ID: 1153565609

View in Genome Browser
Species Human (GRCh38)
Location 18:6414727-6414749
Sequence CCCCGCGCGGCGGCGGCCGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 4, 3: 32, 4: 217}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153565598_1153565609 3 Left 1153565598 18:6414701-6414723 CCTCTACCTGCCCGGGGATGGGG 0: 1
1: 0
2: 0
3: 26
4: 234
Right 1153565609 18:6414727-6414749 CCCCGCGCGGCGGCGGCCGTGGG 0: 1
1: 0
2: 4
3: 32
4: 217
1153565600_1153565609 -3 Left 1153565600 18:6414707-6414729 CCTGCCCGGGGATGGGGCCACCC 0: 1
1: 0
2: 1
3: 19
4: 231
Right 1153565609 18:6414727-6414749 CCCCGCGCGGCGGCGGCCGTGGG 0: 1
1: 0
2: 4
3: 32
4: 217
1153565587_1153565609 29 Left 1153565587 18:6414675-6414697 CCCTCGCCGCGGGAGTCGTGCAG 0: 1
1: 0
2: 0
3: 2
4: 23
Right 1153565609 18:6414727-6414749 CCCCGCGCGGCGGCGGCCGTGGG 0: 1
1: 0
2: 4
3: 32
4: 217
1153565601_1153565609 -7 Left 1153565601 18:6414711-6414733 CCCGGGGATGGGGCCACCCCGCG 0: 1
1: 0
2: 0
3: 24
4: 218
Right 1153565609 18:6414727-6414749 CCCCGCGCGGCGGCGGCCGTGGG 0: 1
1: 0
2: 4
3: 32
4: 217
1153565602_1153565609 -8 Left 1153565602 18:6414712-6414734 CCGGGGATGGGGCCACCCCGCGC 0: 1
1: 0
2: 1
3: 20
4: 146
Right 1153565609 18:6414727-6414749 CCCCGCGCGGCGGCGGCCGTGGG 0: 1
1: 0
2: 4
3: 32
4: 217
1153565590_1153565609 23 Left 1153565590 18:6414681-6414703 CCGCGGGAGTCGTGCAGGCCCCT 0: 1
1: 0
2: 0
3: 6
4: 90
Right 1153565609 18:6414727-6414749 CCCCGCGCGGCGGCGGCCGTGGG 0: 1
1: 0
2: 4
3: 32
4: 217
1153565594_1153565609 5 Left 1153565594 18:6414699-6414721 CCCCTCTACCTGCCCGGGGATGG 0: 1
1: 0
2: 1
3: 15
4: 152
Right 1153565609 18:6414727-6414749 CCCCGCGCGGCGGCGGCCGTGGG 0: 1
1: 0
2: 4
3: 32
4: 217
1153565588_1153565609 28 Left 1153565588 18:6414676-6414698 CCTCGCCGCGGGAGTCGTGCAGG 0: 1
1: 0
2: 0
3: 3
4: 52
Right 1153565609 18:6414727-6414749 CCCCGCGCGGCGGCGGCCGTGGG 0: 1
1: 0
2: 4
3: 32
4: 217
1153565596_1153565609 4 Left 1153565596 18:6414700-6414722 CCCTCTACCTGCCCGGGGATGGG 0: 1
1: 0
2: 0
3: 19
4: 158
Right 1153565609 18:6414727-6414749 CCCCGCGCGGCGGCGGCCGTGGG 0: 1
1: 0
2: 4
3: 32
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153565609 Original CRISPR CCCCGCGCGGCGGCGGCCGT GGG Intronic
900237614 1:1600162-1600184 CCCGGCGCGGCGGCGGAGGCGGG + Intergenic
901084638 1:6603014-6603036 CCCCGCGCGGCGCCCGCCCCCGG + Intronic
901641519 1:10695218-10695240 CCCCGCGCGTCCCCGGCCCTGGG + Intronic
903750211 1:25616798-25616820 GCCCGAGCGGCGGCGGCGGCGGG + Intergenic
