ID: 1153565670

View in Genome Browser
Species Human (GRCh38)
Location 18:6414926-6414948
Sequence GAGGGTGCACGCGCGGGGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 206}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153565647_1153565670 28 Left 1153565647 18:6414875-6414897 CCAGCCCAGGCTGCGGCGCCGCT 0: 1
1: 1
2: 1
3: 22
4: 252
Right 1153565670 18:6414926-6414948 GAGGGTGCACGCGCGGGGTGGGG 0: 1
1: 0
2: 0
3: 21
4: 206
1153565663_1153565670 -6 Left 1153565663 18:6414909-6414931 CCCGGCGGGAGGGGCGCGAGGGT 0: 1
1: 0
2: 1
3: 25
4: 200
Right 1153565670 18:6414926-6414948 GAGGGTGCACGCGCGGGGTGGGG 0: 1
1: 0
2: 0
3: 21
4: 206
1153565660_1153565670 2 Left 1153565660 18:6414901-6414923 CCGCGGTGCCCGGCGGGAGGGGC 0: 1
1: 0
2: 4
3: 24
4: 301
Right 1153565670 18:6414926-6414948 GAGGGTGCACGCGCGGGGTGGGG 0: 1
1: 0
2: 0
3: 21
4: 206
1153565652_1153565670 10 Left 1153565652 18:6414893-6414915 CCGCTGCCCCGCGGTGCCCGGCG 0: 1
1: 0
2: 1
3: 31
4: 275
Right 1153565670 18:6414926-6414948 GAGGGTGCACGCGCGGGGTGGGG 0: 1
1: 0
2: 0
3: 21
4: 206
1153565664_1153565670 -7 Left 1153565664 18:6414910-6414932 CCGGCGGGAGGGGCGCGAGGGTG 0: 1
1: 0
2: 1
3: 16
4: 210
Right 1153565670 18:6414926-6414948 GAGGGTGCACGCGCGGGGTGGGG 0: 1
1: 0
2: 0
3: 21
4: 206
1153565648_1153565670 24 Left 1153565648 18:6414879-6414901 CCCAGGCTGCGGCGCCGCTGCCC 0: 1
1: 0
2: 2
3: 37
4: 275
Right 1153565670 18:6414926-6414948 GAGGGTGCACGCGCGGGGTGGGG 0: 1
1: 0
2: 0
3: 21
4: 206
1153565649_1153565670 23 Left 1153565649 18:6414880-6414902 CCAGGCTGCGGCGCCGCTGCCCC 0: 1
1: 1
2: 1
3: 56
4: 430
Right 1153565670 18:6414926-6414948 GAGGGTGCACGCGCGGGGTGGGG 0: 1
1: 0
2: 0
3: 21
4: 206
1153565658_1153565670 3 Left 1153565658 18:6414900-6414922 CCCGCGGTGCCCGGCGGGAGGGG 0: 1
1: 0
2: 1
3: 28
4: 262
Right 1153565670 18:6414926-6414948 GAGGGTGCACGCGCGGGGTGGGG 0: 1
1: 0
2: 0
3: 21
4: 206
1153565656_1153565670 4 Left 1153565656 18:6414899-6414921 CCCCGCGGTGCCCGGCGGGAGGG 0: 1
1: 0
2: 0
3: 14
4: 201
Right 1153565670 18:6414926-6414948 GAGGGTGCACGCGCGGGGTGGGG 0: 1
1: 0
2: 0
3: 21
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153565670 Original CRISPR GAGGGTGCACGCGCGGGGTG GGG Intronic
901242866 1:7704954-7704976 GCGGGGGCGCGCGCGGGGCGGGG + Intronic
901762661 1:11480662-11480684 GTGTGTGCACGCGCGCGCTGGGG - Intronic
901801049 1:11708157-11708179 TAGAGGGCACGCGTGGGGTGTGG + Intronic
901842988 1:11965407-11965429 GAGCGTGCAGGGGAGGGGTGAGG + Intronic
903227322 1:21901343-21901365 GAGGGTGCATGGTAGGGGTGAGG + Intronic
