ID: 1153564729

View in Genome Browser
Species Human (GRCh38)
Location 18:6408368-6408390
Sequence ATTTATAAGCTCTTGCTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 166}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153564729_1153564733 0 Left 1153564729 18:6408368-6408390 CCCACCAGCAAGAGCTTATAAAT 0: 1
1: 0
2: 3
3: 13
4: 166
Right 1153564733 18:6408391-6408413 TGTGGACCAAAAACTGCATCTGG 0: 1
1: 0
2: 0
3: 14
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153564729 Original CRISPR ATTTATAAGCTCTTGCTGGT GGG (reversed) Intronic
901811742 1:11771345-11771367 ATTTAAAAGCTATTGCTGGGGGG - Intronic
902138525 1:14332254-14332276 ATTTTTAAGCTTTTGCTGTTGGG + Intergenic
902655337 1:17864002-17864024 ATTGAAAAGCTCTTGCTGTATGG - Intergenic
903973977 1:27137431-27137453 ATTTAGAAGCCCTTACTGCTAGG + Intronic
904232097 1:29083415-29083437 ATTTACAAGCTTTTGGGGGTGGG + Intronic
906024568 1:42662253-42662275 AGTTAAAAGCAATTGCTGGTAGG + Intronic
907789128 1:57644613-57644635 ATATATAATCTCTTAGTGGTTGG + Intronic
908647209 1:66291035-66291057 ATTTATGAGCTCTTGGCAGTGGG - Intronic
908682748 1:66680691-66680713 ATTTATAATCTTGTGCTAGTAGG - Intronic
909486156 1:76176565-76176587 ATCTATAAGCTAATGCTGGTGGG - Intronic
910006588 1:82404508-82404530 ATTTTAAAGCTCTTGTTGGTGGG + Intergenic
911415035 1:97561152-97561174 GTTTAGAAGCTCATTCTGGTAGG + Intronic
912214689 1:107594911-107594933 TTTTATTATCTCTTGCTGCTGGG + Intronic
915251727 1:154594600-154594622 ACTTATGAGCACTAGCTGGTGGG - Intronic
918511108 1:185316077-185316099 GATTATAAGCTCTTGATGATAGG - Intronic
918533061 1:185544278-185544300 TTGTAAGAGCTCTTGCTGGTTGG + Intergenic
918719831 1:187838995-187839017 TTTTATAGGGTCTTGCTGGAGGG + Intergenic
920262105 1:204695580-204695602 GTTAAGAAGCTCTAGCTGGTAGG + Intergenic
924835828 1:247646213-247646235 ATTTATAAGCTTTGGCTGGAGGG + Intergenic
1063144272 10:3282558-3282580 ATTTATCAGCTCTTGCAGAATGG - Intergenic
1063602442 10:7494542-7494564 GTTTATAATCTCTGGCTGGCAGG - Intergenic
1065640138 10:27773548-27773570 ATTTATTATCCCTTTCTGGTAGG - Intergenic
1067350606 10:45472319-45472341 ACTTAGAAGCTGTTGCTGATTGG + Intronic
1067736534 10:48857351-48857373 TCCTATAAGCTCTTGGTGGTGGG + Intronic
1068150837 10:53128615-53128637 TTTTATAAGCTGTTGGTGCTTGG - Intergenic
1068155334 10:53189854-53189876 AGTCATAATCTCTTGCTGTTTGG - Intergenic
1070353296 10:75614291-75614313 TTTTATAATGCCTTGCTGGTAGG + Intronic
1071542427 10:86498963-86498985 ATTTAAAAACTCTTTGTGGTTGG - Intronic
1072428984 10:95354658-95354680 ATTTATAAGCTAGTGCCTGTGGG + Intronic
1074690369 10:115998884-115998906 ATGTATAAGGACTTGGTGGTTGG + Intergenic
