ID: 1153575981

View in Genome Browser
Species Human (GRCh38)
Location 18:6522406-6522428
Sequence ATGTCTCTGTGGCAGAAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 405
Summary {0: 1, 1: 0, 2: 3, 3: 39, 4: 362}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153575976_1153575981 -2 Left 1153575976 18:6522385-6522407 CCATACATTGCTATTAGTTCCAT 0: 1
1: 0
2: 1
3: 10
4: 162
Right 1153575981 18:6522406-6522428 ATGTCTCTGTGGCAGAAGGAGGG 0: 1
1: 0
2: 3
3: 39
4: 362

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153575981 Original CRISPR ATGTCTCTGTGGCAGAAGGA GGG Intronic
900338813 1:2178061-2178083 ATGTGACCTTGGCAGAAGGAAGG + Intronic
901221709 1:7587161-7587183 AGGCCTCTGTGGCAGGAGGTGGG + Intronic
901775173 1:11555629-11555651 ATTTCACTGTGACAGATGGATGG + Intergenic
901806368 1:11741142-11741164 AAGGCTCTGTGGCAGAAGGGGGG - Intronic
902694105 1:18128814-18128836 ATGTCTCTGTGTCACATGGGAGG + Intronic
903286980 1:22283492-22283514 AAGGCTGTGGGGCAGAAGGAAGG - Intergenic
903476327 1:23621354-23621376 ATGTCACTGAGGCAGGAGAATGG - Intronic
904308381 1:29606152-29606174 ATCTCTCTGTAGTAAAAGGAAGG + Intergenic
904363411 1:29993377-29993399 AAGGCCCTGTGGCAGAAAGAAGG + Intergenic
904797033 1:33064191-33064213 ATGTCTCTGTGTCATAAACAAGG - Intronic
904797517 1:33068384-33068406 ATGTCTCTGTGTCATAAACAAGG - Intronic
905268786 1:36773118-36773140 TGGTCCCTGTGGCAGAGGGAAGG - Intergenic
905515028 1:38556281-38556303 TTGTCTCTGTGGAATAAGGGGGG + Intergenic
905915679 1:41682718-41682740 AGGTCTCAGAGGCAGCAGGAGGG - Intronic
906268709 1:44456915-44456937 AAGACACTGAGGCAGAAGGAAGG - Intronic
906370897 1:45252880-45252902 TTCTCTCTGTGGTAGCAGGATGG + Intronic
907242444 1:53088243-53088265 AGGTCTTTGTAGCAGCAGGAGGG + Intronic
907288028 1:53394486-53394508 ATCTCTCTGTGGCAGCATGCAGG - Intergenic
907330064 1:53664933-53664955 AGGCCTCTGTGGCAGGAGGAGGG + Intronic
907865426 1:58395326-58395348 TTGTCTCTGTGGCAGAGAGAGGG - Intronic
909544153 1:76825430-76825452 ATGTTTATCTGCCAGAAGGATGG + Intergenic
912649575 1:111425915-111425937 ATCTCTCTGTGCCCAAAGGAAGG - Intronic
914910699 1:151783626-151783648 ATCTCTCTGCGGTAGCAGGAAGG + Intronic
914985705 1:152455380-152455402 ATGTCTCTGTGTCATAAACAAGG + Intergenic
915445930 1:155974985-155975007 ATGTCTCTTTGGGAGAGGGTGGG - Intronic
916103430 1:161412482-161412504 ATGTCTCTGGGGCACAGGGTTGG - Intergenic
916457202 1:164983141-164983163 GTGGCTTTGTGGGAGAAGGAGGG - Intergenic
920435220 1:205942903-205942925 ATGTCTGGGCGGTAGAAGGAGGG + Intronic
920502025 1:206491492-206491514 ATGTCTCTGGGAAAGGAGGAAGG - Exonic
921944958 1:220879981-220880003 ATGTCTGCGATGCAGAAGGAGGG - Exonic
923546290 1:234925898-234925920 ATGTCTCAGTGGAAGAACTATGG + Intergenic
923639553 1:235740425-235740447 TTGTCTCTGTGGAAGGGGGACGG - Intronic
1062893236 10:1082244-1082266 GTGGCTCTGGGTCAGAAGGAGGG - Intronic
1063688809 10:8263993-8264015 ATGACTATGAGGCAGAAGAAGGG + Intergenic
1064456898 10:15496086-15496108 AGGAGTCTGAGGCAGAAGGATGG + Intergenic
1064535224 10:16351235-16351257 CTGTCTCGGTGGCAGGTGGAGGG - Intergenic
1065039152 10:21673040-21673062 ATGTTGCTGTGGCAAAAGGTAGG + Intronic
1065500513 10:26377156-26377178 ATGTCTCTGTGTCATAAAGAAGG + Intergenic
1067143613 10:43677186-43677208 CTGACACTGTGGCAGAAAGAAGG + Intergenic
1067532335 10:47083301-47083323 ATGTCTCTGTGACAGCAGGCAGG + Intergenic
1067537701 10:47126707-47126729 TTGTAGCAGTGGCAGAAGGAAGG - Intergenic
1068451872 10:57200985-57201007 TTGCCTCCGTGGCAGAAGGGAGG - Intergenic
1070260098 10:74846258-74846280 AGTTCTCTGTGGCAGAATGTGGG + Intronic
1071222476 10:83485449-83485471 ATGTCTCTGAGGCAGAAAGAGGG + Intergenic
