ID: 1153575903

View in Genome Browser
Species Human (GRCh38)
Location 18:6521542-6521564
Sequence TTTTAGTCAGATATTTTTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 481
Summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 443}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153575898_1153575903 -9 Left 1153575898 18:6521528-6521550 CCCTTTAGTGAATTTTTTAGTCA 0: 1
1: 0
2: 9
3: 43
4: 561
Right 1153575903 18:6521542-6521564 TTTTAGTCAGATATTTTTGGGGG 0: 1
1: 0
2: 2
3: 35
4: 443
1153575897_1153575903 -8 Left 1153575897 18:6521527-6521549 CCCCTTTAGTGAATTTTTTAGTC 0: 1
1: 0
2: 4
3: 62
4: 434
Right 1153575903 18:6521542-6521564 TTTTAGTCAGATATTTTTGGGGG 0: 1
1: 0
2: 2
3: 35
4: 443
1153575899_1153575903 -10 Left 1153575899 18:6521529-6521551 CCTTTAGTGAATTTTTTAGTCAG 0: 1
1: 0
2: 1
3: 21
4: 276
Right 1153575903 18:6521542-6521564 TTTTAGTCAGATATTTTTGGGGG 0: 1
1: 0
2: 2
3: 35
4: 443

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153575903 Original CRISPR TTTTAGTCAGATATTTTTGG GGG Intronic
900843771 1:5079636-5079658 TTTTAGTCATATTTGTTTTGGGG - Intergenic
903835909 1:26203119-26203141 ATTAAGTCAGAAATTTTTAGGGG - Intergenic
903872056 1:26442985-26443007 TGTTAGTTAGATATCTTGGGTGG + Intronic
907262787 1:53233984-53234006 TTTCAGTATGATTTTTTTGGAGG - Intronic
907495712 1:54842951-54842973 ATTTATTCATTTATTTTTGGGGG + Intergenic
907974205 1:59414997-59415019 TTGTGGTCAGATATTTGTGGAGG + Intronic
908662245 1:66449521-66449543 TTTGAGTCTCATATTTTTGTGGG - Intergenic
909961389 1:81848304-81848326 TTTTATTTTGATTTTTTTGGTGG + Intronic
910397919 1:86810262-86810284 CTGTTGGCAGATATTTTTGGAGG - Intergenic
910469157 1:87532536-87532558 TTTTTGTTGGTTATTTTTGGAGG + Intergenic
911210835 1:95136769-95136791 TGTTGGTCAGTTATTTGTGGAGG + Intronic
911426141 1:97715312-97715334 TTTTTGTCACATGGTTTTGGAGG - Intronic
911593548 1:99774928-99774950 TTTTACTAAAATGTTTTTGGTGG - Intergenic
911950518 1:104168052-104168074 TTTTATTCAGCTATTTTTGCAGG - Intergenic
912261530 1:108115664-108115686 GTTTAATCAGCTATATTTGGGGG + Intergenic
912732272 1:112118420-112118442 TTATAGTCAGAGATTATTTGGGG + Intergenic
913038442 1:114998759-114998781 TATTAGTTATAAATTTTTGGGGG - Intergenic
913477111 1:119248654-119248676 TTTCAGTCATATCTTCTTGGAGG - Intergenic
913514680 1:119594310-119594332 TGTTTGTCAGTTATTTTTGGGGG - Intergenic
914979405 1:152399427-152399449 TTTGATTCAAATATTTTTGTTGG - Intergenic
915381973 1:155450014-155450036 TTTTTGAAAGATATTTTTGCTGG + Intronic
917389122 1:174513611-174513633 TTTTATTTATTTATTTTTGGGGG - Intronic
917627965 1:176864673-176864695 TGCTTGACAGATATTTTTGGAGG - Intronic
917886035 1:179385877-179385899 TTTTTGAAAGATATTTTTGTTGG + Intronic
918499243 1:185175633-185175655 TTTTAGGAAGATATTTTGGCAGG + Intronic
919066738 1:192701088-192701110 TTTTATTCAGTTTTTTCTGGAGG + Intergenic
919076193 1:192815943-192815965 TTGTAGGCAGATATTTTTAATGG + Intergenic
919176590 1:194027073-194027095 ACTGAGTCAGATATTTTTGAGGG - Intergenic
919236678 1:194854533-194854555 TTATAATCAGATATTTTTGTTGG - Intergenic
919557051 1:199070909-199070931 ATACATTCAGATATTTTTGGGGG - Intergenic
919669378 1:200325069-200325091 TTTAAAACAGGTATTTTTGGTGG - Intergenic
919888044 1:201949446-201949468 TTTTAGTTAGGTATGTTGGGTGG + Intergenic
921388227 1:214592206-214592228 TTTTTGAAAGATATTTTTGCTGG - Intergenic
921573855 1:216810493-216810515 TTTTTATCAGATATATTTTGAGG - Intronic
921956634 1:220991794-220991816 TTATAGTCATATATTTATAGGGG + Intergenic
922361823 1:224829582-224829604 TTTTAATCAGATAAATTTGAGGG + Intergenic
922384280 1:225066506-225066528 TTTTATTTCGATAGTTTTGGGGG + Intronic
923327748 1:232895918-232895940 TGTTATACATATATTTTTGGAGG - Intergenic
923351408 1:233110426-233110448 TTTTTGAAAGATATTTTTGCTGG - Intronic
923457401 1:234176290-234176312 TTTAAGGCAGTTAATTTTGGGGG + Intronic
923527307 1:234782476-234782498 TTTAAGTTAGATATTTGTGGGGG + Intergenic
924168282 1:241308320-241308342 TTTTAGGCTGATATTTTTGGTGG - Intronic
924502564 1:244651400-244651422 TTTAAGTCACAAAGTTTTGGGGG - Intergenic
924753639 1:246921567-246921589 TATTAGTACTATATTTTTGGGGG - Intronic
1063943978 10:11159224-11159246 TTATTTTCACATATTTTTGGTGG + Intronic
1065177172 10:23089654-23089676 TTTGAGTCTCATATTTGTGGGGG - Intergenic
1065624886 10:27620039-27620061 TTTTTGTCAGTTTTTTTTGGGGG - Intergenic
