ID: 1153569241

View in Genome Browser
Species Human (GRCh38)
Location 18:6451835-6451857
Sequence CTTCACATACAGCCTGTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153569241_1153569248 12 Left 1153569241 18:6451835-6451857 CCTGCCACAGGCTGTATGTGAAG No data
Right 1153569248 18:6451870-6451892 TGCATGAAATCCCCAGAGCTGGG No data
1153569241_1153569247 11 Left 1153569241 18:6451835-6451857 CCTGCCACAGGCTGTATGTGAAG No data
Right 1153569247 18:6451869-6451891 ATGCATGAAATCCCCAGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153569241 Original CRISPR CTTCACATACAGCCTGTGGC AGG (reversed) Intergenic
No off target data available for this crispr