903907586 1:26697124-26697146 TCCGGCGCGGCGGCGGCTGCCGG + Exonic
904837748 1:33349918-33349940 CCCCCGGCGGAGGCGGCCGCGGG - Intronic
905179131 1:36155965-36155987 GCCCGCTCGGCCGTGGCCGTGGG + Intronic
905995940 1:42380709-42380731 CAGCGCGCGGCGGCGGGCGCTGG - Intergenic
906116880 1:43363057-43363079 CCCTGCGCGGCGGCGGGAGCGGG + Exonic
906263165 1:44407926-44407948 CCCCGCGCGGCTGCGGACCAGGG + Intronic
906627141 1:47334262-47334284 CGCCGCGCGCCGGCGGCCCTCGG - Intronic
907444568 1:54499522-54499544 CGCCGAGCGGCGGCGGCTGCCGG + Intergenic
907906117 1:58784582-58784604 CCCCGCGCGGTGGCGGCCGCCGG - Intergenic
912354263 1:109042172-109042194 CCCCGCGCGGCGGGGTCCTGAGG - Intergenic
913528029 1:119712538-119712560 CCCCGCGCGGAGGCGGTTGGGGG - Intronic
914813691 1:151047899-151047921 CCCCGGGCGGCGGGGGCCCAAGG + Exonic
915366697 1:155320924-155320946 CCCCGCCGGGCGGGGACCGTGGG + Exonic
915616894 1:157045939-157045961 CCTCACGCCGCGGCGGCCGGGGG + Intergenic
919991033 1:202709007-202709029 CCCCGCAGGGCGGCAGCAGTAGG + Intronic
920401567 1:205679845-205679867 CCCCGCGGCGCCGCGGCCGTCGG + Intronic
920920252 1:210292533-210292555 CCCCGCGCGGCTCCGGCCCGCGG - Intergenic
922783319 1:228269979-228270001 CCCGGCGCGGCCGCGGCCGGGGG - Intronic
924172416 1:241356678-241356700 CCCCGCGCCGCGGCGGCCGCCGG + Intronic
924289723 1:242524714-242524736 CCCGGGGCGGCGGCGGCGGCGGG + Intergenic
1063115440 10:3068599-3068621 CCCGGCGCGCCCGCGTCCGTGGG - Intronic
1066464524 10:35640839-35640861 CCCCGCACCGCGGCGGCGGCAGG - Exonic
1066464553 10:35640910-35640932 CGCCGGGCGGCGGCGGCGGCAGG + Exonic
1067091318 10:43266964-43266986 CGCAGCGCGGGGGCGGCCGCGGG - Intergenic
1067831758 10:49614599-49614621 TCCTGCGCAGCAGCGGCCGTCGG + Intronic
1068788401 10:61001589-61001611 CCCCGCAGGGCGGCGGCTGCCGG - Intergenic
1070198009 10:74176721-74176743 CCCCGCGCGCGGGCGGCCCCTGG - Intronic
1070800833 10:79243558-79243580 CCCCGCGCCGCCGCCGCCGCCGG + Intronic
1072294159 10:93993772-93993794 CCCCGCGCGGCAGGAGCCGGGGG + Intergenic
1072409070 10:95183876-95183898 CCCGGGGCGGCGGCGGCGGCAGG - Intergenic
1074130420 10:110568258-110568280 CCCGGCCCGGGGGCGGCCCTGGG + Intronic
1075802017 10:125159930-125159952 CCGAGCGCGGCGGCGTCCGGAGG - Intronic
1076035696 10:127196765-127196787 CCCCGCGCGCAGGCGGCAGCCGG - Intronic
1078057406 11:8019254-8019276 CCGCGGGCGGCGGCGGCGCTGGG - Intronic
1078246007 11:9573791-9573813 CTCTGCGCGGCGGCGGCCTGCGG - Exonic