1065762263 10:28993168-28993190 GTTTAGTGAGATATTTTTATGGG + Intergenic
1065999747 10:31093126-31093148 TTTTATTTATTTATTTTTGGAGG + Intergenic
1066230805 10:33431067-33431089 TTTAAGTCACAAAGTTTTGGAGG + Intergenic
1066239503 10:33519556-33519578 TTTTTTACAGATATTTTTGCAGG + Intergenic
1066304977 10:34131770-34131792 TTTTAGACAGATATTTGAGAGGG + Intronic
1067857970 10:49813492-49813514 TGTTAGGAAGATATCTTTGGGGG - Intergenic
1068292402 10:55021222-55021244 GTTTAGTAACATATTTGTGGTGG - Intronic
1068711530 10:60140593-60140615 TTTTAAAAAGATTTTTTTGGGGG - Intronic
1068719379 10:60225899-60225921 TTTTAGTTAATTTTTTTTGGGGG + Intronic
1070081979 10:73197942-73197964 TTATAGTTAGTTATTTTTGTTGG - Intronic
1071100479 10:82030963-82030985 TTATAATCAGGTATTTTGGGAGG - Intronic
1071623641 10:87146114-87146136 TTCTAGTCAAATTTTTTTTGGGG + Intronic
1071732088 10:88258273-88258295 TTTTAGTCATATATTTCTCAAGG + Intergenic
1071888632 10:89978232-89978254 TTTTAATCAGATAGGATTGGTGG + Intergenic
1071901141 10:90121094-90121116 ATTTATTCAAATAATTTTGGAGG + Intergenic
1072278381 10:93844735-93844757 TTTGAGTCTCATATTTTTGTGGG + Intergenic
1072864455 10:99042933-99042955 TATTAGCAAAATATTTTTGGTGG - Intronic
1073174481 10:101544737-101544759 TTTTTGAAAGATATTTTTGCTGG + Intronic
1073706940 10:105994860-105994882 TGTTACTCAGTTATTTTAGGTGG - Intergenic
1075708110 10:124514436-124514458 TTTTGGAAAGATATTTTTGCTGG + Intronic
1077203067 11:1323040-1323062 TTTTAGACAGATATGTTTTAAGG - Intergenic
1078776272 11:14396651-14396673 TTTTTCTCACATAGTTTTGGAGG - Intergenic
1078861832 11:15255564-15255586 TTTTTGTTAGATATTTCTGATGG + Intergenic
1078868437 11:15321106-15321128 TTGTAGTCATAGATTTCTGGAGG - Intergenic
1078949851 11:16117854-16117876 TCTTAGTAAAATATTTTTGGGGG - Intronic
1079775415 11:24519559-24519581 TTTCACTAAGATAGTTTTGGAGG - Intronic
1079816512 11:25066686-25066708 TTTTAGGAAGACATTTCTGGAGG + Intronic
1080025984 11:27615889-27615911 TTTTACTCATATATTATTGAGGG - Intergenic
1080905180 11:36537781-36537803 TTTGATTCAGTTATCTTTGGGGG + Intronic
1081176186 11:39929858-39929880 GTTAAGTAAGATAATTTTGGAGG - Intergenic
1081210942 11:40333123-40333145 TGAAAGTGAGATATTTTTGGTGG - Intronic
1081826605 11:46059894-46059916 TTTTATTTATTTATTTTTGGGGG + Intronic
1082070116 11:47932770-47932792 TTTTAGTCAGCTACTCTTTGAGG - Intergenic
1082213045 11:49529060-49529082 TTTTTGTCAAATATTTGTGTAGG + Intergenic
1083528346 11:63393955-63393977 TTTTAGTCCCATATTTCTTGGGG + Intronic
1086589711 11:88498605-88498627 TTTTAGTCAGAAATTAGTGTTGG + Intergenic
1086636554 11:89095447-89095469 TTTTTGTCAAATATTTGTGTAGG - Intergenic
1087142543 11:94779249-94779271 TTGAAGGCAAATATTTTTGGTGG + Intronic
1087408384 11:97758338-97758360 TTTTAAACATATATTTTTGCAGG - Intergenic
1087453994 11:98360290-98360312 TTATACTCAGATATTTTAAGGGG + Intergenic
1088314520 11:108494385-108494407 AGCTAGCCAGATATTTTTGGAGG - Intronic
1089266171 11:117263619-117263641 CTTTAATCTGATATTTTTGTGGG - Intronic
1089680925 11:120118481-120118503 TTTTAGAAAGATAGCTTTGGTGG - Intronic
1089854410 11:121529937-121529959 TTTTATTTAGATTTTTTGGGGGG + Intronic
1089944912 11:122460606-122460628 TTTTTGAAAGATATTTTTGTTGG - Intergenic
1090901891 11:131039268-131039290 CTTTGGTTATATATTTTTGGGGG - Intergenic
1092055026 12:5501634-5501656 TTTTAAGAAGATAATTTTGGTGG + Intronic
1092510787 12:9154096-9154118 TTTTAATCACACATTTTTTGGGG + Intronic
1092686310 12:11051006-11051028 TTTTTGTCAGCTAGGTTTGGTGG - Intronic
1092935608 12:13360826-13360848 TTTTAATTATATTTTTTTGGGGG + Intergenic
1092941715 12:13415274-13415296 TTTTAATCAGATTGTTTTGGAGG - Intergenic
1093102182 12:15040582-15040604 TTTTAGTGAGATATGCTGGGAGG + Intergenic
1093193557 12:16104004-16104026 TTTTTGGAAGATATTTTTGCTGG + Intergenic
1093483860 12:19631804-19631826 TTTTTGTCAGATATTTTCACTGG + Intronic
1093495323 12:19750364-19750386 TGTTATTCTTATATTTTTGGAGG + Intergenic
1093911493 12:24752607-24752629 TCTCATTCAGATATATTTGGAGG - Intergenic
1094068500 12:26386650-26386672 ATTTTGTCAGATTTTTTTGGGGG + Intronic
1094153629 12:27313700-27313722 TTTTTTTCATATATTTTTTGAGG - Intronic
1094247207 12:28312188-28312210 TTTGAGTCGGTTTTTTTTGGAGG + Intronic
1094351865 12:29535423-29535445 TTTGCATCAGAAATTTTTGGAGG - Intronic
1096218884 12:49815152-49815174 TTGTAATTAAATATTTTTGGGGG + Intronic
1097763633 12:63498009-63498031 ATTTAGTCATACATTTTTGGGGG - Intergenic
