ID: 1153570963

View in Genome Browser
Species Human (GRCh38)
Location 18:6473321-6473343
Sequence AGTCCATCCAGTCTCTCTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153570963_1153570966 2 Left 1153570963 18:6473321-6473343 CCAACAGAGAGACTGGATGGACT No data
Right 1153570966 18:6473346-6473368 CCTAGGTCACTGCCATTCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153570963 Original CRISPR AGTCCATCCAGTCTCTCTGT TGG (reversed) Intergenic
No off target data available for this crispr