904008747 1:27378023-27378045 GAAGGTGCAAGGGAGGGGTGAGG + Intergenic
914490908 1:148149613-148149635 GTGGGGGCCGGCGCGGGGTGAGG - Intronic
920308603 1:205034633-205034655 GAGGGTGCAAGGAAGGGGTGAGG + Intergenic
921944905 1:220879790-220879812 GTGGGTGGGCGCGCGGGGAGGGG - Exonic
924719514 1:246609056-246609078 GAGGGTGCAACCCGGGGGTGTGG + Intronic
1064622375 10:17229140-17229162 GAGGGTGGGCGGGTGGGGTGGGG - Intronic
1065204543 10:23344322-23344344 GAGGGAGCACGCGCGGGAGGAGG + Intronic
1066963638 10:42242458-42242480 GAGGGGGGGCGCGCGGGGAGCGG - Intergenic
1067222771 10:44355974-44355996 GTGTGTGCACGCTAGGGGTGGGG + Intergenic
1070655099 10:78265933-78265955 GAGGGTGCAGGGTCAGGGTGGGG + Intergenic
1070823608 10:79377951-79377973 GAGGGTGCACGTGTGAGATGAGG + Intergenic
1070823633 10:79378262-79378284 GAGGGTGCACGTGTGCGGTGTGG + Intergenic
1073429343 10:103476257-103476279 GAGGGTGCAAGGGCCGGGGGAGG + Intronic
1074088753 10:110227403-110227425 GAGGGTGCGCACGGAGGGTGGGG + Intronic
1076520589 10:131078490-131078512 GAGGCTGCAGGAGCAGGGTGAGG - Intergenic
1076670373 10:132117653-132117675 GAGGGTGCAGGCGTGGGCTCGGG + Intronic
1078594626 11:12675113-12675135 GAGGGGGCGCGCGGGGGGCGCGG - Intronic
1080496968 11:32829960-32829982 CGGGGAACACGCGCGGGGTGAGG - Exonic
1081700059 11:45147038-45147060 GACGGCGCCGGCGCGGGGTGGGG + Intronic
1083285558 11:61656526-61656548 GAGGGTGCAGGGGCGCGGGGTGG + Intergenic
1083753616 11:64777796-64777818 GAGTGCGCACGCGCGCTGTGGGG - Intronic
1084393240 11:68892115-68892137 GTGGGTTCACGCGCGGAGGGTGG + Intronic
1084393251 11:68892155-68892177 GTGGGTTCACGCGCGGAGGGTGG + Intronic
1089169277 11:116500853-116500875 GCGGGTGCACGCGGGGGCCGGGG - Intergenic
1092170591 12:6371545-6371567 GAGGGTGGACGGTGGGGGTGGGG + Intronic
1092204389 12:6606671-6606693 GCTGGTGCAAGCGCGGGGAGGGG + Intronic
1093247814 12:16761903-16761925 GAGGGTGCCAGCTGGGGGTGGGG - Intergenic
1101772134 12:107761180-107761202 GAGGGCGCACGCACGAGGGGCGG - Intronic
1101963611 12:109267446-109267468 GAGGGTGCATGCGCAGGCTGGGG - Exonic
1103310937 12:120007450-120007472 GAGTGTGTACGTGGGGGGTGGGG - Intronic
1103985874 12:124767173-124767195 GAGGCTGCACGTGCGGATTGTGG - Intergenic
1104670125 12:130674771-130674793 GAGGGTGCAGGGGCGGGGGTGGG - Intronic
1107462398 13:40616728-40616750 GAGGCTGCATGCAAGGGGTGTGG + Intronic
1110596483 13:77326401-77326423 GCGGGTGCACGCGCGGCATGGGG + Intronic
1113082719 13:106535161-106535183 GGGAGCGCACGCGCGGGGCGCGG + Intergenic
1113364932 13:109667011-109667033 GAGGTAGCAGGGGCGGGGTGGGG - Intergenic
1113693855 13:112330404-112330426 GAGGGTGGCCCCGTGGGGTGGGG - Intergenic