1097780289 12:63695400-63695422 TTTTTGAAAGATATTTTTGCTGG + Intergenic
1098537748 12:71613881-71613903 TTTTATTTATTTATTTTTGGTGG - Intronic
1098731864 12:74045408-74045430 TTTTATTTAAATAGTTTTGGGGG - Intergenic
1099127652 12:78784766-78784788 CTTTAGTAAGATATTTTTACTGG - Intergenic
1099784448 12:87242878-87242900 TTTTATTCAAATATTTTAGGTGG + Intergenic
1099863213 12:88245506-88245528 ATGTAGACAGATATTTTTGAGGG + Intergenic
1101644610 12:106619316-106619338 TTTTTGAAAGATATTTTTGCTGG + Intronic
1102158936 12:110753116-110753138 TTTAAGAAAGATATTTTAGGCGG + Intergenic
1103237241 12:119383750-119383772 TTTTATTCAGGTATCTGTGGTGG - Intronic
1104086154 12:125475778-125475800 TATTAGTCAGATTTCTTTAGAGG - Intronic
1105470828 13:20693235-20693257 TTTTAGTAAGATAGATTTGGGGG + Intergenic
1106059894 13:26279491-26279513 TTTAAATTAAATATTTTTGGTGG - Intronic
1106113301 13:26795633-26795655 TTTGAGTCTCATATTTTTGTGGG + Intergenic
1106739310 13:32622386-32622408 TTTTAGTCAGGAATATGTGGTGG + Intronic
1106799613 13:33242839-33242861 ATTGAGTCTGATATATTTGGAGG + Intronic
1106919217 13:34545172-34545194 TTTTAATCAGATAACTTGGGGGG + Intergenic
1106934178 13:34700019-34700041 TTTGAGTCTCATATTTTTGTGGG + Intergenic
1108807614 13:54178988-54179010 TTTGTGTGAGATATTTTTAGGGG - Intergenic
1108823263 13:54379517-54379539 TTTGTGTAAGATATTTTTGAGGG - Intergenic
1108895827 13:55326845-55326867 TTCGAGTGAGATATTTTTAGGGG - Intergenic
1109048118 13:57439435-57439457 CATTAGCCAGATATTTTCGGTGG - Intergenic
1109195693 13:59375690-59375712 TGTTAGTCACACATTTTTGTGGG - Intergenic
1109295592 13:60526590-60526612 TATTAGGCAGATATTCTTGGGGG + Intronic
1109824513 13:67700410-67700432 TTTTAATCACAAATTTTTGCTGG - Intergenic
1111057078 13:82964948-82964970 TTTTAAGCACCTATTTTTGGGGG - Intergenic
1111521079 13:89405330-89405352 ATTTAATAAAATATTTTTGGGGG + Intergenic
1112244841 13:97723310-97723332 TTTTATCCAGATATTGGTGGGGG - Intergenic
1112470092 13:99680502-99680524 TCCTAGTCCGTTATTTTTGGAGG - Intronic
1112817927 13:103295340-103295362 ACTTAGGCAAATATTTTTGGGGG + Intergenic
1112957937 13:105084679-105084701 CTCTAGACAGATATTTTTAGTGG + Intergenic
1112981677 13:105392453-105392475 ATTTAATAAAATATTTTTGGAGG - Intergenic
1113141556 13:107157522-107157544 TTTTAATCCTAAATTTTTGGAGG - Intergenic
1114074169 14:19145249-19145271 ATTTAGTCAAATATTTTTTCTGG - Intergenic
1114088099 14:19254726-19254748 ATTTAGTCAAATATTTTTTCTGG + Intergenic
1114242131 14:20877824-20877846 TTTGAGTCTTATATTTTTGTGGG - Intergenic
1114249001 14:20941440-20941462 TTTGAGTCTTATATTTTTGTGGG - Intergenic
1114289122 14:21273208-21273230 TTTTATTTATTTATTTTTGGGGG + Intergenic
1114920506 14:27321650-27321672 TATTATTCTGATATTTTTGAAGG + Intergenic
1115625082 14:35182804-35182826 TATCAGTGCGATATTTTTGGTGG + Intronic
1116246305 14:42417680-42417702 TGTTAGTCACATATTTTAAGTGG + Intergenic
1116455216 14:45112625-45112647 TTTTCCTCAGATATATATGGGGG + Intronic
1116719275 14:48472945-48472967 TTTTTGAAAGATATTTTTGTTGG - Intergenic
1117723701 14:58651827-58651849 TTTTAGTGAGGTATTATTGAAGG + Intergenic
1118493292 14:66282790-66282812 TTTTTGACAGATATTTTTGCTGG - Intergenic
1118508176 14:66439697-66439719 TTTTTGAAAGATATTTTTGTTGG + Intergenic
1118690300 14:68332226-68332248 TTTTAGCCATTTATATTTGGGGG - Intronic
1118722819 14:68606520-68606542 CTACACTCAGATATTTTTGGAGG - Intronic
1119276135 14:73357905-73357927 TTTTAGTTTGTTTTTTTTGGTGG - Intronic
1119834905 14:77740208-77740230 CTTTAGTCAGAAATTCTTTGAGG + Intronic
1119919990 14:78437949-78437971 TTTTAGAAAGATCTTTCTGGTGG + Intronic
1121621790 14:95355203-95355225 TTTTATTTGTATATTTTTGGGGG - Intergenic
1122058376 14:99120512-99120534 GTTTAGCAAGATATTTTTGGTGG - Intergenic
1122360652 14:101160116-101160138 TTTTTGAAAGATATTTTTGCTGG + Intergenic
1124639784 15:31390576-31390598 TTTTGTTCAGATATTTTTAGAGG + Intronic
1124682255 15:31743206-31743228 TTTTATTGAGACATGTTTGGTGG - Intronic
1126451946 15:48818111-48818133 GTTTTGTAAGATATTATTGGTGG - Intergenic
1127603721 15:60564705-60564727 TATCACTCAGATATATTTGGGGG + Intronic
1127729346 15:61784237-61784259 TTTTATTTTGATAGTTTTGGGGG - Intergenic
1127805969 15:62520836-62520858 TCTTACTCAGATATTTTTTAAGG + Intronic
1128654040 15:69446100-69446122 TTTTATACAGAGATTTTTGATGG - Intronic
1129094275 15:73186368-73186390 TTTTTGAAAGATATTTTTGCTGG - Intronic