1071933073 10:90495981-90496003 ATGTCTTTGTTCCAGAATGAAGG + Intergenic
1072252400 10:93591792-93591814 ATGTCTGTGCTGCAGACGGATGG - Exonic
1072739134 10:97899218-97899240 AAGTCCCTGTGGCAGATGGCTGG - Intronic
1074096419 10:110317577-110317599 TTGTCTCCGGGGAAGAAGGAGGG + Intergenic
1074486896 10:113893256-113893278 ATGGGTCAGAGGCAGAAGGAGGG + Intronic
1075446280 10:122515724-122515746 ATGCCTCTGTGGATGGAGGAAGG - Intergenic
1076236714 10:128869149-128869171 ATGTCTCTGTGCCATCTGGATGG + Intergenic
1077475852 11:2790131-2790153 CTGTCTCTGTGGCAGGTTGAGGG - Intronic
1078576878 11:12510038-12510060 ATGTCTTTGTGGCAGAGAGAGGG - Intronic
1080089467 11:28327650-28327672 ACCTTCCTGTGGCAGAAGGATGG - Intronic
1080853493 11:36091493-36091515 CTCTCTCTCTGGCAGAGGGAGGG - Intronic
1081490146 11:43561349-43561371 ATGTTGCTGTGGAAGAAGCAGGG + Intronic
1083394730 11:62382394-62382416 ATGTCTCTGTGTCATAAATAAGG + Intronic
1084961589 11:72719707-72719729 GTGTCACTGTGAGAGAAGGAAGG + Intronic
1085623705 11:78056248-78056270 ATGTCTCCCTGGCAGACAGAAGG - Intronic
1085730780 11:78996816-78996838 ATGACCCTGGGGCAGAAGAATGG + Intronic
1088327298 11:108614029-108614051 ATGAGGCTGTGGCAGGAGGATGG + Intergenic
1088395432 11:109362754-109362776 GTGTCTCTGTATCAGAAAGATGG - Intergenic
1089689982 11:120181115-120181137 ATGTGTCTGGGGGAGCAGGATGG + Intronic
1090334193 11:125951768-125951790 ATGGCCCTGTGGAAGGAGGAAGG - Intergenic
1090507853 11:127338626-127338648 ATCTCTCTGTCCCAGAAGTAGGG + Intergenic
1091225239 11:133953202-133953224 ATGGCTCTGAGACAGAAGGCTGG - Intronic
1091367208 11:135032362-135032384 AAGTCTCTGTAGCAGAGGGGAGG - Intergenic
1092185905 12:6478270-6478292 ATATCTCGGTGGCACCAGGAAGG - Intergenic
1092260406 12:6950585-6950607 ATGCCACTGTGGCAGAGGGATGG - Intronic
1094447753 12:30550180-30550202 CTGTCTCAGTGGCAGGAGGCAGG - Intergenic
1094701915 12:32878298-32878320 ATATCTCGGTGGCACTAGGAGGG + Exonic
1095376615 12:41536664-41536686 ATGTATGTGTGAAAGAAGGATGG + Intronic
1095930719 12:47622742-47622764 ATCTCTCTGTGGCACTTGGAGGG - Intergenic
1097744569 12:63286935-63286957 GTCTTTCTCTGGCAGAAGGAGGG + Intergenic
1098167336 12:67711790-67711812 GTGTGTTTGTGGCAGAAGAAGGG + Intergenic
1098360514 12:69649982-69650004 ATCTACCTGTGGCAAAAGGAAGG + Intronic
1098545966 12:71711457-71711479 GTGACTCTGTGGGAGAAGGAGGG - Intergenic
1099946749 12:89253899-89253921 GTGTCTCTGTGGAAGATTGATGG - Intergenic
1100378679 12:94041903-94041925 ATGTCTCTGTGCAAGAAGCAGGG + Intergenic
1101057228 12:100930648-100930670 AACTTTCTGTGGCAGAAGGAAGG + Intronic
1101769924 12:107740089-107740111 AGGTCTCTGTTGCAAAAGGATGG + Intronic
1103516667 12:121512824-121512846 CTGTCTTTGAGGCAGCAGGAGGG - Intronic
1104491838 12:129201014-129201036 GTGTCTCTGGTGCAGAAGCAAGG + Intronic
1105351449 13:19619910-19619932 ATGTCTCTATGGGAGAATGAGGG + Intergenic
1106527808 13:30558646-30558668 ATGTCTTTTTGGAAAAAGGAAGG - Intronic
1109125139 13:58507284-58507306 ATGTTTCTGTAGGGGAAGGACGG + Intergenic
1111384872 13:87512287-87512309 AAGTCTGTGTGGCAGAAGCAGGG - Intergenic
1111654866 13:91139703-91139725 AAGTCTGTGTGGCTGAAGCATGG - Intergenic
1112007759 13:95268702-95268724 ATGTCTCTGTGTCATAAACAAGG - Intronic
1112241099 13:97681999-97682021 ATGTCTTTGAGGCACAAGTATGG + Intergenic
1113036629 13:106056960-106056982 ATATCTCTGTGGCAAGAGAAAGG - Intergenic
1113521710 13:110946379-110946401 ATGTGTCCGGGGCAGGAGGACGG + Intergenic
1113822000 13:113221325-113221347 AGGTCACTCTGGCAGAATGATGG + Intronic
1113920197 13:113903479-113903501 CTGCCTCTCTGGCAGGAGGACGG + Intergenic
1114345689 14:21792292-21792314 ATGTCTCCCTGGAAGAGGGAGGG + Intergenic