1119364905 14:74083850-74083872 GAGGGGGGACGCGAGGGGCGAGG - Intronic
1121074934 14:91060252-91060274 GCGGGTGCCCGCGCGGGGCTGGG - Intronic
1121453899 14:94026609-94026631 GCGGGTGCACCCGCGGGACGGGG + Intronic
1122550171 14:102545110-102545132 AGGTGCGCACGCGCGGGGTGGGG - Intergenic
1123054746 14:105563989-105564011 GTGTGTGCACGTGTGGGGTGTGG + Intergenic
1123079186 14:105683548-105683570 GTGTGTGCACGTGTGGGGTGTGG + Intergenic
1123121884 14:105920479-105920501 GGGCGTGCACGGGAGGGGTGTGG + Intronic
1127836576 15:62795426-62795448 GAGGGTGTACGTGATGGGTGAGG + Intronic
1128061871 15:64740513-64740535 GTGGGTGCAGGGGCGGGGCGAGG + Exonic
1128217446 15:65944352-65944374 GAGGGTGCACCAGCAGGATGTGG + Intronic
1128252282 15:66171771-66171793 GAGGGTGAGCGCTGGGGGTGGGG - Intronic
1129854163 15:78811923-78811945 GCGGTTGCCCGCGCGAGGTGGGG + Intronic
1129893758 15:79089393-79089415 CAGGGAGCCCGGGCGGGGTGGGG - Intronic
1130295726 15:82646440-82646462 GGGGCTGCAGGCGCGGGGCGGGG + Intronic
1132514801 16:361286-361308 GAGGGTGCGGGCGCTGCGTGTGG + Intergenic
1132595419 16:746881-746903 GAGGGTGGCCCTGCGGGGTGGGG - Intronic
1132663811 16:1072844-1072866 GGGGGTGCCCGCGCGGGAGGGGG - Intergenic
1132805363 16:1772761-1772783 GCGGCTGCAGGGGCGGGGTGCGG + Intronic
1133328624 16:4957808-4957830 GAAGGTGCATGCGCGGGCCGTGG + Intronic
1135296443 16:21283649-21283671 TTGGGAGCATGCGCGGGGTGGGG + Intronic
1136384083 16:29911881-29911903 GAGGATGGACGAGAGGGGTGAGG + Intronic
1136707753 16:32202875-32202897 GGGGGGGCCGGCGCGGGGTGAGG - Intergenic
1136760156 16:32726536-32726558 GGGGGGGCCGGCGCGGGGTGAGG + Intergenic
1136807948 16:33143850-33143872 GGGGGGGCCGGCGCGGGGTGAGG - Intergenic
1137492393 16:48943992-48944014 GAGGGTGCTTGTGTGGGGTGAGG + Intergenic
1138383131 16:56617426-56617448 GCGGGTGCAAGCGCGGGGCGGGG + Intergenic
1138385363 16:56632579-56632601 GCGGGTGCAAGCGCGGGGCAGGG + Exonic
1138385938 16:56635665-56635687 GCGGGTGCAAGCGCGGGGCAAGG + Intergenic
1138476017 16:57271016-57271038 CAGGGTCCACGCGGGAGGTGGGG - Intronic
1140219525 16:73033517-73033539 AAGGGGGCAGGCGGGGGGTGGGG + Intronic
1140457828 16:75115032-75115054 GGGGGGACACCCGCGGGGTGTGG - Intronic
1141477029 16:84281016-84281038 GTGGGGGGACGGGCGGGGTGGGG - Intergenic
1141996732 16:87640842-87640864 GAGGGTGCAGTCTTGGGGTGAGG + Intronic
1142382019 16:89738304-89738326 GCGGGTGCACACGAAGGGTGAGG - Exonic
1142605008 17:1076705-1076727 GCAGGTGCACGGGGGGGGTGGGG + Intronic
1143111940 17:4557914-4557936 GAGTGTGCACCCGCAGGGTGTGG - Exonic
1143864073 17:9911359-9911381 GTGGGTGCTCTCTCGGGGTGGGG - Intronic