1081492583 11:43579621-43579643 CCCCGCGCCGCGGCGGCGGCGGG + Intronic
1081528506 11:43942835-43942857 CCCGGCGCAGCGGCCGCCCTCGG + Exonic
1083617962 11:64035774-64035796 CCCCTCGCGGCGGCGGCGGCGGG - Intronic
1083879357 11:65540458-65540480 CTCCGCCCCCCGGCGGCCGTGGG - Intronic
1083890238 11:65592340-65592362 CCCGGGGCGGCGGCGGACGCCGG - Exonic
1083970308 11:66070407-66070429 TCCCCCGCGGCGGCGGCGGCGGG - Intronic
1087241825 11:95789539-95789561 GCCCGGGCGGCGGCGGCTCTCGG - Exonic
1091286661 11:134412026-134412048 CTCAGCGAGGCGGCGGCCGAAGG + Intergenic
1091823641 12:3493534-3493556 CCCCGCGCGGCAGCGGGGGTAGG - Intronic
1094624171 12:32107010-32107032 GCCCGGGCTGCGGCGGCCGCGGG - Intronic
1095440743 12:42237560-42237582 CCCCTCGCGCCGCCGGCCGGCGG - Intronic
1096101235 12:48971608-48971630 CCCAGCGCCGCCGCGGCCGCCGG + Exonic
1096106336 12:48998623-48998645 GCCGGCGGGGCGGCGGCTGTGGG + Exonic
1096983728 12:55743374-55743396 CCCCGGGGGGAGGCGGCCGAGGG + Exonic
1097187429 12:57203217-57203239 CCCCGCGATGCAGCGGCCGTTGG - Exonic
1098029051 12:66235417-66235439 CGCCGCGCGGCGGCGGCCGGCGG + Intronic
1100260661 12:92929343-92929365 CCCCGCCCCCCGGCGGCCGCGGG - Intergenic
1100329689 12:93571710-93571732 CCGCGCTCGGAGGCGGCGGTCGG - Exonic
1101037193 12:100717342-100717364 CCCCGCGCGCCGGCAGCTCTAGG + Intergenic
1104961524 12:132490430-132490452 CCCTGGGCGGCGGCGGGCGGCGG - Exonic
1106995049 13:35471270-35471292 CCCGGCCCGGCGGGGGCCGAGGG + Intronic
1107604031 13:42040813-42040835 CCCGGCGCAGCGGCGGCGGCGGG + Intronic
1113789917 13:113022767-113022789 CCCACCGCGGCGGCGGCTGAGGG + Intronic
1114224193 14:20723437-20723459 CCCCGCGCGGGGGAGGCTGCGGG + Intergenic
1115320741 14:32077122-32077144 CCCGGCGCGGCGGCGGGCGCTGG + Intronic
1115474487 14:33800385-33800407 CCCCGCAGGGCGGCGGCGGTGGG + Exonic
1117545903 14:56794728-56794750 TTCCGGGGGGCGGCGGCCGTCGG + Intergenic
1117875929 14:60249723-60249745 GCCTGCGCGGCGGCGGCGGCGGG + Intronic
1118024081 14:61751205-61751227 CCGCCCGCGGCCCCGGCCGTGGG + Intergenic
1120881452 14:89417495-89417517 CCCAGGGCGGCCGCGACCGTGGG + Intronic
1121042218 14:90758579-90758601 CCCCTGGCGGCGGCTGCCGAGGG + Intronic
1121127592 14:91417923-91417945 CCCCGCCCCTCGGCGGCCCTGGG + Intergenic
1122270871 14:100568034-100568056 CCCCGCGGGGCCCCGTCCGTGGG + Exonic
1123119966 14:105911903-105911925 CCCCTAGCGGGGGAGGCCGTGGG + Intergenic
1123630784 15:22258298-22258320 GCCCGCGCGGGGGAGGCCGGGGG - Intergenic
1124469322 15:29968971-29968993 CCACGCACGGCGGCGGCGGCGGG - Intergenic