1114418168 14:22557726-22557748 TTGCCTCTGGGGTAGAAGGATGG + Intronic
1115805190 14:37043088-37043110 TTGTGTCTGTGGCAGAAGGTGGG - Intronic
1117003831 14:51398214-51398236 ATATCTCTATGTCAGAAGCAAGG - Intergenic
1117886428 14:60369069-60369091 GTGTCTCTGTAGGGGAAGGAAGG - Intergenic
1118973434 14:70656575-70656597 ATGTCTCTGGGGCAGGAGAGGGG + Intronic
1119354074 14:73990677-73990699 ATGGCTTTGTTGCAGAATGATGG - Intronic
1120011330 14:79418842-79418864 ATCTCACTGTGGCAGATGCAGGG - Intronic
1120641662 14:87020804-87020826 ATGTCTCTGTGTCATAAACAAGG - Intergenic
1120765188 14:88322367-88322389 TTGTCTCTCTGGCAGATGGGTGG - Intronic
1120889849 14:89482249-89482271 CTGTCTCTCTGGCAGGAGGCCGG - Intronic
1122858748 14:104572625-104572647 GTGTCACTGTGGCTGAGGGAAGG - Intronic
1123065539 14:105617158-105617180 AGGTCTCTGTGGCCAAGGGAAGG - Intergenic
1123069736 14:105636623-105636645 AGGTCTCTGTGGCCAAGGGAAGG - Intergenic
1123088818 14:105732342-105732364 AGGTCTCTGTGGCCAAGGGAAGG - Intergenic
1123763345 15:23449738-23449760 CTGTCCCTGTTGCAGATGGAAGG - Intergenic
1124420977 15:29521654-29521676 TTGTCTCTGGGGCAGAAAAAGGG + Intronic
1125095489 15:35845600-35845622 ATATCTCTGTGGCACTAGGATGG - Intergenic
1125149171 15:36511578-36511600 AAGTCTTTGTGGCAGGAAGAAGG - Intergenic
1125991288 15:44111221-44111243 CTGTCCCTGTTGCAGATGGAAGG - Intronic
1126740719 15:51773489-51773511 ATCTCTGTGTGGCAGAATGCAGG + Intronic
1129538234 15:76331410-76331432 ATTTCTCAGTGGCTGAAAGATGG + Intergenic
1130228643 15:82079643-82079665 ATCTCTCTGTGCAAGAAGAATGG + Intergenic
1130670892 15:85911542-85911564 CTGTCTCTGTCACAGAAGGTAGG + Intergenic
1131377065 15:91934278-91934300 ATGTCTCTGGGGCAAAGGGTAGG - Intronic
1136188455 16:28601427-28601449 GGGTCTCTGTGCCAGGAGGAAGG - Intergenic
1136190923 16:28614421-28614443 GGGTCTCTGTGCCAGGAGGAAGG - Intronic
1137087447 16:36144284-36144306 ATTTCTCTGTGTGAGAAAGATGG - Intergenic
1138303653 16:55955115-55955137 CTCTCCCTGGGGCAGAAGGAAGG - Intronic
1138387856 16:56648333-56648355 ATGTCCCTGCGGCAGGAGGCAGG + Intronic
1138424122 16:56919189-56919211 ATGTCTCTGTTACAGAGTGAGGG + Intergenic
1140318829 16:73927928-73927950 ATGTCTCTGTGGCTTATAGATGG - Intergenic
1141008050 16:80371611-80371633 ATTTCACTGTGGCAGCATGATGG - Intergenic
1142057728 16:88009998-88010020 ATGTCTCATTGGAATAAGGACGG + Intronic
1142483063 17:230217-230239 CTGTCTCTGGGCCTGAAGGAGGG - Intronic
1142691999 17:1612294-1612316 ATGTCAGGGAGGCAGAAGGAAGG - Intronic
1142710849 17:1723220-1723242 ATGTCACTGTGGCTGGGGGAAGG - Intronic
1143209749 17:5176573-5176595 GGGTCTCTGTTGCACAAGGATGG + Intergenic
1143366703 17:6413461-6413483 ATGTCTCTGTGGCAGGTGTAAGG - Intronic
1144623990 17:16835158-16835180 ATGTCTCTGTGTCATAAACAAGG + Intergenic
1144812658 17:18010651-18010673 ATGACACTATGGCAGCAGGAGGG + Intronic
1144875579 17:18395383-18395405 GTGTGTCTGTGGCCTAAGGATGG + Intergenic
1145156647 17:20549038-20549060 GTGTGTCTGTGGCCTAAGGATGG - Intergenic
1146131778 17:30283278-30283300 ATTTCTCTGAGGCAGGAGTAGGG + Intronic
1146161735 17:30563461-30563483 ATGTCTCTGTGTCATAAACAAGG + Exonic
1146200508 17:30853391-30853413 ATGTCTCTATAGCAGAAGGTAGG - Intronic
1146663315 17:34679756-34679778 ATGTCTGCATGGCAGGAGGATGG + Intergenic
1147865583 17:43549907-43549929 ATGTGACTGTGAGAGAAGGATGG + Intronic
1148559964 17:48600369-48600391 ATTTCCCTGTGTCAGAAGCAGGG + Intronic
1150006633 17:61473870-61473892 CTGTTGCTGTGGCAGAAGGCAGG + Intronic
1151134752 17:71935483-71935505 AATTCTCTGTGGCAGAATAAAGG - Intergenic
1151189703 17:72389163-72389185 ATGGCTCTGTGGGTGCAGGATGG + Intergenic