1144784679 17:17824955-17824977 GAGGGAACACCCGCGGGCTGAGG - Intronic
1144816597 17:18039597-18039619 GGGCGCGCACGCGCGGGGTGGGG - Exonic
1146179380 17:30687547-30687569 GTGGGGGCAGGCGCGGGGCGGGG - Intergenic
1147393031 17:40121958-40121980 GAGGACGCATGCGCGGGGAGGGG - Intergenic
1148769102 17:50056682-50056704 GAGTGTGCGAGCGCGGGATGCGG + Intronic
1152107995 17:78341970-78341992 GCGGGTCCGCGGGCGGGGTGGGG + Intergenic
1152537989 17:80961363-80961385 GAGGGGGCACGCTCAGCGTGGGG - Intronic
1153565670 18:6414926-6414948 GAGGGTGCACGCGCGGGGTGGGG + Intronic
1160384299 18:78485655-78485677 GAGGCTGCAGGCGCAGAGTGTGG - Intergenic
1160384351 18:78485907-78485929 GAGGCTGCAGGCGCAGAGTGTGG - Intergenic
1160384413 18:78486202-78486224 GAGGCTGCAGGCGCAGAGTGTGG - Intergenic
1160795032 19:941248-941270 GAGTGTGCACGCTGGGGCTGTGG + Intronic
1160904517 19:1446094-1446116 GGGGGTGCTCGCGGGGGCTGGGG - Intergenic
1160978603 19:1806322-1806344 GAGCGTGGACCCGCGGGGAGTGG - Intronic
1160994677 19:1877131-1877153 GTGGGGGCCGGCGCGGGGTGAGG + Exonic
1161702376 19:5802530-5802552 GAGGGGGCACAGGCGGTGTGGGG + Intergenic
1162339855 19:10086014-10086036 GGGGGAGCGCGCGCTGGGTGGGG + Intergenic
1162742679 19:12782600-12782622 GTGCGTGCAAGCGCGGGGGGTGG + Intronic
1162758440 19:12874266-12874288 GGGGGTCGTCGCGCGGGGTGGGG - Exonic
1162861167 19:13506495-13506517 GAGGGTGCGGGGGCGGGGCGCGG + Intronic
1163146262 19:15380695-15380717 GTGGGTGCAGGGGCGGGGTGGGG - Intronic
1165106689 19:33474219-33474241 GAGGGGGCACCCGTGGAGTGGGG - Intronic
1165851234 19:38851411-38851433 GGGGCTGCCCGCGCAGGGTGTGG + Intronic
1166328520 19:42065658-42065680 GAGGATGCAGGGGCAGGGTGCGG + Intronic
1168493976 19:56835158-56835180 GAGGGTGGACGCAGTGGGTGTGG - Intronic
925643185 2:6006911-6006933 GAGGGTGCAGGGGTGGGGGGGGG - Intergenic
927652185 2:24919715-24919737 GACGGTCCCCGCGCGGGCTGGGG + Exonic
932329448 2:70889362-70889384 GGGGGTGCGAGCGCGGGCTGGGG - Intergenic
936145107 2:109975648-109975670 GAGGGTGCAGGCCCTGGGTGAGG + Intergenic
936199578 2:110395830-110395852 GAGGGTGCAGGCCCTGGGTGAGG - Intergenic
937914629 2:127092840-127092862 GGGGGTGCAGGCGTGGGCTGTGG - Intronic
939629473 2:144516218-144516240 GAGGGTGCCGGGGGGGGGTGGGG - Intronic
940612292 2:156006785-156006807 GAGCCTGCAGGCCCGGGGTGGGG + Intergenic
941905893 2:170716101-170716123 GTGGGTGCGTGCGTGGGGTGCGG + Intronic
948874609 2:240820028-240820050 GTGGGTGCAGGTGCGGGCTGCGG + Intronic
949021710 2:241744516-241744538 CAGGGGGCACGCCCGGGGTCGGG - Intronic
949042989 2:241857965-241857987 GAGGGTCCAGGAGCGGGCTGTGG + Intronic