1129506694 15:76087444-76087466 TTTTAGGGGGAGATTTTTGGTGG + Intronic
1130240325 15:82182302-82182324 TTTTAGGCAGCTATTTGTGTGGG + Intronic
1130430133 15:83839516-83839538 TTTTAGTAAAATAATTCTGGTGG + Intronic
1131016088 15:89058803-89058825 TTTTATTGAGATATTGTTGAGGG - Intergenic
1134464656 16:14464442-14464464 TTTTTGAAAGATATTTTTGCTGG - Intronic
1138171743 16:54857174-54857196 TTTTTGAAAGATATTTTTGCTGG - Intergenic
1138662518 16:58531551-58531573 ATTTATTCAGATATTTATGAGGG + Intronic
1140462562 16:75151932-75151954 TTTTTGAAAGATATTTTTGCTGG + Intronic
1140672571 16:77293421-77293443 TTTTAGCCAGATATGTATGGTGG - Intronic
1141537321 16:84691411-84691433 TTTTACTCTTTTATTTTTGGTGG - Intergenic
1142936209 17:3333982-3334004 TTTTTTTCATATGTTTTTGGCGG - Intergenic
1144597718 17:16585125-16585147 TTTTTGTCAGAATTTTTTGTTGG + Intergenic
1148377759 17:47164458-47164480 GTTATGTCAGATATTATTGGGGG - Intronic
1148658958 17:49312079-49312101 TTTTAGTTTGAGCTTTTTGGTGG - Intronic
1148976136 17:51530572-51530594 TTTTATTTCAATATTTTTGGGGG - Intergenic
1150386183 17:64763101-64763123 TTTTAGGAATATATTTTGGGGGG - Intergenic
1150595703 17:66602591-66602613 TTTAAGTTTAATATTTTTGGAGG - Intronic
1150753896 17:67892969-67892991 TTTTAGGAATATATTTTTTGGGG + Intronic
1151143212 17:72015262-72015284 AATTATTCAGATAATTTTGGGGG - Intergenic
1151245736 17:72793136-72793158 TTTTAGGAAGATAATTCTGGGGG + Intronic
1151618296 17:75229108-75229130 TTTTAGCTCGATACTTTTGGAGG - Intronic
1152533149 17:80932372-80932394 TGTTTGTCTTATATTTTTGGGGG - Intronic
1153575903 18:6521542-6521564 TTTTAGTCAGATATTTTTGGGGG + Intronic
1155394463 18:25372340-25372362 TTTTAGTGATTTATTTTGGGGGG - Intergenic
1155929644 18:31692773-31692795 TTCTAGTGAATTATTTTTGGGGG - Intergenic
1156406474 18:36787352-36787374 TTTTAGGCAGATACTATTAGGGG - Intronic
1157448008 18:47761336-47761358 TTTTTGTGAGGTATTTTTGCTGG - Intergenic
1159765538 18:72483781-72483803 TTTTATTGAGAAATTTGTGGTGG - Intergenic
1162783021 19:13016918-13016940 TTTGGTTCAAATATTTTTGGGGG - Intronic
1166265233 19:41677733-41677755 TTACACTCAGATATTTTTGAAGG + Intronic
1166486395 19:43217363-43217385 TTGCACTCAGATATTTTTGAAGG - Intronic
1168665023 19:58198043-58198065 TTTGAAGCAGACATTTTTGGGGG + Intronic
925403889 2:3592880-3592902 GTTTATTCAGATCTTTTTTGAGG + Intergenic
925422160 2:3721452-3721474 TTTTAGTTGGATATTTTGTGTGG + Intronic
926897970 2:17715597-17715619 TTTTAGTCACGTGTTCTTGGGGG - Intronic
928159965 2:28913604-28913626 ATTTAGTATTATATTTTTGGAGG + Intronic
928361805 2:30669252-30669274 TTTTAAAAAGATATTTTTGCTGG + Intergenic
928369115 2:30727276-30727298 CTTTTGTCACATATTTTTGGTGG - Intronic
929371511 2:41229583-41229605 TTTTTGGAAGATATTTTTGCTGG - Intergenic
929399542 2:41564056-41564078 TTTTTGATAGATAATTTTGGAGG - Intergenic
930139020 2:47932963-47932985 TCTTAATCATATATTGTTGGTGG + Intergenic
930574461 2:53128910-53128932 TTTTAATTAGATATTTCTGGTGG - Intergenic
931007762 2:57871829-57871851 TTTGAGTCATATTTTTTTGTGGG - Intergenic
931069767 2:58632204-58632226 TTTTTCTCAGATATACTTGGGGG + Intergenic
931413073 2:62053296-62053318 ATTTGCTCATATATTTTTGGAGG + Intronic
931459833 2:62441015-62441037 TTTCAGTCATATTTTTGTGGTGG - Intergenic
931545587 2:63381831-63381853 TTTTATTGAGTTATTTTTTGAGG - Intronic
932010689 2:67974676-67974698 TTTCAATCAGATATTTTGGAAGG + Intergenic
932672172 2:73747621-73747643 TTTTAATCACATTTTTTTTGCGG - Intergenic
932947330 2:76250867-76250889 TTTTCCTTAGATATTTATGGTGG - Intergenic
933398622 2:81763818-81763840 TTTCAGTCAGATATATTTCATGG + Intergenic
933703322 2:85271846-85271868 TTTTAGAAAGATATTTCTAGAGG + Intronic
933839056 2:86271535-86271557 TTTTTGAAAGATATTTTTGCTGG - Intronic
935827972 2:106970282-106970304 TTTTAGTAAAATATTTGTCGGGG - Intergenic
935930150 2:108115339-108115361 TTTTAGACAGTGATTTTTGAGGG - Intergenic
935936413 2:108188801-108188823 TTTTAGTCATATATATTTTTGGG - Intergenic
936082378 2:109441936-109441958 TTTTTGAAAGATATTTTTGCTGG - Intronic
936341749 2:111639893-111639915 TATTAGGCAGATATCTTTGTAGG - Intergenic
936702224 2:115025834-115025856 TTTTAATAAGATATTTTGTGGGG + Intronic
938594054 2:132768527-132768549 GTTTAGTCTGACATTTATGGGGG + Intronic
939395280 2:141621656-141621678 ATTTAGTCAGAAATTTATGCAGG + Intronic
939469609 2:142603364-142603386 TTTTGGTAAGATATTTTTAAAGG - Intergenic