1125999349 15:44194865-44194887 CCCTGGGCGGCGGCCGCCGCCGG + Intronic
1127103301 15:55588441-55588463 CCCCGCGCGGGGACGGGCTTCGG + Intronic
1128992493 15:72272515-72272537 CCGCGCGCGGCCGCAGCCGACGG + Exonic
1131174402 15:90201163-90201185 CCCAGCGCTCCGGCGGCCGCCGG + Intronic
1131517578 15:93089246-93089268 CCGCGCTCGGCGGCGGGCGGGGG - Intergenic
1132641950 16:982038-982060 CCCCGCGCGGCCCAGGCCCTCGG - Exonic
1132757571 16:1493513-1493535 TCCGGGGCCGCGGCGGCCGTGGG + Exonic
1132893233 16:2214784-2214806 CGGCGGGCGGCGGCGGCCGGCGG - Exonic
1134419334 16:14071371-14071393 CGGCGGGCGGTGGCGGCCGTTGG + Intronic
1136365192 16:29806438-29806460 CCCCGCGGGGCCGGGGCCGGGGG - Intronic
1136540232 16:30924395-30924417 CCCGGCGGGTCGGCGGCCATCGG - Intronic
1137412929 16:48244634-48244656 GCCCCCGCGGCGGCGGCGGGCGG + Intronic
1141972261 16:87492275-87492297 GACCGCGCGGGGGCGGCCGGGGG + Intergenic
1142299251 16:89247214-89247236 CCCCGCTCGGGGGCGGCCCCTGG - Intergenic
1142592504 17:1012554-1012576 CCCCGCTCGGCGGTGGCAGATGG - Intronic
1142762424 17:2050234-2050256 CCGGGCGCGGCGGCGGCGGCCGG + Intergenic
1145128096 17:20318284-20318306 CCCCGCAGGGCGGGGGCCATGGG - Intronic
1146058653 17:29593410-29593432 CCTCGCGAGGCGGCGGCGGCGGG - Intronic
1146208022 17:30921827-30921849 CCCCGCGCGTCGGCGGAGCTCGG + Exonic
1149678504 17:58487746-58487768 CCGCGGGCGGCGGCGGCTGCTGG + Exonic
1152616678 17:81341210-81341232 CCGCGCGGGGTGGCGGCCGGCGG + Intergenic
1152617839 17:81346039-81346061 CCCCGGAGGGCGGCGGCCGCGGG - Intergenic
1152627776 17:81396184-81396206 CCCCTCAGGGCAGCGGCCGTGGG - Intronic
1152714365 17:81891437-81891459 CCCAGGGCGGCCGCGGCGGTGGG - Exonic
1153219037 18:2846698-2846720 CCCCGGGACGCGGCCGCCGTCGG - Intergenic
1153514431 18:5891173-5891195 CGCCGAGCGGCGGCCGCCCTCGG - Exonic
1153565609 18:6414727-6414749 CCCCGCGCGGCGGCGGCCGTGGG + Intronic
1153794448 18:8609629-8609651 CCGCGCGCGGCGGAGGCCGAGGG + Exonic
1157794109 18:50559633-50559655 CCCCGCGCGGCTGCAGCCGCCGG - Intergenic
1160729258 19:633350-633372 CCCCGCGCGGCCGGGGCCTTTGG - Intronic
1160736125 19:663153-663175 CCCCGCGCGGCACCCGCCGCCGG + Exonic
1161304039 19:3557227-3557249 CCCCGCGCCGCGGGAGCTGTAGG + Exonic
1162778686 19:12995721-12995743 CGCAGCGCGGCGGAGGCCGGAGG + Exonic
1162914059 19:13865154-13865176 CCCCGCGCCGCGCCGGGCGGTGG - Intronic
1162959465 19:14117543-14117565 CCCATCGCGGCGGCGGCGGCCGG + Exonic
1163051812 19:14690056-14690078 GTGCGCGCGGCGGCGGCCGACGG + Intronic
