTAAGG - Intergenic
1054316260 9:63590794-63590816 GAATTTTTGTATAAGATGTAAGG + Intergenic
1054549322 9:66382785-66382807 GAATTTTTGTATAAGATGTAAGG - Intergenic
1054957609 9:70930629-70930651 GCATTATGGCATAAGATGTAGGG + Intronic
1055164039 9:73169107-73169129 GCATTCTATCAGAAGATGTATGG + Exonic
1055819047 9:80239767-80239789 GAATTTTTGCATAAGATATAAGG - Intergenic
1055821318 9:80267870-80267892 GAATTTATGAAGAGGATGGATGG - Intergenic
1055967418 9:81879148-81879170 GCATTTTGGAACCAGATGGATGG + Intergenic
1055984042 9:82037392-82037414 CCATTTATGCAGAAGTGGGAAGG - Intergenic
1056083442 9:83121502-83121524 GAATTTTTGAATCAGATGGAAGG - Intergenic
1058248577 9:102662211-102662233 CAATTTTTGCAGAAGATCGGAGG - Intergenic
1058447356 9:105065820-105065842 GCACTTTGGGAGGAGATGGACGG + Intergenic
1059120498 9:111638552-111638574 GCAAGTTTGGAGAAGATGCAAGG - Intronic
1060495625 9:124116400-124116422 GTATTTTACCAGAACATGGATGG + Intergenic
1060535523 9:124383942-124383964 GCATTTGTCCTGAAGATGTAGGG + Intronic
1185870908 X:3664076-3664098 GCAGTGTTGCAGAGGATGGGAGG - Intronic
1186755827 X:12670562-12670584 TCATTTTTGTATAAGGTGGAAGG - Intronic
1186765388 X:12765458-12765480 TCATTTTTGTATAAGGTGGAAGG - Intergenic
1189255135 X:39632126-39632148 GCTTTGTTGCAGCAGATGGTGGG - Intergenic
1192132943 X:68569840-68569862 GCAGTTTTGCAAAACCTGGAAGG + Intergenic
1193009099 X:76656005-76656027 ACATTTTTGCAGTCAATGGAAGG - Intergenic
1193294063 X:79813298-79813320 GTCTTTTTCAAGAAGATGGATGG - Intergenic
1193419321 X:81264688-81264710 GCATATTTGAAGTAGAGGGAGGG - Intronic
1193926188 X:87488351-87488373 GCAATTTTTCAGAATATTGAGGG + Intergenic
1194080686 X:89460904-89460926 GCCTTTTACCAGAACATGGATGG + Intergenic
1194108872 X:89805978-89806000 GCATTGTGGCAGAGGAAGGAAGG + Intergenic
1196119821 X:112037849-112037871 GCATCTTTGCAGTAGAAGGTTGG - Intronic
1196662898 X:118286581-118286603 GCATTTCTGCTGATGATGAATGG + Intergenic
1198063067 X:133066697-133066719 TAATTTTTGCATAAGGTGGAAGG - Intronic
1199406630 X:147469514-147469536 ACATTTTTGAAGAAAATGGAAGG - Intergenic
1199520525 X:148730247-148730269 GGATTTTTGCAGCAGATTGGAGG + Intronic
1200433358 Y:3117107-3117129 GCCTTTTACCAGAACATGGATGG + Intergenic
1200461530 Y:3460709-3460731 GCATTGTGGCAGAAGAAGGAAGG + Intergenic
1200948874 Y:8872695-8872717 TAATTTTTGTAGAAGTTGGAAGG + Intergenic