939584940 2:143992688-143992710 TTTTAGTGAGGGATTGTTGGTGG - Intronic
939705456 2:145447085-145447107 GGTTTGTCAGATATTTTTGGGGG - Intergenic
940060146 2:149556818-149556840 TTTTAGGAAAATATATTTGGGGG + Intergenic
940549734 2:155138845-155138867 TTTAAGTTACATATTTTTGTGGG - Intergenic
941350995 2:164436021-164436043 TTTTATACTTATATTTTTGGGGG + Intergenic
941991036 2:171557252-171557274 TTTTAATGAGATATTTTTCTCGG - Exonic
942829344 2:180220968-180220990 TTAAAGTTGGATATTTTTGGAGG + Intergenic
942937906 2:181580528-181580550 TATTAGTCAAATTTTTCTGGTGG - Intronic
943107302 2:183561426-183561448 TTTTTGGCTCATATTTTTGGAGG + Intergenic
943191197 2:184681286-184681308 TTTTAGTGGGATTTTTTTTGTGG - Intronic
943465749 2:188227240-188227262 TCTTGTTCAGATGTTTTTGGTGG - Intergenic
945049820 2:205813117-205813139 TTATATTTAGATTTTTTTGGGGG + Intergenic
946032322 2:216715044-216715066 TTTTAGACAAATAATTTTTGCGG - Intergenic
946610540 2:221453212-221453234 TTTTTATCAAATATTTTTAGAGG + Intronic
946977290 2:225167420-225167442 TTTAGGTCAGATTTTTGTGGTGG + Intergenic
948635406 2:239331398-239331420 TTTTATTCAGATATTTTATGAGG - Intronic
1168819769 20:765007-765029 TTTGAGTCTCATATTTTTTGGGG + Intronic
1169162930 20:3397701-3397723 TTTTAAGCAGATTTTTTTTGGGG + Intronic
1169602825 20:7281349-7281371 TTTTAGAAAGATAATGTTGGTGG - Intergenic
1171903204 20:30876390-30876412 TTTTTGAAAGATATTTTTGCTGG + Intergenic
1171944230 20:31361750-31361772 TTTTAGTAAGATGAATTTGGGGG + Intergenic
1172045829 20:32079618-32079640 TTTTACTCAAAGATTTTTTGGGG - Intronic
1172087531 20:32398917-32398939 TTTTAGTAAGATACTTTTGCTGG + Intronic
1174887222 20:54349035-54349057 TTTTAGTCAGGTCATTCTGGTGG + Intergenic
1177534958 21:22413011-22413033 TTTTATACATATATTTTTTGAGG - Intergenic
1177580767 21:23019703-23019725 TTATAGTCAGATTATTTTGAAGG - Intergenic
1178999351 21:37441972-37441994 TTTTTGACAGATATTTTCAGTGG + Intronic
1179498741 21:41792844-41792866 TTTTTGAAAGATATTTTTGCTGG + Intergenic
1180289814 22:10838189-10838211 ATTTAGTCAAATATTTTTTCTGG - Intergenic
1180336602 22:11582362-11582384 TTTTTGAAAGATATTTTTGCTGG + Intergenic
1180492611 22:15867611-15867633 ATTTAGTCAAATATTTTTTCTGG - Intergenic
1182327356 22:29523795-29523817 TTTTTTTCATATATTTTTTGGGG - Intronic
1182701096 22:32239074-32239096 TTTTAGGCAGACATATTTGCTGG - Exonic
1182948802 22:34351725-34351747 ATTTGGTCAAATATTTATGGTGG + Intergenic
949182212 3:1145925-1145947 TTTTAGGAAGAAAATTTTGGTGG + Intronic
951117108 3:18876923-18876945 TTTTATTTATTTATTTTTGGGGG - Intergenic
955282431 3:57606376-57606398 TTTTTATAAGATATTTTTGCTGG - Intergenic
955287097 3:57652616-57652638 TTGTAATTAGGTATTTTTGGGGG - Intronic
955443035 3:58977700-58977722 TTTTTGTCAGATATTTAGAGTGG + Intronic
955930775 3:64054644-64054666 TTTTAGAAAGATCTTTCTGGTGG - Intergenic
955955851 3:64289000-64289022 TTTTAGGCATTTATGTTTGGTGG - Intronic
956036580 3:65099380-65099402 TTTTTGAAAGATATTTTTGCTGG + Intergenic
956367042 3:68515471-68515493 TGTTAGTCAGATGCTTTAGGTGG - Intronic
957239783 3:77643550-77643572 TTGTAGTTAGATTTTTTTGGGGG + Intronic
957402385 3:79733323-79733345 TGTTAGTGAGATATTGTTGTAGG + Intronic
957420274 3:79959014-79959036 TTTTAGTAAGTTATTTTTGGTGG - Intergenic
958106418 3:89079509-89079531 TTTTAATAATTTATTTTTGGGGG + Intergenic
959452257 3:106518029-106518051 TGTTAGTGAGGTATTTTTGGTGG - Intergenic
960391890 3:117087415-117087437 TTTTAGCCAGAAATTTGTGTTGG + Intronic
960557003 3:119041272-119041294 TTTTATTCTGATATTATTTGAGG - Intronic
962496786 3:135947926-135947948 TATTGGTCATATATTTTTGTGGG + Intergenic
962724927 3:138214944-138214966 TCTTAATCAGTTATTTTTGAGGG + Intronic
966070811 3:175875590-175875612 TTTTAGTCATTTTTTTTGGGGGG - Intergenic
967145966 3:186606368-186606390 TTCTAGTCAGATGTTTTTCAGGG - Intergenic
967716457 3:192767963-192767985 ATTTGCTCAGTTATTTTTGGTGG - Intergenic
968796219 4:2706682-2706704 ATTTAGTTAGTTATTTTTAGAGG + Intronic
970622744 4:17841589-17841611 TTTTGATCAGATTTTTTTTGTGG + Intronic
970706230 4:18806233-18806255 TTTTATTTAAATAGTTTTGGGGG - Intergenic
970935206 4:21561641-21561663 TTTTTGTCTGATTTTTTTAGTGG - Intronic
971300131 4:25435087-25435109 TTTTATTCAGCTTTTTTGGGGGG - Intergenic
973346996 4:49067497-49067519 GTTTACTAAGAGATTTTTGGTGG - Intergenic
974247736 4:59342637-59342659 CTTTAGTCACATAATTCTGGAGG + Intergenic
974278219 4:59755393-59755415 TTTTAGTCAGATAATTCAGGTGG + Intergenic
