ID: 1153580608

View in Genome Browser
Species Human (GRCh38)
Location 18:6569963-6569985
Sequence ATCCATTAGAAGCCGAGCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 72}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153580608_1153580611 -3 Left 1153580608 18:6569963-6569985 CCCTTGCTCGGCTTCTAATGGAT 0: 1
1: 0
2: 0
3: 4
4: 72
Right 1153580611 18:6569983-6570005 GATTTGCTGCAAAGGCTGTGAGG 0: 1
1: 0
2: 0
3: 21
4: 211
1153580608_1153580614 30 Left 1153580608 18:6569963-6569985 CCCTTGCTCGGCTTCTAATGGAT 0: 1
1: 0
2: 0
3: 4
4: 72
Right 1153580614 18:6570016-6570038 ACTCAGGGACACGATGACACAGG 0: 1
1: 0
2: 0
3: 11
4: 148
1153580608_1153580612 14 Left 1153580608 18:6569963-6569985 CCCTTGCTCGGCTTCTAATGGAT 0: 1
1: 0
2: 0
3: 4
4: 72
Right 1153580612 18:6570000-6570022 GTGAGGAATGAGTCACACTCAGG 0: 1
1: 0
2: 1
3: 13
4: 152
1153580608_1153580613 15 Left 1153580608 18:6569963-6569985 CCCTTGCTCGGCTTCTAATGGAT 0: 1
1: 0
2: 0
3: 4
4: 72
Right 1153580613 18:6570001-6570023 TGAGGAATGAGTCACACTCAGGG 0: 1
1: 0
2: 0
3: 15
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153580608 Original CRISPR ATCCATTAGAAGCCGAGCAA GGG (reversed) Intronic
915991062 1:160517180-160517202 CCCCATTAAAAGGCGAGCAAAGG + Intronic
917051992 1:170935270-170935292 GTCCAGTAGAAGCTGGGCAAAGG - Intergenic
918096007 1:181334789-181334811 ATCCTTTAGAAGCTGAGTCAGGG + Intergenic
921464699 1:215473463-215473485 ATCCATTAGTAGCCAATCAGGGG - Intergenic
1072983321 10:100117823-100117845 TTCCATCAGGAGCAGAGCAATGG - Intergenic
1087362216 11:97175449-97175471 CTCCATTAAAAGCTGGGCAAAGG + Intergenic
1097910216 12:64961284-64961306 AACCATTAAAAACTGAGCAAAGG - Intergenic
1100456189 12:94753906-94753928 ATCCCTTAGAAGAGGAGAAACGG + Intergenic
1101818921 12:108168019-108168041 TTCCATTAGAAACTCAGCAATGG + Intronic
1101991749 12:109491459-109491481 AGCCAGGAGAAGCCCAGCAAAGG + Intronic
1108458702 13:50643365-50643387 AACTTTTAGAAGCTGAGCAATGG - Intronic
1114788269 14:25625893-25625915 ATCCTTTAGAAGCCAAAAAAAGG + Intergenic
1120420926 14:84284669-84284691 ATCACTTAGAAGCAGAACAAAGG + Intergenic
1120495450 14:85229231-85229253 ATCCATTAAAAGGTGGGCAAAGG - Intergenic
1126433448 15:48611086-48611108 ATCCATCAGAAGCCCAGGACAGG + Intronic
1128216074 15:65935018-65935040 ATCAATTAGAAGCACAGCCAAGG + Intronic
1133456254 16:5945032-5945054 CTCCAGAAGAAGCCCAGCAAGGG - Intergenic
1137467220 16:48720746-48720768 ATGCATTAGAAGGAAAGCAAGGG - Intergenic
1139246519 16:65449723-65449745 ATCCATTAAACGCTGAGTAAGGG - Intergenic
1153580608 18:6569963-6569985 ATCCATTAGAAGCCGAGCAAGGG - Intronic
1154482443 18:14846035-14846057 ATCCAATGGAAGCAGAGGAAAGG - Intronic
1155402759 18:25457113-25457135 GTCCATTAGAAGCTAAGCATGGG + Intergenic
1157148387 18:45189786-45189808 ATCCATTATCACCCAAGCAAAGG - Intergenic
1160303982 18:77714575-77714597 ATGCATTAGAAGCCCAGAAAGGG + Intergenic
1162633643 19:11948561-11948583 ATCCATTAGAACACAAGAAAGGG + Exonic
1163908318 19:20167339-20167361 ACCCCTTAGAAGCCTAGAAATGG + Exonic
1165393683 19:35552342-35552364 ATGCATGAGAATCCCAGCAAGGG + Intronic
1166130927 19:40745058-40745080 GTCCTTAAGAAGCCCAGCAAGGG + Intronic
1168382247 19:55933722-55933744 ACCCAGTAGAAGCTGAGCAAGGG + Intergenic
928023442 2:27721476-27721498 AACCCTTAAGAGCCGAGCAAAGG + Intergenic