1151339656 17:73462658-73462680 ATGTATATGTGGTGGAAGGATGG + Intronic
1152191971 17:78893794-78893816 AGGTCTCTTTGGCATCAGGAAGG + Intronic
1153575981 18:6522406-6522428 ATGTCTCTGTGGCAGAAGGAGGG + Intronic
1155989853 18:32269169-32269191 ATGTCACTGTAGCACAAGCATGG - Intronic
1156462356 18:37328215-37328237 AATTCACTGTGGCAGAAGCAGGG + Intronic
1157503574 18:48208741-48208763 GACTCTGTGTGGCAGAAGGATGG + Intronic
1157516004 18:48312000-48312022 ATCTCTCAGGGACAGAAGGAGGG + Intronic
1158149223 18:54348417-54348439 ATGTATCTGTGGAATAATGAAGG - Intronic
1158700731 18:59743481-59743503 ATGTCTCTGTGCCATTGGGAAGG + Intergenic
1159152210 18:64535069-64535091 ATCTCTCTGTGGAAGATGGAGGG + Intergenic
1159828515 18:73244232-73244254 CTGTCTCTGTTGCAGGGGGAAGG - Intronic
1163667414 19:18609900-18609922 ATGTGTAAGGGGCAGAAGGAGGG + Intronic
1163898853 19:20083012-20083034 ATGTCTCAGTGTCAGAAACAAGG - Intronic
1163973523 19:20825432-20825454 TTGTCTTTGTGGCAGAAGTTGGG + Intronic
1164752252 19:30665672-30665694 GTGTCTTTTTGGCAGAAGCAAGG - Intronic
1164763116 19:30743158-30743180 ACGGCTCTGTGTCAGAAGCAGGG + Intergenic
1165171592 19:33895774-33895796 ATATTTGAGTGGCAGAAGGATGG - Intergenic
1166003942 19:39894448-39894470 CTGTCTCTGTGGCCGACGGGCGG - Exonic
1166382430 19:42362025-42362047 GTGTCTGGGAGGCAGAAGGAGGG + Intronic
1166740669 19:45113006-45113028 TGGGCTCTGTGGCAGAGGGAGGG + Intronic
1166762873 19:45235608-45235630 AGGCCTCTGAGGCTGAAGGAGGG + Intronic
1166944091 19:46386546-46386568 TTGTGTCTGAGACAGAAGGATGG + Intronic
1167862608 19:52297418-52297440 ATGGCCCTGTGGCAGAAGGACGG - Intronic
1167873140 19:52390142-52390164 ATGGCCCTGTGGCAGAAGCACGG - Intergenic
1168461139 19:56559601-56559623 ATGTCTCTGTGTCATAAACAAGG + Intergenic
925795210 2:7533740-7533762 ATGAATATGTGGCAGAAGGCAGG - Intergenic
926663773 2:15497493-15497515 ATCTCCCTTTGGCAAAAGGATGG + Intronic
927149177 2:20186002-20186024 CTGCCTCTGTGGGAGAAGGGAGG - Intergenic
929449922 2:42030125-42030147 AATTCTCTGTGGCAGAAAGCAGG + Intergenic
929830002 2:45339463-45339485 ATGCCACTGTGGCGGCAGGAGGG + Intergenic
930019875 2:46995044-46995066 CTGACTCTGGGGCAGAAGGCTGG + Intronic
932341435 2:70964905-70964927 ATGTGTGTGGGGCGGAAGGAGGG - Intronic
933349883 2:81139967-81139989 ATGTGTTTGTGGCAGAGGAAGGG + Intergenic
934117892 2:88813219-88813241 ATGTGGCCATGGCAGAAGGAAGG - Intergenic
934933335 2:98445708-98445730 GTGTCTTTGTGGGCGAAGGAAGG + Intronic
935180487 2:100685544-100685566 ATGTCTCTGTGTCATAAACAAGG - Intergenic
935605297 2:104966486-104966508 GTGTCTCTGTAGAGGAAGGAGGG + Intergenic
935643036 2:105308689-105308711 ATTTCTGTGAGGCAGGAGGATGG + Intronic
936157306 2:110056744-110056766 AGGTCTCTGTGTCAGAAACAAGG - Intergenic
936187388 2:110314700-110314722 AGGTCTCTGTGTCAGAAACAAGG + Intergenic
936430068 2:112454859-112454881 AGGGCTTTGTTGCAGAAGGAGGG + Intergenic
936613926 2:114029160-114029182 ATGTCTCAGTGGTAGAAGGAAGG + Intergenic
937077348 2:119116903-119116925 AGGTCACTCTGGGAGAAGGAGGG + Intergenic
939443047 2:142274938-142274960 ATATCTCTGTTTCTGAAGGATGG + Intergenic
940029261 2:149243464-149243486 TTACCTCTGTGGCAGAAGCATGG + Intergenic
941743957 2:169066530-169066552 ATGTGTCTGTCACAGAGGGAGGG - Exonic
941859436 2:170263553-170263575 ATGTCTCTGTGTCATAAACAAGG + Intronic
942421001 2:175807692-175807714 ATTGCTCTGTGGCAGAAGCATGG - Intergenic
942651738 2:178175991-178176013 CTGTCTCTATGGCAGAACCAGGG - Intergenic
943327758 2:186522169-186522191 ATGTCTCTGTGTCATAAACAAGG - Intergenic
943733394 2:191327271-191327293 ATGTCTCTGTGGCATAAACATGG + Intronic
943880965 2:193143095-193143117 ATGTCTCTGTGTCATAAACAAGG - Intergenic