974368416 4:60983329-60983351 TTTTAAAAAGATATTTTTGCTGG + Intergenic
975092182 4:70417050-70417072 TTTTAGGCAGAGATTTTGGATGG - Intergenic
975256716 4:72245527-72245549 TTTTATTTAGATATTATTTGAGG - Intergenic
975996012 4:80316305-80316327 TGTTAGTCACAGATTTTTAGTGG - Intronic
976168518 4:82280291-82280313 TTTTATTTAGACATTTTTGTTGG - Intergenic
976340225 4:83938909-83938931 TCATAGTCATATATTTTTTGGGG + Intergenic
977003176 4:91529235-91529257 TTTTAGTCAGAGAATTATAGAGG + Intronic
979180131 4:117715251-117715273 TTTTCATCATATATATTTGGTGG + Intergenic
980066842 4:128198736-128198758 TTTTAGGAAGATAACTTTGGTGG + Intronic
980513921 4:133828479-133828501 TTTTAATGACATATTTGTGGAGG + Intergenic
980809821 4:137861706-137861728 TTTTAGTCATATGTTTTTAAAGG - Intergenic
983334011 4:166369053-166369075 TTTTTTTCAGATAATTTTTGGGG + Intergenic
983504284 4:168535783-168535805 TCTTGGTCAGATATTTGTAGAGG - Intronic
983910949 4:173238240-173238262 TTTTAGACAGATCATTTTGTAGG + Intronic
983977066 4:173948077-173948099 TTTATATCAAATATTTTTGGAGG - Intergenic
984642252 4:182180280-182180302 GTTTAGTTACATATTTATGGAGG + Intronic
985207665 4:187557295-187557317 ATTTAGAAAGATATTTTTGCTGG + Intergenic
986250704 5:6056095-6056117 TTTTAATAAAGTATTTTTGGTGG - Intergenic
987884174 5:23791917-23791939 TTTTAATTATTTATTTTTGGAGG - Intergenic
987897558 5:23967500-23967522 TCTTAGTTACATATTATTGGGGG - Intronic
987931278 5:24402139-24402161 TTTTCAACATATATTTTTGGAGG + Intergenic
988295779 5:29360149-29360171 ATTTATTCAAATATTTTTGGTGG - Intergenic
988458892 5:31414222-31414244 TTTTAGAAAGATTGTTTTGGCGG + Intronic
988826438 5:34940534-34940556 TTTTAGTCAGTTGGTTTTTGTGG + Intronic
988912686 5:35860565-35860587 TTTAACTCAGAAATATTTGGAGG + Intronic
989551869 5:42745030-42745052 TTTTAGAAAGAAACTTTTGGTGG - Intergenic
989644529 5:43615708-43615730 ATTTAGTCAGAAATTATTGATGG + Intronic
990148589 5:52790244-52790266 TTTTAGTCAAAAATCTTTGGTGG + Intronic
990694746 5:58403365-58403387 TTTATGTCATATTTTTTTGGGGG - Intergenic
991059078 5:62352175-62352197 TTTTACACACATATTTTAGGAGG + Intronic
991415851 5:66392188-66392210 TTTTATTTAAATAGTTTTGGGGG - Intergenic
991729673 5:69572727-69572749 TTTTAGTAAGATATTGTTAAAGG + Intronic
991806105 5:70427867-70427889 TTTTAGTAAGATATTGTTAAAGG + Intergenic
991865283 5:71055153-71055175 TTTTAGTAAGATATTGTTAAAGG - Intronic
992932026 5:81657824-81657846 TTTTAGTCAGGTTTTTTAGAGGG + Intronic
994513041 5:100732314-100732336 TTTTTCTCAGCTATTTTTGATGG - Intergenic
994617551 5:102124583-102124605 TTTTAGTTCAATAGTTTTGGGGG - Intergenic
995688097 5:114793460-114793482 TTATAGTCTGCTATTTTGGGAGG - Intergenic
996125275 5:119718943-119718965 ATTTATTCAGAGATTTTTAGTGG - Intergenic
996584335 5:125067953-125067975 TTCTAATCAAATATTTTGGGAGG + Intergenic
996668125 5:126084457-126084479 TTTTATTTAAATAGTTTTGGGGG - Intergenic
997393514 5:133536471-133536493 TTTCAGTCAATTACTTTTGGGGG + Intronic
998309619 5:141114551-141114573 TTTTTGAAAGATACTTTTGGTGG - Intronic
998574066 5:143293669-143293691 TTTTAGTCTAGCATTTTTGGTGG + Intronic
998611062 5:143689007-143689029 TTTTAGAAAGATATTTTTATTGG + Intergenic
998733185 5:145104722-145104744 TTTTAATCAGATTTTATTTGGGG - Intergenic
999118533 5:149187276-149187298 TTTTACTCTGATATTGTAGGTGG - Intronic
999184398 5:149695077-149695099 TGTTGGTCTGATATTTTTGGAGG + Intergenic
999523830 5:152381137-152381159 TTTGGGTCAGATGATTTTGGGGG + Intergenic
1000197666 5:158975273-158975295 TCTTATTCAAATATTTTTTGGGG - Intronic
1000305379 5:159989684-159989706 TTTAAGTCAGTTTTTTTGGGGGG + Intergenic
1000402319 5:160843301-160843323 GTTTAGTGAAATATTTTTAGTGG + Intronic
1001158565 5:169294307-169294329 TTTTATTTATTTATTTTTGGGGG - Intronic
1003379491 6:5610412-5610434 TTGTAGTCAAAAATATTTGGGGG + Intronic
1003817208 6:9854908-9854930 TTTTAGTGTGGTATTTTTGGTGG - Intronic
1004626311 6:17380586-17380608 TTTTATTTATTTATTTTTGGGGG + Intergenic
1005905241 6:30257193-30257215 TTGTAGTCAGTTATTTATAGTGG + Intergenic
1006709411 6:36053026-36053048 TTTTACTCAAAGATTTTTAGAGG + Intronic
1006870760 6:37249189-37249211 ATGTAGACAAATATTTTTGGGGG + Intronic
1007937818 6:45749564-45749586 TTTAAGTCAGATTTTTTTTCTGG - Intergenic
1010011046 6:71048782-71048804 TTTCAAATAGATATTTTTGGAGG + Intergenic
1010169573 6:72959085-72959107 TTTAAATCAGATATTTTTGCAGG + Intronic