1163243115 19:16076413-16076435 CCCCCCGGGCCGGCTGCCGTCGG - Intronic
1163556598 19:17996940-17996962 CACCCCGCGGCGGCCTCCGTGGG - Intronic
1163743890 19:19033488-19033510 CCTCGCGCGGCGGCGGCGGCGGG - Intronic
1164990079 19:32676578-32676600 GCACGCGCCGCGGCGGCCGCTGG + Exonic
1165080411 19:33303153-33303175 CCCTGCGCGGCGCCGCCCATGGG - Intergenic
1165850858 19:38849700-38849722 CGGCGGGCGGCGGCGGCGGTGGG - Exonic
1165928586 19:39342375-39342397 CGGCGCGCGGCGGCCCCCGTCGG + Intronic
1165928698 19:39342687-39342709 CCGCGGGCGGCGGCGGCGGGCGG + Intronic
1166330672 19:42076415-42076437 CCGCGCGCCGGGTCGGCCGTTGG - Intronic
1167048821 19:47066879-47066901 CCCCGCGTGCTGGCGGCCGGTGG - Exonic
1167311247 19:48739133-48739155 CGGCCCGCGGCGGCGGGCGTGGG - Exonic
1167709944 19:51104400-51104422 CCCGGCGCGGTGGTGGCCGTGGG - Exonic
1168688459 19:58362602-58362624 CCCCGCGCGGCGGGAGTGGTTGG + Intronic
1168696768 19:58408272-58408294 CCCCGCGCGGCGCGGTCCGATGG + Intronic
925984960 2:9207553-9207575 CCCCGGGCGGCGGCGGGCGGCGG - Intronic
927606699 2:24491963-24491985 CCCCTCTCGGCGGCGGCCCGGGG - Exonic
928277968 2:29920169-29920191 CCCCCCGGGGAGGCGGCTGTGGG - Exonic
928303518 2:30147297-30147319 CCTGGCGCGGCGGCCGCCGTCGG + Intronic
929133502 2:38602162-38602184 CGCGGCGCGGCGGCGGCGGCGGG - Intronic
929218038 2:39436856-39436878 CCGCGCGCCGCCGAGGCCGTGGG - Intronic
930089440 2:47521102-47521124 GCCCGAGAGGCGGCGGCCCTCGG + Exonic
931649411 2:64454516-64454538 CCCGGCGCGGCGGGGTACGTGGG - Exonic
934566986 2:95346618-95346640 CCCCGCGCCCCGGCGCCCGCGGG + Intronic
935059302 2:99593817-99593839 CCCAGCGCGTCCGCGGCCGCGGG + Exonic
937325724 2:120988748-120988770 CCCCGCGTGGCCGTGGCCATAGG - Exonic
941020967 2:160407658-160407680 CGCCGCGCGGCGGCGGCCGGCGG + Intronic
941096686 2:161245164-161245186 CCCGGCGCGGCCGCGGCCGGGGG - Intergenic
942151066 2:173076161-173076183 GCCCGCCCGGCGGCGGCGGCCGG + Intronic
942463964 2:176188994-176189016 GGCCGCGCGGGGGCGGCCGGGGG - Exonic
942890492 2:180981010-180981032 GCCGGGGCGGCGGCGGCGGTGGG + Intronic
944433215 2:199659346-199659368 CCGCGCCCGGCGGCGGCTGGGGG - Intergenic
945225873 2:207530479-207530501 CCCGGCCCGGCGGCGGCGGCGGG - Intronic
948801583 2:240435737-240435759 CCCCGCGCCGCCGCCGCCGCCGG + Exonic
948805773 2:240453026-240453048 TCCAGCGCGGCGGCGGACGCGGG - Intronic
948824682 2:240568505-240568527 CGCCGGGCGGCGGCGGCGGCGGG - Intronic
948934022 2:241150644-241150666 GGCCGCGCGGCGGCGGCCAGAGG - Intronic