944668046 2:201972950-201972972 TTGTCCCTGTGTCAAAAGGATGG - Intergenic
946217638 2:218197956-218197978 ACTTATTTGTGGCAGAAGGAAGG - Intergenic
946755360 2:222939806-222939828 ATGTTTCTGTAGGGGAAGGAGGG + Intronic
946759883 2:222982966-222982988 ATTTCTGTGTGGCAGAGAGAAGG + Intergenic
947200982 2:227614585-227614607 ATGTGGCTGTGGCTGTAGGAAGG - Intronic
947736060 2:232456179-232456201 ATGTCTTGGGGGCAGCAGGAGGG - Exonic
947888389 2:233594438-233594460 ATGTCTACGTGGCAGCAGGCAGG - Intergenic
949038971 2:241836571-241836593 ATTTCTCTGTGGTAGAAAGGGGG - Intergenic
1169336461 20:4760944-4760966 CTGTCTCTGTGACTGTAGGAGGG - Intergenic
1170056338 20:12208409-12208431 GTGTCTCTGTGGGGGAAGAAGGG + Intergenic
1170498248 20:16947896-16947918 ATGTCTCTATGGGCTAAGGAAGG + Intergenic
1170573003 20:17642894-17642916 TCCTCTCTGTGGCAGAGGGAAGG + Intronic
1170628706 20:18049800-18049822 AGGTCTGTGGGGCAGGAGGAGGG + Intronic
1171195124 20:23190926-23190948 AGGTCACTGTTGCAGAGGGAAGG - Intergenic
1171256780 20:23694630-23694652 ATGTCTCTGTGTCATAAACAAGG + Intergenic
1171264134 20:23756551-23756573 ATGTCTCTGTGTCATAAACAAGG + Intergenic
1171291061 20:23983317-23983339 ATGTCTCTGTGTCATAAACAAGG - Intergenic
1171783275 20:29440562-29440584 ATGTCTCTGTGTCATAAACAAGG + Intergenic
1172728478 20:37066108-37066130 ATTTCTCTTTGGTAAAAGGAGGG - Intronic
1173758223 20:45537223-45537245 AAGGCTCTGTGGCAGGAGGCAGG - Exonic
1174556711 20:51400738-51400760 ATGTCTGTGAGGATGAAGGAAGG - Intronic
1174665528 20:52254347-52254369 CTGTGGCTGGGGCAGAAGGATGG - Intergenic
1175404715 20:58718587-58718609 GTGTCTGTGTGGCACAGGGAGGG - Intronic
1175573443 20:60041449-60041471 ATGTCTCTGTGTCATAAACAAGG + Intergenic
1177091541 21:16775290-16775312 ATGTGTCTGAGGCAGAGGGAAGG + Intergenic
1177737971 21:25116785-25116807 ATGTATGTATGGCAGAAAGAAGG - Intergenic
1178378286 21:32086586-32086608 ATGTTTCTGAGGCAGGAGAATGG + Intergenic
1179424036 21:41258915-41258937 CTTTCTCTGTGGCAGCAGGTGGG + Intronic
1180766355 22:18347776-18347798 ATGTCTCTGTGTCATAAACAAGG + Intergenic
1180779960 22:18514602-18514624 ATGTCTCTGTGTCATAAACAAGG - Intergenic
1180812674 22:18771923-18771945 ATGTCTCTGTGTCATAAACAAGG - Intergenic
1180870970 22:19147244-19147266 ATGTAAATGTGGCAGAAAGATGG + Intergenic
1181198832 22:21206171-21206193 ATGTCTCTGTGTCATAAACAAGG - Intergenic
1181400902 22:22649618-22649640 ATGTCTCTGTGTCATAAACAAGG + Intergenic
1181518844 22:23433840-23433862 TCGTCTCTGGGGCAGAAGGAAGG + Intergenic
1181702881 22:24630716-24630738 ATGTCTCTGTGTCATAAACAAGG + Intergenic
1181820654 22:25472703-25472725 ATGCCTCTGTGTCAAAAGAAAGG - Intergenic
1181847356 22:25722415-25722437 CTGTTTCTGTGACAGAGGGATGG - Exonic
1183274732 22:36886676-36886698 TTGGCTCAGTGGCACAAGGAGGG + Intergenic
1184726181 22:46347963-46347985 ATCACCCTGTGGCATAAGGAAGG - Intronic
1203227973 22_KI270731v1_random:88666-88688 ATGTCTCTGTGTCATAAACAAGG + Intergenic
949430393 3:3969264-3969286 ATGCCACTGTAGCAGAAAGATGG + Intronic
949451865 3:4194490-4194512 ATCTCTATGTGGCAGACGGTGGG - Intronic
949826573 3:8171789-8171811 ATATCTCTGTGGAAGAAGATGGG - Intergenic
950387956 3:12674790-12674812 ATGTCTCTGTGTCATAAACAAGG - Intergenic
950629579 3:14273517-14273539 ATGTCTCTGTGTCATAAACAAGG - Intergenic
951351393 3:21611255-21611277 ATATCTCTGTGGCAGACAGATGG - Intronic
953333794 3:42076801-42076823 TTTTTTATGTGGCAGAAGGAAGG + Intronic
953919745 3:46943648-46943670 ATGTCTCTGGGGCTCCAGGAGGG - Intronic
955582317 3:60437269-60437291 ATGTCACTGAGGCAGAGAGAAGG + Intronic
956127695 3:66026852-66026874 ATGTCTCTCTGGCAGCAAAAGGG + Intronic
956802925 3:72779262-72779284 AAGGCTCTGTGGCAGGAGGAGGG - Intronic