1168800882 20:642572-642594 GGCGGCGGACGCGCGGGGTGAGG + Intergenic
1172011783 20:31849888-31849910 GAGGGTGCACGGGCTGGACGTGG + Intronic
1172118294 20:32584103-32584125 GAGGGTGGTGCCGCGGGGTGGGG - Intronic
1172702799 20:36863280-36863302 GCGGGTGCAGGCGCGGGCTGGGG + Exonic
1175337395 20:58205442-58205464 GTGGGTGCAGACGTGGGGTGCGG - Intergenic
1175422007 20:58840580-58840602 GAGCGTGCAGACGCTGGGTGAGG - Intronic
1175793841 20:61758807-61758829 GAGGGCGCACAGGCGTGGTGCGG + Intronic
1176097318 20:63350065-63350087 CAGGGTCCAGGCGAGGGGTGGGG + Exonic
1176194453 20:63830941-63830963 GAGGGCGCCCCCGCGGGGCGGGG + Intronic
1177151436 21:17459088-17459110 GAGGGTGGAGGTGGGGGGTGGGG + Intergenic
1179141811 21:38732493-38732515 GAGAGTGCAGGTGAGGGGTGAGG - Intergenic
1179179588 21:39034391-39034413 GAGGGTGCAGACGTGAGGTGTGG - Intergenic
1179950827 21:44707992-44708014 GTGTGTGCACGCGCGGGGCGGGG - Intronic
1179970822 21:44836096-44836118 GGGGCTGCACGGGTGGGGTGGGG - Intergenic
1180104425 21:45608598-45608620 CAGGGTCCACGCACGGGGTGGGG - Intergenic
1180259368 21:46658106-46658128 GAGGGAGCACCAGCGAGGTGGGG - Intronic
1182149510 22:28018293-28018315 GTGTGTGCGCGCGCGGGGGGGGG + Intronic
1182282761 22:29226638-29226660 GAGGGTGCGAGCATGGGGTGCGG - Intronic
1182618325 22:31603688-31603710 GAGGGTGCCCTCACTGGGTGGGG + Intronic
1183072686 22:35407356-35407378 GAGGGTGGACGCGGGGGATCAGG - Intronic
1183788390 22:40045150-40045172 GAGGGAGCGCGCGTGGGGCGGGG + Intronic
1184248886 22:43249207-43249229 GTGGGTGAATGTGCGGGGTGGGG + Intronic
1184263202 22:43331741-43331763 GAGGGGGCAGGCTGGGGGTGAGG - Intronic
1184377764 22:44125311-44125333 GAGTGGGCAGGCGCAGGGTGCGG - Intronic
1184751155 22:46487586-46487608 CAGGGTGCAGGTGGGGGGTGCGG + Intronic
1184751171 22:46487621-46487643 CAGGGTGCAGGTGGGGGGTGCGG + Intronic
1184751209 22:46487713-46487735 CAGGGTGCAGGTGGGGGGTGAGG + Intronic
1184863573 22:47190517-47190539 GAGGGTGCGGGCGCTGGGTGGGG - Intergenic
1185188549 22:49418059-49418081 GCGGGTGCACGTGTGGGGTGTGG - Intronic
1185337296 22:50276350-50276372 GAGGGTGCAGCCGCAGGGAGGGG + Intronic
1185340640 22:50289416-50289438 GAGGGTGCACGTGAGCAGTGTGG - Intronic
950449149 3:13055851-13055873 CAGGGTCCAGGCCCGGGGTGGGG + Intronic
951544479 3:23810791-23810813 TCGGGGGCGCGCGCGGGGTGGGG + Intronic
953925364 3:46979922-46979944 GCGGGTGCGGGCGCGGGGCGGGG - Intronic
955325825 3:58008899-58008921 AGGGGTGCACGCGCGGGGGCGGG - Intronic
958814535 3:98901445-98901467 AAGGGTCCCGGCGCGGGGTGAGG - Exonic
960223764 3:115146980-115147002 GAGGGGGCGCGGGCGGGGCGGGG + Intronic
