ID: 1153578142

View in Genome Browser
Species Human (GRCh38)
Location 18:6543556-6543578
Sequence TGCCCACTAGTAATTCAAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 94}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153578137_1153578142 26 Left 1153578137 18:6543507-6543529 CCACTAGATGGCAGTGAATTGGC 0: 1
1: 0
2: 1
3: 2
4: 93
Right 1153578142 18:6543556-6543578 TGCCCACTAGTAATTCAAAGGGG 0: 1
1: 0
2: 1
3: 6
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153578142 Original CRISPR TGCCCACTAGTAATTCAAAG GGG Intronic
902279666 1:15365080-15365102 TCTCCACCAGGAATTCAAAGGGG + Intronic
903406595 1:23102439-23102461 TTCCCAATAGTCATTTAAAGAGG + Intronic
907746996 1:57223471-57223493 TGGTCACTGGTAGTTCAAAGGGG - Intronic
909024367 1:70465423-70465445 TGGCCACTAGTAACTGAAACTGG - Intergenic
910214789 1:84832375-84832397 TGCCCTCTAGTAAGTCAAAATGG + Intronic
915772142 1:158437034-158437056 TGCCAAATAGTTTTTCAAAGTGG + Intergenic
916884430 1:169053158-169053180 TGCCAATTAGAAATCCAAAGCGG + Intergenic
921968505 1:221119053-221119075 AGAGCACTAGTAATTCCAAGTGG - Intergenic
1063306628 10:4908800-4908822 TTCCCTATAGTAATTCAAACTGG + Intergenic
1064018728 10:11792600-11792622 TGCCCACTAGAAATTCCCTGTGG - Intergenic
1067772429 10:49136814-49136836 TGCCCACTTTTAATTCTAATGGG - Intergenic
1073915063 10:108393218-108393240 TACCCAAAAGCAATTCAAAGAGG + Intergenic
1077753861 11:5004368-5004390 TGCCCACCTGTACTTCAAAGGGG - Intergenic
1078765414 11:14292215-14292237 TGCCCACTAGAACCCCAAAGAGG - Intronic
1081839820 11:46191602-46191624 TGCCAACTGGTCTTTCAAAGTGG - Intergenic
1086966848 11:93036953-93036975 TGCCCAGTTGTTTTTCAAAGTGG + Intergenic
1087775649 11:102254235-102254257 TGCCCCCTAGTGATTCCAGGAGG - Intergenic
1091942151 12:4496956-4496978 TGCCAAATAGTTTTTCAAAGTGG - Intronic
1098066372 12:66621705-66621727 TTCCCTCTAGTAATGCAAAAGGG + Intronic
1098365499 12:69699526-69699548 TGCCAACTTCTCATTCAAAGGGG - Intergenic
1098905294 12:76155589-76155611 TGGCCACTATTGATTCCAAGTGG + Intergenic
1099643909 12:85325913-85325935 TACCCATTAGAAATTCAGAGAGG - Intergenic
1100113410 12:91272790-91272812 TGACAACAAGAAATTCAAAGGGG + Intergenic
1101499840 12:105292934-105292956 TGCCAACTAGAACTCCAAAGTGG - Intronic
1103828459 12:123760178-123760200 TCCCCACTAGTAATTCTCATGGG + Exonic
1104399119 12:128461161-128461183 TGGCAGCTATTAATTCAAAGAGG + Intronic
1105277055 13:18940784-18940806 TGCCCACCTCTAATTCAAGGTGG - Intergenic
1111982900 13:95035644-95035666 TGTCCACTGGAAATTGAAAGAGG + Intronic
1112751002 13:102583288-102583310 TGGCCACCAGTAATCCCAAGAGG + Intergenic
1116408178 14:44592103-44592125 TCCCCAAGAGTAATGCAAAGAGG + Intergenic
1134211528 16:12281428-12281450 TGCCCACCAGCCATTTAAAGAGG - Intronic
1137349512 16:47699733-47699755 TGCCAACTAGTAATGCATACTGG + Exonic
1141526440 16:84614780-84614802 TGCCCACTTGTGACTCAGAGAGG - Intronic
1141801184 16:86310475-86310497 TGCCAATTGGTAATTAAAAGCGG + Intergenic
1143987629 17:10928735-10928757 TTCCCACTAGTTAGTCGAAGTGG - Intergenic
1144247123 17:13378000-13378022 TGCCCACGAATAATCCAGAGAGG + Intergenic
1148828414 17:50412149-50412171 TGCCAACAACTAATGCAAAGCGG - Intergenic
1150885918 17:69085472-69085494 TGCCCAGTAAAAATTTAAAGAGG + Intronic
1152099290 17:78291763-78291785 TCCCCACTAGCAATCCAGAGTGG - Intergenic
1153578142 18:6543556-6543578 TGCCCACTAGTAATTCAAAGGGG + Intronic
1157397444 18:47354737-47354759 TGTGCACTAGGAATACAAAGGGG + Intergenic
1159172554 18:64790067-64790089 TGGCCACAAGCAATTCAGAGGGG - Intergenic
1166586844 19:43956607-43956629 TGCCCCCAAGCAATTCCAAGTGG + Intronic
945816550 2:214611760-214611782 TGCCCACTAGTTTTTTAATGAGG - Intergenic
1169876336 20:10301179-10301201 TGAGAACTAGAAATTCAAAGTGG - Intronic
1170013141 20:11749878-11749900 TGCCAACTTGTTTTTCAAAGGGG + Intergenic
1170160765 20:13307985-13308007 TGCCCAGTAGTTTTCCAAAGTGG + Intergenic