1170150508 20:13221729-13221751 CCCGGCGCGGCGGCCGGCGGCGG - Intergenic
1172222412 20:33283064-33283086 CCCCGCCCGGAGGCAGCCTTGGG - Intronic
1172252596 20:33490243-33490265 CGGCGCGCGGCGGCGGCGCTCGG + Intronic
1172661744 20:36573473-36573495 CCCCCCGCGGGGCGGGCCGTCGG - Exonic
1172702843 20:36863419-36863441 CCCGGCGCGGCTCCGGCCGCTGG + Exonic
1175358629 20:58389581-58389603 CCCGGCGCGGCGGGTGACGTCGG + Intronic
1175890083 20:62312125-62312147 CCCCACCCCGCGGTGGCCGTCGG - Intronic
1176232299 20:64038650-64038672 CCCGGCGTCGCGGCGGCCGAAGG + Intronic
1176548600 21:8212240-8212262 GCCGCCGCCGCGGCGGCCGTCGG + Intergenic
1176550165 21:8217358-8217380 CGGCGCGCGGCGGCGGCGGCGGG + Intergenic
1176556494 21:8256448-8256470 GCCGCCGCCGCGGCGGCCGTCGG + Intergenic
1176567531 21:8395275-8395297 GCCGCCGCCGCGGCGGCCGTCGG + Intergenic
1176575433 21:8439490-8439512 GCCGCCGCCGCGGCGGCCGTCGG + Intergenic
1176577007 21:8444628-8444650 CGGCGCGCGGCGGCGGCGGCGGG + Intergenic
1177941809 21:27421003-27421025 ACCCGCGGGGCGGCGGCCCATGG + Intergenic
1179626838 21:42653750-42653772 CCTCCCGCGGCGGCTGGCGTCGG + Exonic
1179674837 21:42974447-42974469 CCCTGCGCGGCGGCGGGCGCGGG - Intergenic
1179912028 21:44455635-44455657 ACCTGCGCGGCGGCGGCCGGAGG - Exonic
1180649987 22:17369605-17369627 CCCCGCCCGGCGCCCGCCCTCGG + Exonic
1181081441 22:20418391-20418413 GCACGCGCGGCGCCGGCCCTTGG - Intergenic
1181147498 22:20859046-20859068 CCCTGGACGGCGGCGGCAGTGGG + Exonic
1181283400 22:21735754-21735776 GCCCGCGGGGCGGCGGCGGGAGG - Exonic
1181710809 22:24686864-24686886 GGCCGGGCGGCGGCGGCTGTAGG + Intergenic
1181984384 22:26789445-26789467 CCCCGTGCTGCGGTGGCAGTAGG + Intergenic
1185278622 22:49960654-49960676 GCCCGCGAGGCGGCGGCGGCCGG - Exonic
1185338361 22:50280803-50280825 CCCTGAGCCGCGGCGGCCGGTGG - Exonic
1203253484 22_KI270733v1_random:128545-128567 GCCGACGCCGCGGCGGCCGTCGG + Intergenic
1203261538 22_KI270733v1_random:173623-173645 GCCGCCGCCGCGGCGGCCGTCGG + Intergenic
950345326 3:12287854-12287876 CCCGGCGCGGGGGCGGGCGCGGG - Intronic
950710628 3:14810753-14810775 CCCCGCGGGGCGGCCGCGGAGGG + Intergenic
951140084 3:19148370-19148392 CACCGCGCGGCGGCGCCTGGCGG + Intergenic
951898344 3:27632766-27632788 CCCCCCGGGCCGGCTGCCGTCGG - Intergenic
953680667 3:45035924-45035946 GCCGGCGGGGCGGGGGCCGTGGG + Exonic
954613477 3:51958135-51958157 CCAAGCCCGGCGGCGGCCCTGGG + Exonic
954838899 3:53494531-53494553 CGCGGCGCGGCGCGGGCCGTGGG + Intergenic