1010806416 6:80242444-80242466 TCTTCTTCAGTTATTTTTGGTGG + Intronic
1011378861 6:86720808-86720830 TAATAGTGAGATCTTTTTGGTGG + Intergenic
1011799601 6:90996807-90996829 TTTTCCTCATTTATTTTTGGAGG + Intergenic
1012394857 6:98784824-98784846 CACAAGTCAGATATTTTTGGCGG + Intergenic
1012530837 6:100234190-100234212 TTTTAATGAGTTAGTTTTGGAGG + Intergenic
1012825662 6:104143699-104143721 TTATTGCCAGATATTTTGGGGGG + Intergenic
1012907077 6:105079773-105079795 TGTTTGGCATATATTTTTGGTGG + Exonic
1013043417 6:106459752-106459774 TTTTGGTCAGTTATTTTTGCGGG + Intergenic
1013266030 6:108499762-108499784 TTTTCTTCAGGTTTTTTTGGGGG - Intronic
1013518660 6:110912670-110912692 TTTTTGAAAGATATTTTTGTTGG - Intergenic
1013711249 6:112902221-112902243 TTTTAGTCATATTTAGTTGGAGG - Intergenic
1014340184 6:120195606-120195628 TTTTATGCAGATATTTTGGATGG - Intergenic
1014575459 6:123064542-123064564 TCTTAGTCAAAGAGTTTTGGAGG - Exonic
1015378578 6:132538937-132538959 ATACAGTAAGATATTTTTGGTGG + Exonic
1015550433 6:134406596-134406618 TTTAAATGAGATATTTTTGCTGG - Intergenic
1015641860 6:135343032-135343054 TTTTTTTCAGATTTTGTTGGGGG - Intronic
1016226312 6:141743098-141743120 TTTCAGTTAGATATTTTAAGTGG + Intergenic
1016866595 6:148773656-148773678 TTTTGTTCACATATTTTTGTAGG + Intronic
1017191285 6:151655564-151655586 TTTTTGTCATATATATTTTGAGG - Intergenic
1017560323 6:155620677-155620699 TTATAGTCAGAAATTCTTAGGGG + Intergenic
1019037930 6:169077471-169077493 ATTTACTCATAGATTTTTGGGGG - Intergenic
1020547092 7:9545973-9545995 TTTTACTCTGATATTTGTAGGGG - Intergenic
1020971766 7:14952268-14952290 TTATAGTCTTATAATTTTGGAGG - Intronic
1022462494 7:30623955-30623977 TTTTTGAAAGATATTTTTGCTGG - Intronic
1022938867 7:35211475-35211497 TTTTTGAAAGATATTTTTGCTGG + Intronic
1022980760 7:35602680-35602702 TTTTAGTCTGAGGTTTTTGAAGG + Intergenic
1023102787 7:36736057-36736079 ATTTAGGCATATATTTATGGTGG - Intergenic
1023689486 7:42771619-42771641 TTTCAGTCAGATAGTTTTATGGG - Intergenic
1023812350 7:43921385-43921407 CTTTGATCAGATATTTTTGAAGG + Intronic
1024003458 7:45207320-45207342 TTTTTGAAAGATATTTTTGTCGG + Intergenic
1025755635 7:64336434-64336456 TTTTCTTCTGATTTTTTTGGAGG + Intronic
1026483690 7:70799860-70799882 TTTTAGGGAGATAAATTTGGTGG + Intergenic
1027839293 7:83287715-83287737 TTTTACTCAGAGAAATTTGGAGG - Intergenic
1028067308 7:86402923-86402945 TCTTAATTATATATTTTTGGAGG - Intergenic
1028184279 7:87763503-87763525 TTTTAGGAAGATAATTTTGCTGG + Intronic
1028542967 7:91964758-91964780 TTTTAGTTAGATTTTGTTGAAGG - Intronic
1028765624 7:94555454-94555476 TTTAAGTCAGATATTTATAGAGG - Intronic
1029239431 7:99148742-99148764 ATTTAGCCAGGTATGTTTGGTGG - Intergenic
1029967818 7:104758593-104758615 ATTTATTTATATATTTTTGGTGG - Intronic
1029992682 7:104976411-104976433 TATTAATCAGGTATGTTTGGAGG + Intergenic
1030417393 7:109262666-109262688 TTTAAGTCACAGAGTTTTGGAGG + Intergenic
1031007243 7:116487534-116487556 TTTTAGTCTGGCATTTTTTGAGG + Intronic
1031137864 7:117905015-117905037 TTCCAGTTATATATTTTTGGAGG - Intergenic
1031262340 7:119536822-119536844 TTTAAATCATATATTATTGGAGG + Intergenic
1031720854 7:125174154-125174176 TTTTAAACAGATTTTTGTGGGGG + Intergenic
1032309763 7:130774185-130774207 TTTTATCAAGATATTTTTAGGGG + Intergenic
1032448013 7:132001267-132001289 TTTTAGAAAGATAATTCTGGTGG + Intergenic
1032822608 7:135538420-135538442 TTTTGTTCAGAGAATTTTGGGGG + Intergenic
1033270431 7:139927730-139927752 CTTTAGTCAAATGTTTTTGTAGG + Intronic
1033377894 7:140781419-140781441 TTTTTGTTAGAAACTTTTGGAGG + Intronic
1033978346 7:147130450-147130472 TTTTATTCTTTTATTTTTGGGGG - Intronic
1034032945 7:147787912-147787934 CTTTAGTCACTTATTTTTGTGGG - Intronic
1034130608 7:148712903-148712925 CTTTAGTAAAATATTTTTTGTGG + Intronic
1035870506 8:3132352-3132374 TTTAAGTCAAATTTTTTTGAAGG - Intronic
1037075072 8:14705190-14705212 ATTTAGTTGAATATTTTTGGTGG + Intronic
1038138270 8:24814354-24814376 TATTAGTCATAAAGTTTTGGGGG + Intergenic
1038153346 8:24962353-24962375 TTGTATTCAGATATTTTTCAAGG - Intergenic
1039866181 8:41504704-41504726 CTTTATTCAAATATTTTTTGGGG - Intronic
1040747621 8:50664489-50664511 TTTTTCTCCTATATTTTTGGGGG + Intronic
1042421395 8:68594050-68594072 TTTTAGTTATACTTTTTTGGGGG + Intronic
1042441652 8:68834473-68834495 TTTTTGAAAGATATTTTTGTTGG - Intergenic
1042853828 8:73243859-73243881 TTTTAGATAAATATTTTTTGAGG - Intronic