1174243684 20:49159348-49159370 TACCCACAAGTTGTTCAAAGAGG - Intronic
1179069862 21:38061242-38061264 TTCCCCCTAGTCATTCAGAGAGG + Intronic
951060065 3:18195591-18195613 TTCCCACTGATAATTCATAGGGG + Intronic
962608263 3:137050526-137050548 TGACCTCTAGTCAGTCAAAGCGG - Intergenic
963163662 3:142178840-142178862 TGCCAAATAGTTTTTCAAAGTGG + Intronic
966213789 3:177480212-177480234 TGCCCCTTAGCTATTCAAAGAGG - Intergenic
966634686 3:182118962-182118984 TCCCCACTAATATTTCAAGGAGG - Intergenic
970511068 4:16782237-16782259 TGCCCACAAGGAATTCAGAGTGG - Intronic
974053788 4:56965393-56965415 TGCCCCCAAGGAAATCAAAGGGG + Intronic
974361804 4:60890467-60890489 TGCCCTGTAGTAATTTTAAGTGG - Intergenic
974639840 4:64614294-64614316 TGCCCTCAAGTAATTAAAAAAGG + Intergenic
978910175 4:114053108-114053130 TGCCCACTGATAATTTAAAGTGG + Intergenic
982231368 4:153211109-153211131 TGCTCACTAGGAATCCATAGCGG + Intronic
982942817 4:161580306-161580328 TGCCCACTAGTAATTCTTAGGGG + Intronic
984111429 4:175620869-175620891 TGCCCACTAGTTGTTTAAAATGG - Intergenic
985143882 4:186872887-186872909 TGCTAAATAGTACTTCAAAGTGG + Intergenic
986339981 5:6780551-6780573 TGCCCTCTAGTAGCCCAAAGGGG - Intergenic
987068735 5:14315551-14315573 TGCTTACTAGAAACTCAAAGAGG + Intronic
988136631 5:27180079-27180101 TGCCTACTATAAATTCAAAAGGG + Intergenic
988392230 5:30649568-30649590 TGCCAAATTGTTATTCAAAGTGG - Intergenic
990190534 5:53255049-53255071 TGCACACAAGTAATTCAACTGGG - Intergenic
998766673 5:145496258-145496280 TGCCCACTAGACATCCAAATAGG + Intronic
1004445433 6:15693439-15693461 TCCCCAGGAGTAATTCAAGGAGG - Intergenic
1009578257 6:65494991-65495013 TGCACACTGTTAATTCTAAGTGG - Exonic
1012513160 6:100027883-100027905 TTCCCACTAGCAATTCACAAGGG - Intergenic
1013456681 6:110335973-110335995 TGCCCAGTAGTACTTCAGAAAGG + Intronic
1015046745 6:128785459-128785481 TGCCAACAAGTTTTTCAAAGCGG + Intergenic
1018803641 6:167242039-167242061 TGCCCATTAGCAAATCGAAGTGG - Intergenic
1018806570 6:167266463-167266485 TGCCCATTAGCAAATCGAAGTGG + Intergenic
1021441277 7:20679834-20679856 TGCCAAATAGTTTTTCAAAGTGG - Intronic
1021845594 7:24759325-24759347 TTACCACTTGTAATTCAGAGTGG + Intergenic
1023234446 7:38069055-38069077 TGCAGTCTAGTAATTCAAAACGG + Intergenic
1028174690 7:87641325-87641347 TGAACACTAGTAAAGCAAAGTGG - Intronic
1028265312 7:88716745-88716767 TGCCGAGTGGTAAATCAAAGAGG - Intergenic
1030221652 7:107104969-107104991 TGCCCATAAGTAAATCAAATGGG - Intronic
1031406570 7:121394531-121394553 TTCCCATTGGTAATTCAGAGAGG + Intronic
1033535213 7:142306096-142306118 TGCCGACAAGAAAGTCAAAGAGG - Intergenic
1033851330 7:145499168-145499190 TTCCCCCTATTAATGCAAAGAGG + Intergenic
1035053693 7:156019632-156019654 GGCCCAGTCCTAATTCAAAGTGG + Intergenic
1036527562 8:9549195-9549217 TGCCCTCTGGTAATACCAAGTGG + Intergenic
1040623229 8:49113487-49113509 TGTCAAATAGTCATTCAAAGTGG - Intergenic
1040717798 8:50279592-50279614 TCCCAACTAGTAACTCAAAAAGG - Intronic
1041316758 8:56571553-56571575 TTCCCACTACTAATGCACAGGGG + Intergenic
1046734735 8:117765143-117765165 TTCTTACTAGTAATTAAAAGAGG + Intergenic
1050567588 9:6902279-6902301 TGCCCAGTAGTACTTTTAAGGGG + Intronic
1053276520 9:36787531-36787553 TGCCCATTAGCCATTCAAGGAGG + Intergenic
1053475052 9:38376610-38376632 TGCCCACTTGGAATCCAGAGGGG - Intergenic
1054914849 9:70486272-70486294 TGCCCACTTCTCATTCAAGGAGG - Intergenic
1055057281 9:72035579-72035601 TGCCGACTAGGTTTTCAAAGAGG + Intergenic
1055295465 9:74828460-74828482 TGCCTACTAGTTATTCATAGTGG - Intronic
1060389001 9:123263033-123263055 TTCTGACTAGTAATTCTAAGAGG - Intronic
1185979344 X:4759189-4759211 TGCACACAAGTAATTCAATGGGG - Intergenic
1192496526 X:71619964-71619986 TGCCCACTGGTAATGAGAAGAGG - Intergenic
1197443111 X:126514123-126514145 TTCCCACTATAAATTCCAAGTGG - Intergenic
1198592023 X:138194202-138194224 TGCCTATTAGATATTCAAAGAGG + Intergenic