955916483 3:63912638-63912660 CGCCGCGCGGCGGCGGCGGCGGG + Exonic
956468681 3:69542752-69542774 CCCCGTGCGGCGGGGGCCGAGGG - Intergenic
966594348 3:181712433-181712455 TCCACCGCGGCGGCGGCCGGCGG + Exonic
967904070 3:194486698-194486720 CAGCGCGCGGCGCCGGCCGAGGG - Intronic
968515138 4:1012543-1012565 CCTCGGGCGGCGGCGGCCGGCGG - Exonic
968659641 4:1793710-1793732 CCCTGGGCGGCGGCGGCGGCGGG + Intronic
971257812 4:25030433-25030455 TCCCTCGCGGCGGCGGACGCAGG + Intronic
972396454 4:38663530-38663552 CGCCGCGCCGCGCCGGCCGCGGG + Intergenic
972532901 4:39977066-39977088 CCACGCGCAGCGGCGGCTGCCGG + Intronic
972765790 4:42151704-42151726 CCAGGCGCGGCGGCGGCCGCCGG - Exonic
973954426 4:56049102-56049124 TGCCGCGCGGTGGCGGCAGTGGG + Intergenic
975342570 4:73258562-73258584 CCCCCCGCGGCGGCGGAGGTCGG - Exonic
976390017 4:84497706-84497728 GCCCGGGCGGCGGCGGCGGCGGG + Exonic
976629145 4:87219892-87219914 CCCCGCGCGGCGTGGCCCGGAGG + Intronic
976719798 4:88158746-88158768 CCTCGCGCGGCGGCCGGCGTGGG + Exonic
979278195 4:118836199-118836221 CCCCGCCCCGCGGCGGCCGGTGG - Intronic
981516904 4:145619458-145619480 CCCGGCGGGAGGGCGGCCGTAGG - Intronic
984639373 4:182144858-182144880 CCCCGGGAGGCGGCGGACGCGGG + Intronic
985513087 5:322821-322843 CCCCAGGCGGCGGCGTCCGCCGG - Intronic
985791694 5:1931583-1931605 CCGCGGGTGGCGGCGGCTGTGGG - Intergenic
989102283 5:37834607-37834629 CCCCGCGGGGGGGCCGCCGGCGG - Intronic
989102301 5:37834665-37834687 GGGCGCGCGGCGGCGGCCGAGGG + Exonic
991063636 5:62403728-62403750 CCGCCCGCGGCGGCGGCCGATGG + Exonic
991298163 5:65103018-65103040 CCCCTCGCCTCGGCGGCCGCCGG + Intergenic
992124321 5:73625892-73625914 CGCTGCGGGGCTGCGGCCGTTGG - Intergenic
992866438 5:80960976-80960998 CCCTGCCCGGCGCCGGCCCTGGG - Exonic
995313377 5:110739017-110739039 CCTGACGCGGCGGCGGCCGACGG + Exonic
999462910 5:151772166-151772188 CCGCGCGCGCCTGCGGCCGTTGG - Intronic
1003049415 6:2766049-2766071 CCCGCCGCGGCGGCGGCCGCCGG - Exonic
1005648866 6:27867662-27867684 CCGCGAGCGGCGGCGGCCAGAGG - Intergenic
1007226955 6:40321805-40321827 CCACCGGCGGCGGCGGGCGTGGG - Intergenic
1011272525 6:85593881-85593903 GCACGCGCGGCGGGGGGCGTGGG - Exonic
1013225747 6:108118500-108118522 CGCCGGGCTGCGGGGGCCGTGGG + Intronic
1013272863 6:108559618-108559640 CTCCGCGGGGCTGCGGGCGTGGG - Intergenic
1014230104 6:118893981-118894003 GCCCGCGCGGAGGCCGCCGGCGG - Intronic
1015910171 6:138161840-138161862 CTCCGCTCGGCGGCGGCTGCGGG - Intergenic