957082203 3:75646000-75646022 ATGTCTCTGTGTCATAAACAAGG - Intergenic
957379236 3:79403884-79403906 ATCTCTCTGTGGCAGAAGCTGGG + Intronic
958680217 3:97320547-97320569 ATTTCTCTGTGGAAGGAGGAAGG - Intronic
958761725 3:98316962-98316984 ATGTTTCTGTGACACAAGGTTGG + Intergenic
958858769 3:99419986-99420008 ATGTCTCTGTGTCATAAACAAGG - Intergenic
959728152 3:109569026-109569048 ATGCTTCCCTGGCAGAAGGATGG + Intergenic
960834909 3:121896088-121896110 AGGGCTCTGGGGCAGAAGAATGG - Intronic
961593416 3:127997818-127997840 CAGTCTCCATGGCAGAAGGATGG + Intergenic
962312283 3:134335112-134335134 ATGTGTCTGTGGCTCAAGAAGGG - Intergenic
962353480 3:134673489-134673511 AGGCGTGTGTGGCAGAAGGAGGG - Intronic
963005650 3:140724191-140724213 AGGTCACTGTGGGAGAGGGAAGG - Intergenic
965062321 3:163800361-163800383 ATGGCTCAGTGGCAGCAGGCTGG - Intergenic
966878678 3:184337658-184337680 ATGTTTCTGTGGCAGCGTGAAGG + Exonic
967476388 3:189925500-189925522 TTCTCTTTGTGGGAGAAGGAGGG - Intergenic
967927636 3:194663782-194663804 CTTTCTCTGAGGCAGAAGAAGGG - Intronic
970637383 4:18023553-18023575 ATCTCTGGGTGGCAGGAGGAGGG + Intergenic
971766006 4:30832954-30832976 ATATCTCTGTAGCAGAAAGGTGG + Intronic
972129646 4:35816163-35816185 ATGTCTCTGGGGCTGGGGGAGGG - Intergenic
972343686 4:38175181-38175203 GTGTTTCTGGGGCAGATGGATGG - Intergenic
972429630 4:38968265-38968287 ATGTCTCTGTGTTAGAATCATGG - Intronic
974960548 4:68694141-68694163 ATGTCTCTGTGTCATAAACAAGG - Intergenic
977566915 4:98589850-98589872 ATGTCTCTGTGGAAGGTGGTGGG + Intronic
977793727 4:101137407-101137429 CTGTCTCTGTGGCTGAGGAATGG + Intronic
978300680 4:107266394-107266416 ATGTCACTGTGGGAGATGGTTGG - Intronic
979325864 4:119378823-119378845 ATCTCCCTGTGGCAGAGGGAGGG + Intergenic
979674940 4:123399433-123399455 CTCTCTCTGTGGTAGGAGGAGGG - Intronic
980784370 4:137532905-137532927 ACATGTCTGTGGCAGAAGAAAGG - Intergenic
982823747 4:159976759-159976781 ATGTCTCTGTGTCAAAAACAAGG + Intergenic
983243780 4:165263971-165263993 ATTTCCCTGTGGCAGAGGGAGGG + Intronic
984655549 4:182313916-182313938 AGATCTCTCTGGCTGAAGGATGG - Intronic
985023633 4:185717388-185717410 ATATCTCTGTAGCAGAAACATGG + Intronic
985057840 4:186050716-186050738 ATGTCTCTGTGTCATAAACAAGG - Intergenic
985286748 4:188344168-188344190 ATGTCCCTGTGTCTGAAGGGAGG + Intergenic
985382724 4:189412565-189412587 CTGGTGCTGTGGCAGAAGGAAGG - Intergenic
986090988 5:4506235-4506257 CTTTCTCTGTGGCAGAATAAGGG + Intergenic
986156565 5:5182485-5182507 ATCTCTCCATGGCAGATGGATGG + Intronic
986741051 5:10705450-10705472 AAGTCTGTGTGGCAGAAGCCTGG + Intronic
987329289 5:16841590-16841612 ATTTCTCTGAGAGAGAAGGATGG + Intronic
987946786 5:24619839-24619861 CTGTCTCTGTACCAGAAAGAGGG + Intronic
988611173 5:32726786-32726808 TTGTCTGTGTGGCAGAATTATGG - Intronic
988683205 5:33503181-33503203 TCCTCTCTGTGGCAGGAGGAGGG - Intergenic
990046056 5:51433161-51433183 AAGTGTCTGTTGCATAAGGAAGG + Intergenic
990519581 5:56565873-56565895 CTGACTCTGTGGCTGAGGGATGG + Intronic
990835267 5:60012507-60012529 ATGTCTCAGTTGCAGAAGTCAGG - Intronic
990848346 5:60171489-60171511 ATGGATCTGAGGTAGAAGGAAGG + Intronic
992021623 5:72630413-72630435 CTCCCTCTGTGGCAGAAGGCAGG + Intergenic
992096841 5:73370635-73370657 ATGGCCCTGTAGCAGAAAGAGGG + Intergenic
992615573 5:78543265-78543287 CTGTCTCTGTTGCAGAGAGAGGG - Intronic
994010303 5:94894614-94894636 ATGTGTCTCTGGAAGGAGGAGGG + Intronic
994766847 5:103929176-103929198 ATGTGTATGTGGCAGAAAGGAGG + Intergenic
994805683 5:104444915-104444937 ATGTATGTGTGCCAGAGGGAGGG + Intergenic
995118146 5:108505158-108505180 ATGGATCTGTGCCAGAAAGAAGG - Intergenic