1078130866 11:8613040-8613062 GTTTATGAGCTCCTGCTGGGAGG - Exonic
1079193238 11:18300130-18300152 ATTTATTAGCTCTTCATGTTGGG - Intronic
1080993330 11:37568977-37568999 ATGCATCAGTTCTTGCTGGTTGG - Intergenic
1083761960 11:64823667-64823689 ATTTATAAGGGCTTTTTGGTGGG - Exonic
1084393506 11:68893442-68893464 ATTTTTCAGGTCCTGCTGGTTGG - Exonic
1086875327 11:92088878-92088900 AGTGATAAGCACTTGCTGGGTGG - Intergenic
1087246405 11:95843201-95843223 ATTTTTAAGCTCATTATGGTGGG - Intronic
1089471947 11:118728430-118728452 ATTGATAAGCTACTGGTGGTTGG + Intergenic
1090283294 11:125477158-125477180 ATTTTAAAGATCTTTCTGGTGGG + Intronic
1092919172 12:13215275-13215297 GTTTGTAAGGTCATGCTGGTGGG + Exonic
1094504515 12:31050223-31050245 ATTTATAACCTATTTCTGCTTGG - Intergenic
1097331292 12:58335171-58335193 ATTGATAAGCTACTGGTGGTTGG + Intergenic
1097804619 12:63951792-63951814 ATTTAAAAGCTCTTGCTGTTAGG + Intronic
1097973621 12:65661773-65661795 ATTTAAAAGCACTTTCTAGTCGG + Intergenic
1098233288 12:68394761-68394783 ATATATAAGCTGATGATGGTAGG + Intergenic
1099205876 12:79725805-79725827 ATTTATAAGAATATGCTGGTTGG - Intergenic
1100409112 12:94296937-94296959 ATCTCTGATCTCTTGCTGGTAGG - Intronic
1100800948 12:98229625-98229647 ATTTATAAGTTCTTGGTGAAAGG - Intergenic
1101679493 12:106951328-106951350 ATTTATAAAAACTTGCTGTTTGG - Intergenic
1105546457 13:21354418-21354440 ATTTTAAAGCTCTTTGTGGTAGG + Intergenic
1106356805 13:28991083-28991105 ATTTACAAGCTGCTGCTGCTGGG + Intronic
1106644010 13:31613734-31613756 ATTTATAAGCACTTGCACATTGG + Intergenic
1106916254 13:34518411-34518433 ATTTATAAGCATTTGTTGGGGGG - Intergenic
1109486840 13:63034930-63034952 TTTTATAAGCTTTTGATGTTCGG - Intergenic
1113291320 13:108909995-108910017 ATGTATAAATTCTGGCTGGTTGG - Exonic
1113679414 13:112232782-112232804 ATAGATAATCTTTTGCTGGTTGG + Intergenic
1115414624 14:33117183-33117205 ATTTATCATTTCTTGGTGGTGGG + Intronic
1117829392 14:59734542-59734564 GTTTTTCAGCTCTAGCTGGTTGG - Intronic
1117922961 14:60744867-60744889 ATTTCTCTGCTCTGGCTGGTGGG + Intronic
1121865771 14:97361044-97361066 ATTAATAATATCTTGTTGGTGGG - Intergenic
1124691173 15:31824462-31824484 ATTTAGCAGCTCTTTCTGTTTGG - Intronic
1128357831 15:66940949-66940971 ATTTATAGCCCCTTCCTGGTAGG - Intergenic
1130963316 15:88679435-88679457 ATTTATCTGGTCTTGCAGGTCGG + Intergenic
1138134041 16:54506390-54506412 ATTTAAAATCCCTTGCTTGTTGG + Intergenic
1138339985 16:56282663-56282685 CTTTAAAAGCCCTTGCTTGTAGG - Intronic
1140351801 16:74269528-74269550 TTTTATTTGCTCTTGCTGCTTGG - Intergenic
1145355975 17:22152236-22152258 TTTTATAAGCTTTTGATGTTGGG + Intergenic
1148900089 17:50868802-50868824 ATTTATGAGTTATTGCTGCTTGG + Intergenic