1016328180 6:142926828-142926850 CCGCGCCCGGCGGCCGCCGCAGG - Intronic
1016330275 6:142946572-142946594 CCGCCCGCAGCGGCAGCCGTGGG - Intergenic
1017174988 6:151494205-151494227 CCGCGCGCGGGGGTGGCCCTGGG + Intronic
1019379254 7:712593-712615 CCCCGCGGGGAGGCGGTCGGGGG - Intronic
1019527614 7:1487720-1487742 CCCCGCCCTGCGCCTGCCGTCGG - Intronic
1021452774 7:20798054-20798076 GCCCGGGCTGCGGCGGCCGCGGG + Intergenic
1022363373 7:29685051-29685073 CTCCCCGCGGCGGCGGCCTCCGG + Intergenic
1023955710 7:44885304-44885326 GCGAGCGCGGCGGCGGCGGTGGG - Exonic
1026817140 7:73521929-73521951 GCCATCGCGGCGGCGGCGGTGGG + Exonic
1028856171 7:95596518-95596540 CCTCGGGCGGCGGCGGCTGGTGG - Intergenic
1029834761 7:103297495-103297517 CGCGGCGCGGCGGCGGCTCTGGG + Exonic
1030176501 7:106660422-106660444 CCTCGGGGGGCGGCGGCGGTGGG + Exonic
1031966526 7:128031571-128031593 CCCCGCGTGCCGGCAGCCGGCGG - Intronic
1032279762 7:130491392-130491414 CCCCGCGCAGCGGCGGTGGCTGG + Intronic
1034339184 7:150341196-150341218 CCCGGCGCGGGGGCTGCCGCGGG + Exonic
1034455500 7:151167815-151167837 CCGGGCGCGGCGGCGGCGGGCGG - Intronic
1038152657 8:24956533-24956555 CCCCGGCCCGCGGCGGCGGTGGG + Exonic
1038540376 8:28385917-28385939 CCCCGCGCGCCCGCGGCTGTCGG - Intronic
1040512213 8:48105544-48105566 CCCCGCGAGGCGGCAGCCCCTGG - Intergenic
1044973721 8:97644146-97644168 CCGCGCGCGGGGACGACCGTGGG - Intergenic
1045063765 8:98427947-98427969 CCCCGCGCGGCGCGGGCGGCCGG + Exonic
1049409035 8:142464274-142464296 CGCCGCGCGCGGGCGGCCGCCGG + Exonic
1049585301 8:143430161-143430183 CCCCGCGCCGCCGCCGCCGCCGG + Exonic
1049719265 8:144108128-144108150 CCCCGCGCGCCCGCGCCCGCCGG + Exonic
1049752224 8:144290733-144290755 CCCAGCGCGGCCGCGGCCGAGGG + Intronic
1052982322 9:34458319-34458341 CCGCGCGGGGCGGCGGCCCCAGG + Exonic
1055945715 9:81689506-81689528 GCGCGGGCGGCGGCGGCGGTGGG - Intergenic
1057772739 9:97983028-97983050 CTCAGCGCGGCGGGGGCCGGGGG + Intergenic
1057881584 9:98796487-98796509 CCGCGCGTGGCGGCGGCGATGGG - Exonic
1057997138 9:99828685-99828707 CTGAGCGCGGCAGCGGCCGTCGG - Exonic
1062595073 9:137295746-137295768 CCACGCGCGGCGGCGTCTGGTGG + Intergenic
1203469884 Un_GL000220v1:111692-111714 GCCGCCGCCGCGGCGGCCGTCGG + Intergenic
1203477705 Un_GL000220v1:155664-155686 GCCGCCGCCGCGGCGGCCGTCGG + Intergenic
1187393809 X:18903437-18903459 CCCCGGGCAGCTGTGGCCGTGGG + Intronic
1196842542 X:119871809-119871831 CCCCGCTCGCGGGCGGCCGCGGG + Exonic
1198388139 X:136147717-136147739 CCCCGAGCGGCGGCGGCGGCGGG - Intronic