938892755 2:135722153-135722175 CTCCATCAGGAGCAGAGCAAAGG + Intronic
941671786 2:168301540-168301562 ATCCCTTAGGAGCCGAGCTGTGG + Intergenic
944410016 2:199431013-199431035 ATCCATTTAAAGCAGAGAAATGG - Intronic
944881734 2:204019615-204019637 ATACTTTAGAAGCCTAACAAGGG - Intergenic
944966686 2:204943398-204943420 CTCCATGAGAAGCAGAGGAAAGG - Intronic
945479250 2:210324978-210325000 TTTCATTAGAAGCTGAGAAAAGG - Intergenic
945563214 2:211363888-211363910 ATCCATTATAAGGTGGGCAAAGG + Intergenic
947610237 2:231520678-231520700 ATCCATTAGAAGACAAGAATAGG + Intergenic
1171485874 20:25485345-25485367 ATCAATTTGAAGCCTATCAAAGG + Intronic
1175983662 20:62753762-62753784 CTCCATTGGAAGCCGGGCCATGG + Intronic
1184430016 22:44437239-44437261 ATCCATTATATGCCCAGCACTGG - Intergenic
952488567 3:33841736-33841758 ATCAATTAAAAGCAAAGCAAAGG - Intronic
954626822 3:52026379-52026401 TTCCATGAGGAGCAGAGCAAGGG - Intergenic
959178062 3:102942655-102942677 ATTCATCAGAAGCCAAGGAAAGG + Intergenic
962432689 3:135334766-135334788 AACCCTTAGAAGGCGAGGAAGGG + Intergenic
969460891 4:7328334-7328356 ATCTATCAGAAGCCTAGCACGGG - Intronic
970560374 4:17276396-17276418 CTACAATAGAAGCAGAGCAAAGG - Intergenic
970838189 4:20436354-20436376 ATACATTAGAGGCCTAGCCATGG - Intronic
973736405 4:53875828-53875850 ATCAATTACCAGCTGAGCAAGGG - Intronic
977596688 4:98890131-98890153 ATCTATTAGAAGCCAAGCACTGG + Intronic
978053293 4:104230603-104230625 ATCTATTAGAATCCTAGCAGGGG - Intergenic
979646321 4:123074600-123074622 ATCCATTAGAAAACCATCAAAGG - Intronic
987513383 5:18872881-18872903 CTCCATTAAAAACTGAGCAAAGG + Intergenic
988997156 5:36725475-36725497 ATCCAGAAGAAGCAAAGCAATGG + Intergenic
989258608 5:39394197-39394219 ATCCACTTGAAGCCAAGGAAGGG - Intronic
995540303 5:113179328-113179350 ATCCATTTGCAGCCTAGCACAGG + Intronic
1010051960 6:71515374-71515396 ATCCAATGGAAAACGAGCAAAGG + Intergenic
1012001060 6:93655660-93655682 AGCCATTAGATGCCAAGCTAAGG - Intergenic
1013896752 6:115098019-115098041 ATCCATTAAAAAGCGAGCAAAGG - Intergenic
1016074925 6:139784563-139784585 CTCCATTAAAAACTGAGCAAAGG - Intergenic
1017418920 6:154252229-154252251 AAGCAATAGAAGCCCAGCAAGGG + Intronic
1023349550 7:39306984-39307006 ATCCATTAGAAGGGGTGCAGGGG + Intronic
1024571879 7:50729960-50729982 ATCCTTTAGAAGCTGAGTCAAGG - Intronic
1025719721 7:63998979-63999001 ATCCCCTGGAAGCCGAGAAATGG + Intergenic
1025746700 7:64249135-64249157 ATCCCCTGGAAGCCGAGAAATGG + Exonic
1033247598 7:139730952-139730974 AGCCATCAGAAGCCGAGAGAAGG + Intronic
1052394358 9:27920950-27920972 CTCCATTAAAAACTGAGCAAAGG + Intergenic
1053516795 9:38737286-38737308 ATGGATTGGAAGCCAAGCAAAGG - Intergenic
1058765642 9:108180369-108180391 ATCCATGTGAAGCCCAGCCAAGG + Intergenic
1062206168 9:135338640-135338662 AACCAACAGCAGCCGAGCAACGG + Intergenic
1186121867 X:6371958-6371980 ATCCATAAGATTCTGAGCAATGG - Intergenic
1186211834 X:7257541-7257563 ATCCTTCAGAAGCTTAGCAAAGG - Exonic
1193820963 X:86164257-86164279 CTCCATTAAAAACTGAGCAAAGG - Intronic
1195920565 X:109979247-109979269 ATTCATTGGAAGCAGAGAAAGGG - Intergenic
1198739298 X:139823973-139823995 CTCCATTAAAAGCTGGGCAAAGG + Intronic
1199506920 X:148573306-148573328 ATCCACTAGAGGGGGAGCAAGGG + Intronic
1200091056 X:153636234-153636256 ACCCTTCAGAGGCCGAGCAAGGG + Intergenic