1153564729 18:6408368-6408390 ATTTATAAGCTCTTGCTGGTGGG - Intronic
1155629657 18:27877690-27877712 ACTTATAAGCTCATTCTGGATGG + Intergenic
1155675921 18:28428581-28428603 ATTTGTAAGATTTTGCTGGGGGG + Intergenic
1155999450 18:32368572-32368594 ATTTATAACCTCTAGATGGCAGG + Intronic
1156217374 18:35013501-35013523 ATTTATAATTTCTTTCTGTTAGG + Intronic
1159185190 18:64961989-64962011 ATTTATACTCTCTCTCTGGTTGG + Intergenic
1159294791 18:66470848-66470870 ATGTATTAGCTCTTGGTTGTGGG - Intergenic
1160667647 19:340358-340380 ATTAATAGCCTCCTGCTGGTCGG + Intronic
926720754 2:15958468-15958490 ATATATAAGCTGTTGTTGGCTGG - Intergenic
927313906 2:21660060-21660082 ATTTAAAATCTTTTGCTTGTGGG - Intergenic
928186748 2:29116868-29116890 TTTTAAAAGCCCTTGCTGGTGGG - Intronic
928476964 2:31637447-31637469 ATTTATAAACTGTTGCTGGTGGG - Intergenic
929372153 2:41238737-41238759 ATGTGTAATCTGTTGCTGGTTGG + Intergenic
929873246 2:45775416-45775438 ATGAATAAGCTCTTGCTGGTGGG - Intronic
932991505 2:76793741-76793763 GTTTATAAGTTCATACTGGTGGG - Intronic
935005587 2:99072975-99072997 ATATATGAGCTCTTACTGGGGGG - Intronic
935653514 2:105401853-105401875 ATTTATAAGCGGTTGCTTCTGGG + Intronic
936120179 2:109734987-109735009 ATTTATAATTTCTTTGTGGTAGG + Intergenic
937732692 2:125253760-125253782 ATTAATAAGCTGTTGCTTGAGGG - Intergenic
939631987 2:144536771-144536793 ATGAACAAGCTCTTGCTGGATGG - Intergenic
939868221 2:147498802-147498824 ATATTTAAGCCCTTGCAGGTGGG + Intergenic
940334904 2:152516011-152516033 ATTTATTAGTTTTTGCTAGTTGG - Intronic
941318172 2:164020655-164020677 CTTTGTTAGCTCTGGCTGGTGGG + Intergenic
942887949 2:180951551-180951573 TCTTATATGCTCTTGCTGCTGGG - Intergenic
945324226 2:208464012-208464034 AATTATTAACTCTTGTTGGTAGG + Intronic
946429755 2:219619012-219619034 ATCAATAAGCACTTGCTGGAGGG - Intergenic
1170289675 20:14754754-14754776 ATCTATAAACTCTTGCATGTGGG + Intronic
1171184165 20:23112921-23112943 ATTCACCTGCTCTTGCTGGTAGG - Intergenic
1171981540 20:31632607-31632629 TTTTAGAAGCGCTTGCTGGACGG + Intergenic
1174227930 20:49019505-49019527 ACTTATAATCTTTTGCTGTTAGG + Intronic
1175339581 20:58219690-58219712 TTTTATGAGCTCCGGCTGGTTGG + Intronic
1176043233 20:63078183-63078205 ATGTGTAAGCTGTTGCTGTTGGG + Intergenic
1179620407 21:42611567-42611589 ATTTAAAAGCTTTACCTGGTTGG + Intergenic
1184956236 22:47888520-47888542 AGTGCTAAGCTCTTGATGGTAGG + Intergenic
950030927 3:9852858-9852880 ATTGATAAGCTACTGGTGGTTGG + Intronic
950270757 3:11613011-11613033 ATTTATAAGCTCTACCAGGGAGG - Intronic
951477415 3:23122590-23122612 ATTTATATGATCTTGGGGGTGGG - Intergenic
952701643 3:36335226-36335248 ATTTATAGGGTCATGCTGGAGGG + Intergenic
