ID: 1153565615

View in Genome Browser
Species Human (GRCh38)
Location 18:6414752-6414774
Sequence GGATGGTCGCGAGCCCGCGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 38
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 35}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153565615_1153565626 17 Left 1153565615 18:6414752-6414774 CCCACGCGGGCTCGCGACCATCC 0: 1
1: 0
2: 0
3: 2
4: 35
Right 1153565626 18:6414792-6414814 CCTTCTTACCCCCAGCGGAGCGG 0: 1
1: 0
2: 0
3: 8
4: 64
1153565615_1153565624 12 Left 1153565615 18:6414752-6414774 CCCACGCGGGCTCGCGACCATCC 0: 1
1: 0
2: 0
3: 2
4: 35
Right 1153565624 18:6414787-6414809 GGCGTCCTTCTTACCCCCAGCGG 0: 1
1: 0
2: 0
3: 6
4: 76
1153565615_1153565620 -9 Left 1153565615 18:6414752-6414774 CCCACGCGGGCTCGCGACCATCC 0: 1
1: 0
2: 0
3: 2
4: 35
Right 1153565620 18:6414766-6414788 CGACCATCCCACGCGGGCGGCGG 0: 1
1: 0
2: 0
3: 2
4: 27

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153565615 Original CRISPR GGATGGTCGCGAGCCCGCGT GGG (reversed) Intronic