961353027 3:126316193-126316215 GGGAGTGCACGGGCGGAGTGGGG + Intergenic
968196606 3:196712335-196712357 AAGGGTTCCCGCGCGGCGTGGGG - Intronic
968511385 4:997373-997395 GGGGGAGACCGCGCGGGGTGGGG - Intronic
968651319 4:1761380-1761402 CAGGGTGCACGGGGTGGGTGGGG - Intergenic
968831494 4:2934683-2934705 GACAGGGGACGCGCGGGGTGGGG - Intronic
969301414 4:6299462-6299484 GAGGGTGCACGTGTGGGGGTGGG + Intronic
969344579 4:6563121-6563143 GAAGGTGCGGGCGCGGGGTCCGG - Intronic
969675524 4:8612199-8612221 GGGGGTGCAGGGGCTGGGTGGGG + Intronic
969712593 4:8852536-8852558 GAGGCTGCACACGCGGGGCCTGG + Intronic
970529495 4:16967604-16967626 GAGGGTGCGGGCGAGGGGTGTGG - Intergenic
972282828 4:37619469-37619491 AAGGGTGCAGGGGCTGGGTGCGG - Intronic
972718850 4:41675657-41675679 GAGGGTACAGGTGGGGGGTGGGG - Intronic
975710598 4:77157304-77157326 GAGGGTGGGCGCGCGGGGAGCGG + Exonic
976751667 4:88456363-88456385 GAGCGGGCACGAGGGGGGTGGGG + Intergenic
977809701 4:101346063-101346085 GAGGGTGGCCGCGGGGGGCGCGG - Intronic
978401425 4:108335105-108335127 GAAGATGCACGGGCGTGGTGGGG + Intergenic
979231582 4:118353173-118353195 GAGGGTGCCCGCGCGGAGCACGG + Intergenic
985686119 5:1282673-1282695 GATGGTGCAGGTCCGGGGTGAGG - Intronic
985686220 5:1283105-1283127 GATGGTGCAGGTCCGGGGTGAGG - Intronic
985686249 5:1283227-1283249 GATGGTGCAGGTCCGGGGTGAGG - Intronic
985686275 5:1283348-1283370 GATGGTGCAGGTCCGGGGTGAGG - Intronic
985686288 5:1283409-1283431 GATGGTGCAGGTCCGGGGTGAGG - Intronic
985686303 5:1283470-1283492 GATGGTGCAGGTCCGGGGTGAGG - Intronic
985686319 5:1283531-1283553 GATGGTGCAGGTCCGGGGTGAGG - Intronic
985686336 5:1283592-1283614 GATGGTGCAGGTCCGGGGTGAGG - Intronic
985686437 5:1284023-1284045 GATGGTGCAGGTCCGGGGTGAGG - Intronic
985686566 5:1284568-1284590 GATGGTGCAGGTCCGGGGTGAGG - Intronic
987373945 5:17217539-17217561 GCGGGCGGACGCGCGGGGGGAGG + Exonic
989368221 5:40679739-40679761 GGGGCTGGGCGCGCGGGGTGGGG - Exonic
993727406 5:91383647-91383669 GAGGGTACAAGGGCTGGGTGGGG + Intergenic
994710538 5:103259195-103259217 GGTGGGGCCCGCGCGGGGTGCGG + Intronic
997781362 5:136661928-136661950 CAGGGTGAACCAGCGGGGTGAGG + Intergenic
999294484 5:150449958-150449980 GCGGCTACACCCGCGGGGTGAGG + Intergenic
1001945200 5:175772740-175772762 TAGGGTGGAGGGGCGGGGTGGGG - Intergenic
1001992984 5:176133236-176133258 AAGCGTGTAGGCGCGGGGTGCGG + Intergenic
1002401702 5:178994788-178994810 CCCGGTGCACGCGCGGGGCGCGG - Exonic
1002885162 6:1286901-1286923 GAGGGTGAACTCGCAGGGTCTGG - Intergenic
1007829068 6:44624508-44624530 GAGGGGGCTGGCGGGGGGTGGGG + Intergenic