995333995 5:110977605-110977627 ATGTCTCTGTGGGTTAAGGGAGG - Intergenic
996601650 5:125271240-125271262 CTGTCTCTGTGCCAGAAAGGAGG + Intergenic
996653329 5:125909440-125909462 TTGTCTCAGAGACAGAAGGATGG - Intergenic
997529454 5:134572934-134572956 CTGTCACTGTGGCAGAGTGAAGG + Intronic
999295044 5:150454026-150454048 ATGTCTCTGTGTCATAAACAAGG + Intergenic
999679933 5:154047338-154047360 ATGTCTATGGGGCAGTAGGTAGG + Intronic
1002377500 5:178798750-178798772 ATGTCTCTGTGTCATAAACAAGG - Intergenic
1002388685 5:178891918-178891940 ATGTGTCTGTGGGAGAACAAGGG - Intergenic
1005121988 6:22400215-22400237 ATGTCTCTGTGGTTTAGGGATGG + Intergenic
1006678154 6:35778343-35778365 ATGTCACTGTGGCAGGGAGATGG - Intronic
1006842407 6:37037757-37037779 ATGGGTCTCTGGCAGCAGGATGG - Intergenic
1007224159 6:40301251-40301273 ATGTCTGTGTGGCAGACTGCTGG - Intergenic
1007322320 6:41036666-41036688 AGGCCTTTCTGGCAGAAGGAGGG - Intronic
1007339838 6:41184283-41184305 CTGTTGCTCTGGCAGAAGGAAGG + Intergenic
1008155391 6:48008089-48008111 ATTTCTAAGTGGCAGCAGGAAGG + Intronic
1010732164 6:79402843-79402865 GTGTCTGAGTGGAAGAAGGAAGG - Intergenic
1011176640 6:84568811-84568833 ATGTCTCTGAGTTTGAAGGAAGG + Intergenic
1011892530 6:92183313-92183335 ATATCTCTGTGGCAAAGGAATGG + Intergenic
1012396692 6:98806355-98806377 AAGTCTTTCAGGCAGAAGGAAGG - Intergenic
1012521981 6:100132392-100132414 GTGTTTCTGTGGCAGGATGAGGG + Intergenic
1012988558 6:105900617-105900639 AGGTCTCGATGGCAGAAAGATGG - Intergenic
1013371670 6:109476398-109476420 ATGTTTCTGTGGTAGATTGAAGG - Intronic
1013686446 6:112590194-112590216 ATCCTTCTGTGGCAGAATGAAGG - Intergenic
1013703995 6:112810657-112810679 ATGTCTCTGTGAAAGAATGCTGG - Intergenic
1014244409 6:119052319-119052341 ATGACTTTGTGGTAGGAGGAGGG - Intronic
1015060454 6:128958792-128958814 ATGTCTCTGAGAGTGAAGGAGGG - Intronic
1015275669 6:131381245-131381267 ATGTCTGTGTTGGAGCAGGAAGG + Intergenic
1016846699 6:148575055-148575077 ATGTCCCTGAGTCAGAAGGGAGG - Intergenic
1017586884 6:155936320-155936342 ATGAGTAAGTGGCAGAAGGAAGG + Intergenic
1017785365 6:157752485-157752507 ATGTCTCTGTGTCATAAACAAGG + Intronic
1018523855 6:164685329-164685351 ATTTCTTTGTAGCACAAGGAAGG - Intergenic
1019599716 7:1875101-1875123 TCGTCTCTGGGGCAGAAGGAAGG - Intronic
1021576073 7:22107558-22107580 AGGTCACGGTGCCAGAAGGATGG + Intergenic
1021747518 7:23757483-23757505 ATGTCTCTGTGTCATAAACAAGG + Intronic
1021862577 7:24921683-24921705 ATGTCTCAGTGGGAGTAGGATGG - Intronic
1022199393 7:28102018-28102040 ATGTCTCAGTGGCAGAACTGGGG + Intronic
1022633907 7:32113027-32113049 ATAGCTCTGTGCTAGAAGGAAGG + Intronic
1024963386 7:55001856-55001878 AGGTGTCTGTGGAAGGAGGATGG - Intergenic
1026580830 7:71615335-71615357 AGGTCTCGCTGGCAGATGGAGGG - Intronic
1027049610 7:75013685-75013707 ATGTCTGTGTGGCAGACAGAGGG + Intronic
1027516663 7:79150059-79150081 ATGTTTGTGTGGCAGAAAGATGG + Intronic
1027740220 7:81992441-81992463 GTGTATGTGTGGCAGATGGAGGG + Intronic
1027812523 7:82922830-82922852 ATGTCTCTCTAGCAGTATGATGG - Intronic
1029195804 7:98804496-98804518 ATGGGTCTGTGGCAGAGGGGAGG - Intergenic
1029383419 7:100227980-100228002 ATGTCTGTGTGGCAGACAGAGGG - Intronic
1029691108 7:102182408-102182430 AAATCTCAGTGGCAGAAAGATGG - Intronic
1031079195 7:117241789-117241811 ATGTTCATGTTGCAGAAGGAAGG - Intergenic
1031397193 7:121287248-121287270 GTGTCTGTGTGGCAGGAGGTTGG - Intronic
1032305925 7:130732970-130732992 ATGACTCTGGGAAAGAAGGATGG + Exonic
1034928426 7:155141465-155141487 AGGTTTCTGTGGTAGAAGGCAGG + Intergenic
1035262209 7:157669229-157669251 CTGACTCCGTGGCAGAAGAAGGG - Intronic