954035558 3:47849218-47849240 ATTTATGAGGCCTTCCTGGTGGG + Exonic
955208080 3:56915779-56915801 TTTTAGAAGTTCATGCTGGTTGG - Intronic
955633485 3:61000321-61000343 ATTTTTAAGCTCTGGCTGTAAGG + Intronic
958710801 3:97714823-97714845 AGTTATAATTTCTTGTTGGTGGG - Intronic
958799760 3:98742380-98742402 AATTTTAAGCTCTTGCGGTTAGG - Intronic
959557509 3:107739169-107739191 ATTTATATGTTCCTGCTTGTTGG + Intronic
961686221 3:128633508-128633530 TTTTAAAATCTCTTGCTGGTTGG - Intronic
963641469 3:147865689-147865711 TTTTATAAGGTCATGCTGGAGGG - Intergenic
970952077 4:21768103-21768125 ATTTAGAAGCTCTTGCTTGGCGG - Intronic
973689841 4:53416263-53416285 ATTTATAAGTTCTTGTTGTCTGG - Intronic
974471001 4:62317170-62317192 TCTTAAAATCTCTTGCTGGTTGG + Intergenic
974997647 4:69181440-69181462 ATTTCTAAGCTCTAGAAGGTTGG + Intronic
975002515 4:69242408-69242430 ATTTCTAAGCTCTAGAAGGTTGG + Intergenic
975007380 4:69307371-69307393 ATTTCTAAGCTCTAGAAGGTTGG - Intronic
975010620 4:69346390-69346412 ATTTCTAAGCTCTAGAAGGTTGG + Intronic
978985050 4:115001940-115001962 ACTTATAAGCTCTGTCTGCTGGG + Intronic
982393199 4:154888364-154888386 ATTTGTTAGCTTTGGCTGGTGGG - Intergenic
982758750 4:159254895-159254917 ATTTAAAGTCTCATGCTGGTGGG - Intronic
983119969 4:163870996-163871018 ATTTATCATTTCTTGCTGTTGGG - Intronic
983215339 4:164997395-164997417 ATTGATAAGCTACTGGTGGTTGG - Intergenic
983895106 4:173072867-173072889 ATTAATAAGCTATTGTGGGTGGG + Intergenic
985194837 4:187418695-187418717 ATTTATAGGCTCTTGAGGATGGG - Intergenic
987354667 5:17052786-17052808 ATGAATAAGCTCTTGCATGTGGG - Intergenic
987586795 5:19865786-19865808 ATTTATTTTCTCTTGCTGCTAGG + Intronic
987632200 5:20488638-20488660 ATTCATATGCTCTTTTTGGTTGG + Intronic
991163866 5:63538981-63539003 ATTAATCAGCTTTTGTTGGTGGG + Intergenic
992925280 5:81578035-81578057 ATTTATAAGCTCCTGATCTTGGG - Intronic
993589708 5:89778883-89778905 AGTTCTAAGCCCTTGCTGGAGGG - Intergenic
994608062 5:101995849-101995871 ATTTATCAGCTCTCAATGGTAGG + Intergenic
995068182 5:107886370-107886392 ATTTCTTAGCTCTTTCTGCTGGG + Intronic
995221786 5:109656437-109656459 ATTCAGAACCTCTTGGTGGTGGG + Intergenic
996230400 5:121057163-121057185 ATTTATAAGTACATGCTGGATGG - Intergenic
996349499 5:122522890-122522912 ATTTAAAAGCCATTGCTGGCCGG - Intergenic
997546273 5:134710837-134710859 ATTTAAAAGCTCGTGTTGGCCGG + Intronic
998371645 5:141665710-141665732 ATTTGGAATCACTTGCTGGTTGG - Intronic
998582547 5:143393728-143393750 ATTTATTATTTCATGCTGGTTGG - Intronic
1000933175 5:167277572-167277594 ATTTATAACCTGTTGTTGTTGGG + Intergenic
1001350820 5:170962281-170962303 ATTCCTACTCTCTTGCTGGTGGG + Intronic
1003405231 6:5822345-5822367 ATTTTAAAGCTCTTTGTGGTAGG - Intergenic