1013306181 6:108848718-108848740 GAGGGTGGCCGGGCGGGGTGAGG + Intronic
1017913926 6:158818320-158818342 GAGGGGGCACGGGCGGGGCGGGG + Intronic
1019198681 6:170296742-170296764 GCAGGAGCCCGCGCGGGGTGGGG + Intronic
1019299601 7:296490-296512 GAGGATGGAGGGGCGGGGTGGGG - Intergenic
1021535019 7:21693943-21693965 GAGAGAACACGCGCGAGGTGGGG + Intronic
1022973532 7:35537433-35537455 GTGGGAGCACGCGGGGGGTCTGG + Intergenic
1023041903 7:36179927-36179949 GAGAGTGCAAGCCAGGGGTGGGG - Intronic
1025917002 7:65873609-65873631 GAGGGTGGAGTCTCGGGGTGGGG + Intronic
1026850398 7:73719794-73719816 GGGGCTGCTCGTGCGGGGTGGGG - Intergenic
1029673658 7:102051052-102051074 AAGGGACCACGCCCGGGGTGGGG - Intronic
1032159859 7:129502253-129502275 GAGGGGGCGGGCGCGGGGCGAGG - Intergenic
1032159868 7:129502272-129502294 GAGGGGGCGGGCGCGGGGCGAGG - Intergenic
1034162355 7:149002731-149002753 GACGGGGGAGGCGCGGGGTGAGG + Intergenic
1034461266 7:151199298-151199320 GGGGGTGCAGGCGGGGGCTGGGG - Intronic
1034494152 7:151410110-151410132 GAGGCTGCAGGCGCGCGGGGTGG - Intronic
1034895568 7:154874391-154874413 GAGTGTGCACCCAGGGGGTGGGG - Intronic
1035291846 7:157844330-157844352 GAGGGTGCAGGCTGGGGATGGGG - Intronic
1035368018 7:158361207-158361229 GAGGGTGGACGCGGGGTCTGTGG - Intronic
1037901577 8:22692210-22692232 GGGGGTTCACCCGCGGGGCGAGG - Intronic
1041167194 8:55102072-55102094 GAGGGAGCGCGCGCGAGGGGAGG + Intergenic
1042695131 8:71547539-71547561 GAGGCTGCCCGGGCGGGCTGGGG + Exonic
1045674090 8:104589057-104589079 GAGGGAGCGCGCGCGGGCGGCGG - Intergenic
1045815092 8:106269986-106270008 GAGGGGCCGCGCGCGGGGAGGGG + Intergenic
1049291095 8:141802360-141802382 GAGGGTGCTGGCGGGGTGTGGGG + Intergenic
1049463132 8:142739301-142739323 GAGGGCGCGCCCACGGGGTGGGG - Intergenic
1049581350 8:143412570-143412592 GAGGGTTCACGGTGGGGGTGGGG - Intergenic
1049744079 8:144255758-144255780 GCGTGTGCACGCGCGTGGTGGGG + Intronic
1059977809 9:119736755-119736777 GAGGGTGCACGCAGGAGGGGAGG + Intergenic
1060584396 9:124777152-124777174 CAGGGTGCAGGCGCGGGGCGCGG + Intronic
1061035188 9:128109546-128109568 GAGGAGGCAGGAGCGGGGTGAGG - Intergenic
1061682146 9:132248114-132248136 GAGGGTGCGGGTGCGTGGTGGGG - Intergenic
1062120175 9:134829866-134829888 GAGGATGCAGGCGCGGGGGCCGG + Intronic
1186107968 X:6226915-6226937 GCGGGTGCCAGCGCGGGCTGTGG + Intronic
1186480177 X:9890717-9890739 GAGAGTGCACGTGCTGTGTGTGG + Intronic
1199872611 X:151912751-151912773 GGGGGTGCAGGTGTGGGGTGGGG - Intronic
1200068701 X:153517562-153517584 GAGGGAGCGGGCGCGGGGGGCGG - Intergenic
1200092581 X:153642782-153642804 GGAGGTGCACGGGCGGCGTGCGG - Intronic