1035481624 7:159191664-159191686 TTCTCCCCGTGGCAGAAGGAGGG - Intergenic
1036604785 8:10295398-10295420 AGGTCCCTGTGTGAGAAGGAAGG - Intronic
1036796870 8:11762528-11762550 GTGTTTCTGTGTCAGAGGGAGGG - Exonic
1038372178 8:27005311-27005333 AGGTCTCTTTGGGAGAAGGGTGG + Intergenic
1039129198 8:34242459-34242481 ATGTGTGTGTGAGAGAAGGAGGG + Intergenic
1041429638 8:57764873-57764895 TTTTCTCTGGTGCAGAAGGAAGG - Intergenic
1041623314 8:59998765-59998787 ACGGCTCTGTGGCAGACTGAAGG - Intergenic
1041695186 8:60728400-60728422 ATGTTTTTGTGGCAGGAGGAAGG + Intronic
1041878831 8:62722737-62722759 ATGTGTCTGTGTGGGAAGGAGGG - Intronic
1042380640 8:68109478-68109500 CTGTCTCTGGGACAGCAGGATGG + Exonic
1042740579 8:72040332-72040354 ATATCTCTATGGAGGAAGGAGGG - Intronic
1044181338 8:89199015-89199037 TTATCTTTGTGGCAGAAGGAAGG - Intergenic
1045419334 8:101998641-101998663 TTGTTTCTGTGGCCCAAGGATGG + Intronic
1046953187 8:120037646-120037668 ATGTCACTCTAGCAGAAGAATGG + Intronic
1047417894 8:124680530-124680552 TTGTCTATGTGCCACAAGGAGGG + Intronic
1047562638 8:126005674-126005696 ATGTCTCGGAGGCAGAGGGAGGG + Intergenic
1048062881 8:130938495-130938517 ATGGCTGTGTGGGAAAAGGAGGG + Intronic
1048112550 8:131484562-131484584 ATGTCTGTATTTCAGAAGGAGGG + Intergenic
1049341880 8:142117540-142117562 ATGTCTCTGTGGGATCTGGAAGG - Intergenic
1049383179 8:142327603-142327625 AAGTCCCTGTGGCAGAGGGGTGG - Intronic
1050050450 9:1595709-1595731 ATGGCTCTGTGGCCCAAAGACGG - Intergenic
1050852889 9:10310526-10310548 ATGTTTCTGTGACAAAAGAAAGG + Intronic
1051554296 9:18365461-18365483 AGGACTCTGAGGCTGAAGGAAGG + Intergenic
1052379203 9:27751780-27751802 CTGTCCCTGTGGCAGTAGAAGGG - Intergenic
1054711502 9:68515647-68515669 ATCTCTCTGTGTCAGCAAGAGGG - Intronic
1055309235 9:74961351-74961373 ACGTCTCTGCCTCAGAAGGAAGG + Intergenic
1055397046 9:75887293-75887315 ATGTCTCAGTAGCCAAAGGAAGG - Intergenic
1055455599 9:76468669-76468691 ATCTCTCTTTAGCAGAAAGATGG + Intronic
1055762344 9:79622341-79622363 ATGTCTGTGTGGCTGGAAGAGGG - Intronic
1057085591 9:92206951-92206973 GTGTCTCTATGGGAGAATGAGGG + Intergenic
1057124904 9:92609378-92609400 AAGTCTCTGGAGCAGCAGGAAGG + Intronic
1059284922 9:113164262-113164284 TTGTCTTTGTAGCAGATGGATGG - Intronic
1059425287 9:114217236-114217258 ATGTCTCTGAGGTATAAGCAAGG - Intronic
1062196364 9:135276402-135276424 TTGTCTGTGTGGCAGGAGGTTGG - Intergenic
1203443304 Un_GL000219v1:31436-31458 ATGTCTCTGTGTCATAAACAAGG + Intergenic
1203514112 Un_KI270741v1:150345-150367 ATGTCTCTGTGTCATAAACAAGG + Intergenic
1186632424 X:11364477-11364499 ACCTCTCTTTGGAAGAAGGAGGG - Intronic
1186746273 X:12572963-12572985 AAGTATCTGTGTCAGAAAGAGGG - Intronic
1186807703 X:13156360-13156382 GTGTCTCTGTGGTAGAATAAAGG + Intergenic
1186877808 X:13833962-13833984 ATGTCTGTGTGGTAAAATGAAGG - Intronic
1187404104 X:18986843-18986865 AAGTCTCTGTGGCAGGATGATGG - Intergenic
1187962658 X:24581447-24581469 TTGTGTCTGTGGCAGAGTGAGGG - Intronic
1188331423 X:28876250-28876272 TGGTCACTGTGGCAGGAGGAAGG + Intronic
1188933818 X:36148574-36148596 ATGTCTCTGGATCAGGAGGAAGG + Intergenic
1189482797 X:41406046-41406068 ATGTCACTGTGGCACTAGGATGG - Intergenic
1190481567 X:50882491-50882513 ATGTCCCTGTTCAAGAAGGAAGG + Intergenic
1194781620 X:98030209-98030231 ATGTCTGTGTGTCAGACTGAAGG + Intergenic
1195289072 X:103414195-103414217 ATGGCGATGTGGCAGGAGGAGGG + Intergenic
1196121691 X:112058056-112058078 GTGTCTTTGTGAGAGAAGGAGGG + Intronic
1196256399 X:113524285-113524307 ATGTCTATGTGGTAGAACTAAGG - Intergenic
1196278342 X:113795194-113795216 ATGTATCTGTATCAGAAAGAGGG + Intergenic
1196369965 X:114966546-114966568 ATGTCTCTGTTGAAGCATGATGG + Intergenic