1004482418 6:16033454-16033476 TTTTATAAGGTCATGCTGGTGGG - Intergenic
1007026032 6:38575353-38575375 AATTATAAGCTCTTGGAGGCAGG - Intronic
1008945080 6:57088649-57088671 ATTTAAAAGCTCTTCCTAGTGGG - Intronic
1010768140 6:79799315-79799337 AATTGTAAGTTCTTGCAGGTAGG + Intergenic
1012715166 6:102659878-102659900 ATTTATCATCTTTTGTTGGTTGG - Intergenic
1014474281 6:121853693-121853715 ATTTTTATGCTCATCCTGGTTGG + Intergenic
1017825465 6:158078452-158078474 ATTAATTAGTTCTTGGTGGTGGG - Intronic
1026449131 7:70511969-70511991 ATTTATAAGCTCATGAAGTTGGG - Intronic
1026593477 7:71715238-71715260 ATTTAAAAGCTCTGGATGGCCGG + Intergenic
1028256453 7:88604077-88604099 ATTTATAAGCACTTACTTGCTGG - Intergenic
1028314848 7:89387839-89387861 CTTTACAAGAACTTGCTGGTTGG - Intergenic
1028771795 7:94633269-94633291 ATTTTTGACCTCTTGCGGGTTGG - Intronic
1033485843 7:141788210-141788232 ATTTCTCAGCTCTTGTTGGCTGG + Intergenic
1035437778 7:158871845-158871867 TTTTAAAAGTTCTTGCTGTTTGG + Intronic
1037179461 8:15987367-15987389 ATTTATCAGTTCTTTCTGTTGGG + Intergenic
1037293067 8:17371659-17371681 TTTTCTAAGCTGTTGGTGGTCGG + Intronic
1037927166 8:22852554-22852576 TTTTCTAGGCTCTTTCTGGTTGG - Intronic
1039073705 8:33669748-33669770 ATTTATAAACTCTAGTTGGTGGG + Intergenic
1041820910 8:62031953-62031975 TTTTATAAGGTCATGCTGGAAGG + Intergenic
1043115402 8:76246949-76246971 ATTTATAATTTCTTTCTGTTGGG - Intergenic
1044542768 8:93426295-93426317 ATTTCTAAGCCCTTGAGGGTTGG - Intergenic
1045420525 8:102010157-102010179 TTTTATAACATCTTGCTGGAGGG - Intronic
1046357407 8:113106685-113106707 ATTTATGAGGTGTTGCTGGGAGG + Intronic
1049014834 8:139912807-139912829 AATTAGAAGCTCTTGCTGCACGG - Intronic
1049958598 9:716108-716130 ATTTATATGCTCTTTTTGGTAGG - Intronic
1055143976 9:72910396-72910418 ATGTATAAGCTCTTGCAGTAAGG - Intronic
1061325568 9:129861869-129861891 ATTTATACTCTCTTGCAGATGGG - Intronic
1061628211 9:131854905-131854927 AGTGATGAGCTCCTGCTGGTGGG + Intergenic
1185715933 X:2342107-2342129 ATTTAGAAGCTTTTGTTTGTGGG + Intronic
1185870102 X:3657715-3657737 ATTTCGAAGCACTTGCTTGTGGG + Intronic
1186623563 X:11267478-11267500 ATTTGTAAGCTCATAGTGGTTGG - Intronic
1187427105 X:19187927-19187949 TTTTATAGGGTCTTGCTGGAGGG + Intergenic
1191766988 X:64708867-64708889 ATTAATAAGCACTTGTTGGTTGG + Intergenic
1191871597 X:65751021-65751043 TTTTATAAGGTCATGCTGGAGGG - Intergenic
1192741088 X:73893227-73893249 ATTTGTCAACCCTTGCTGGTAGG - Intergenic
1195461511 X:105131118-105131140 ATTTATTTGTTCTTGTTGGTTGG + Intronic
1198191213 X:134308347-134308369 ATTTATCATTTCTTGGTGGTGGG - Intergenic
1199440088 X:147857918-147857940 ATCTATCAGCTTTTGCTGGCTGG - Intergenic