1043029323 8:75112623-75112645 TTTTAGTCTTAAATTTGTGGAGG + Intergenic
1043319645 8:78968224-78968246 TTTTAGACCAATATTTTTGAAGG + Intergenic
1043605417 8:81992744-81992766 TTTTAGACTGCTATGTTTGGAGG - Intergenic
1043939426 8:86180210-86180232 TTTTAATCAGACATTTTTAATGG - Intergenic
1043996119 8:86818670-86818692 TTTTATTCAGGTTTCTTTGGGGG - Intergenic
1046347643 8:112955363-112955385 TTGTAGTAAGATATTTTAGATGG - Intronic
1046368324 8:113267734-113267756 ATTGAGTCAGATATTTAGGGTGG - Intronic
1046423418 8:114013946-114013968 TTCTAGACAGAAATTTTTGTTGG + Intergenic
1046827241 8:118704577-118704599 TTTTATTTCGATAGTTTTGGGGG + Intergenic
1047994580 8:130321722-130321744 TTTTACTCAGAGATTTTGAGTGG - Intronic
1048030372 8:130626025-130626047 TTTTAGATAAATATTTTGGGAGG - Intergenic
1048064984 8:130958188-130958210 ATTTATTCACATATTTTTTGTGG - Intronic
1048271747 8:133034150-133034172 TTTTATTCTAATATTTTTGCTGG + Intronic
1049836836 8:144740964-144740986 TTTTATTTATTTATTTTTGGGGG - Intronic
1049983506 9:926506-926528 TTTTCCTCAGATAATTTTTGAGG + Intronic
1050280877 9:4048803-4048825 TGTTGGTCAGATATTTGTGCAGG - Intronic
1050360796 9:4829224-4829246 TTTTAGGAAGATAATTCTGGAGG + Intronic
1050452296 9:5795972-5795994 TTTTAAGTAGTTATTTTTGGGGG - Intronic
1052516394 9:29486116-29486138 TTTATGTCAGACATTATTGGGGG - Intergenic
1052571057 9:30224570-30224592 TTTTAGAAAGATATTTTTCCAGG - Intergenic
1053516718 9:38736442-38736464 TTTTATTTAGATTTTTGTGGAGG - Intergenic
1054569898 9:66799102-66799124 TTTTTGTCTGATAGTTCTGGAGG - Intergenic
1054862590 9:69968901-69968923 TTTTAAGGAGATATTTTGGGGGG + Intergenic
1054929827 9:70624625-70624647 TGTTTGTCATATATTTTTGTGGG + Intronic
1054962729 9:70986710-70986732 TTTTACTCACATATATTTTGGGG - Intronic
1055270517 9:74552937-74552959 TTTCAGACAGGTGTTTTTGGTGG + Intronic
1055488847 9:76783913-76783935 TTCTACTCAGAAATTTTTGATGG + Intronic
1056341574 9:85638775-85638797 TTTTTGTTATATATTTTTTGAGG - Intronic
1057099923 9:92348778-92348800 TTTTTGAAAGATATTTTTGCTGG + Intronic
1057243718 9:93435714-93435736 GATTTGACAGATATTTTTGGAGG - Intergenic
1057821601 9:98335552-98335574 GTTAAATCAGATATTTTGGGGGG + Intronic
1058113573 9:101058335-101058357 TCTCACTCAGATATGTTTGGTGG - Intronic
1058376663 9:104329678-104329700 TTTTACTGGGATATTTTTTGGGG + Intergenic
1059887779 9:118766029-118766051 TCCTAGTTAGATATTTTTAGTGG - Intergenic
1061774865 9:132955231-132955253 TTTTTGAAAGATATTTTTGCTGG + Intronic
1186049717 X:5577999-5578021 TATTAGTCATTTAATTTTGGGGG + Intergenic
1187251013 X:17598008-17598030 TCTTAGTCAGCTCTTTTTGGAGG + Intronic
1188717015 X:33472643-33472665 TTTTTGTAAGATAGTTTTGCTGG + Intergenic
1188732123 X:33662309-33662331 ATTTATTCTAATATTTTTGGTGG - Intergenic
1188899430 X:35711582-35711604 TGATAGACACATATTTTTGGAGG + Intergenic
1189162365 X:38822576-38822598 GTTTATTCAGATATGTTTGCAGG + Intergenic
1190376117 X:49790038-49790060 TTTAAGTCTGACATATTTGGAGG + Intergenic
1190376327 X:49791931-49791953 TTTTAGTCTGAGGTGTTTGGAGG + Intergenic
1193276767 X:79598047-79598069 TTTGAGACAGAAATTATTGGTGG - Intergenic
1193303463 X:79921043-79921065 TTTTATTTCAATATTTTTGGGGG + Intergenic
1193511694 X:82410140-82410162 TTGTAGTCAGGCTTTTTTGGGGG + Intergenic
1193824558 X:86206878-86206900 TTTTGTTCTCATATTTTTGGAGG + Intronic
1194271276 X:91819557-91819579 TTGTAGTCATATATTCTTGGAGG + Intronic
1195362437 X:104096385-104096407 TTTTAATCAAACATGTTTGGAGG + Intergenic
1196342766 X:114614955-114614977 TTTTAGAATGATAGTTTTGGAGG + Intronic
1197348415 X:125351707-125351729 TTTCAGACAGATAATTCTGGAGG + Intergenic
1197570216 X:128141473-128141495 TTTTAAACTAATATTTTTGGGGG + Intergenic
1197835338 X:130688183-130688205 TTTTAGTCAATTATTATTAGTGG + Intronic
1198300949 X:135333792-135333814 TTTTAGACTGATTTTTTTTGGGG - Intronic
1198623495 X:138541142-138541164 TATTAGTCAGATAATCTTGGGGG + Intergenic
1200588519 Y:5040995-5041017 TTGTAGTGATATATTCTTGGAGG + Intronic
1201799319 Y:17937962-17937984 TTTTAGGCAGTTATTTTAGAAGG - Intergenic
1201802234 Y:17967994-17968016 TTTTAGGCAGTTATTTTAGAAGG + Intergenic
1202362223 Y:24122680-24122702 TTTTAGGCAGTTATTTTAGAAGG + Intergenic
1202362850 Y:24130416-24130438 TTTTAGGCAGTTATTTTAGAAGG - Intergenic
1202507928 Y:25539699-25539721 TTTTAGGCAGTTATTTTAGAAGG + Intergenic
1202508556 Y:25547435-25547457 TTTTAGGCAGTTATTTTAGAAGG - Intergenic