ID: 1153581199

View in Genome Browser
Species Human (GRCh38)
Location 18:6575492-6575514
Sequence CACATTTACTACTAATAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 109}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153581199_1153581210 23 Left 1153581199 18:6575492-6575514 CCCAGCTATTAGTAGTAAATGTG 0: 1
1: 0
2: 0
3: 12
4: 109
Right 1153581210 18:6575538-6575560 TGTAATCCCAACACTTTGGGAGG 0: 20711
1: 314656
2: 260585
3: 140497
4: 126854
1153581199_1153581208 20 Left 1153581199 18:6575492-6575514 CCCAGCTATTAGTAGTAAATGTG 0: 1
1: 0
2: 0
3: 12
4: 109
Right 1153581208 18:6575535-6575557 GCCTGTAATCCCAACACTTTGGG 0: 16492
1: 240790
2: 271963
3: 174140
4: 134914
1153581199_1153581207 19 Left 1153581199 18:6575492-6575514 CCCAGCTATTAGTAGTAAATGTG 0: 1
1: 0
2: 0
3: 12
4: 109
Right 1153581207 18:6575534-6575556 TGCCTGTAATCCCAACACTTTGG 0: 7114
1: 109335
2: 242763
3: 237820
4: 206209
1153581199_1153581213 29 Left 1153581199 18:6575492-6575514 CCCAGCTATTAGTAGTAAATGTG 0: 1
1: 0
2: 0
3: 12
4: 109
Right 1153581213 18:6575544-6575566 CCCAACACTTTGGGAGGGTGAGG 0: 78
1: 7720
2: 105468
3: 226921
4: 240960
1153581199_1153581211 24 Left 1153581199 18:6575492-6575514 CCCAGCTATTAGTAGTAAATGTG 0: 1
1: 0
2: 0
3: 12
4: 109
Right 1153581211 18:6575539-6575561 GTAATCCCAACACTTTGGGAGGG 0: 201
1: 2706
2: 3413
3: 3225
4: 3298
1153581199_1153581206 -8 Left 1153581199 18:6575492-6575514 CCCAGCTATTAGTAGTAAATGTG 0: 1
1: 0
2: 0
3: 12
4: 109
Right 1153581206 18:6575507-6575529 TAAATGTGGGTCGGGTGCGGTGG 0: 1
1: 4
2: 50
3: 380
4: 2535

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153581199 Original CRISPR CACATTTACTACTAATAGCT GGG (reversed) Intronic
905993306 1:42359029-42359051 CTCAATTCCTACTAATAGCAGGG + Intergenic
911503524 1:98719175-98719197 CACATTTAGCACTATGAGCTAGG - Intronic
912023180 1:105132809-105132831 CAAATTTATTACTCATAGATAGG - Intergenic
1065123320 10:22549204-22549226 AATATTAACTACTAATAACTTGG + Intronic
1068838430 10:61582351-61582373 AACATTGACTACTCATAGTTAGG + Intergenic
1077793876 11:5470419-5470441 CACTTTCACAACTAATACCTTGG + Intronic
1079437778 11:20475069-20475091 CACATCTACTACAAGTATCTTGG + Intronic
1085172198 11:74458970-74458992 CAGAATTTCTACAAATAGCTAGG - Intronic
1087219648 11:95532516-95532538 CACATATACTAATAAAGGCTAGG - Intergenic
1087537260 11:99465146-99465168 CACATTTACTACTTTTAGAAGGG - Intronic
1087718344 11:101634407-101634429 GACAGTTACTACTAATATCTTGG + Intronic
1088071732 11:105794864-105794886 CACAGGTACTGCTAATACCTCGG - Intronic
1089380962 11:118031295-118031317 CACATCTACCACTAAGATCTTGG + Intergenic
1092580687 12:9837886-9837908 CAAAATTACTACTGATAGCAAGG + Intronic
1094093354 12:26675463-26675485 CACATGTTCTACTCATAGGTGGG + Intronic
1096921690 12:55094040-55094062 CACAATTACTACTAATATCAGGG + Intergenic
1098257635 12:68633568-68633590 CACAGTTAAAACTAATATCTCGG + Intronic
1099117009 12:78639896-78639918 CACATTTACTGCTAAGAACTTGG - Intergenic
1100984641 12:100192337-100192359 CACTCTTACTACTATTATCTTGG - Intergenic
1101711791 12:107274575-107274597 CAGCTTTACTACTAAAAACTTGG - Intergenic
1102344255 12:112148779-112148801 CATATTTTCCACTAATAGATTGG - Intronic
1108390165 13:49939218-49939240 CACTTTTCCTTCTAATATCTGGG + Intergenic
1109834468 13:67839356-67839378 CAGATATATTACTAAAAGCTAGG - Intergenic
1109969413 13:69746789-69746811 AAGATTTACTAATAATAGCAAGG + Intronic
1110009117 13:70309076-70309098 CACATTTACTAGTATTTTCTAGG + Intergenic
1110859061 13:80327923-80327945 CACATGTAGTCCTAATAGCTAGG + Intergenic
1115458395 14:33631976-33631998 CAGATTCACTACTACTAGCTGGG - Intronic
1115984278 14:39088036-39088058 CATATTTAGTACTAATAACCTGG + Intronic
1116577818 14:46597382-46597404 CACCTTTACTTCTAGCAGCTTGG + Intergenic
1117836566 14:59813799-59813821 CACATGTTCTAATAATATCTTGG - Intronic
1119277841 14:73375635-73375657 CACATTTTTTATTAATAGCTTGG - Intronic
1127552276 15:60052423-60052445 GAGATTTACTATTACTAGCTGGG - Intronic
1127694072 15:61426985-61427007 CACATTTACTGCTAATTAGTTGG - Intergenic
1133565616 16:6990689-6990711 CACATTCACAACTATTAGGTCGG - Intronic
1134540478 16:15060196-15060218 CCCACTTACTACTAATTTCTGGG + Exonic
1135652609 16:24219142-24219164 CCCATTTACTAGCAATTGCTTGG - Exonic
1138244510 16:55457227-55457249 TACATTTACAACTAATAAATTGG - Intronic
1138794915 16:59956181-59956203 CAGATTTCCTTCTAATAGTTTGG - Intergenic
1140968168 16:79987503-79987525 CACTTTTACTAATAATTACTCGG + Intergenic
1141263280 16:82473120-82473142 AGCATTTACTACTATGAGCTGGG - Intergenic
1142916601 17:3145088-3145110 CACATTTATTAATAATCCCTGGG - Intergenic
1145039839 17:19569493-19569515 CACAATTTCTTCTAATAGGTGGG - Intronic
1153581199 18:6575492-6575514 CACATTTACTACTAATAGCTGGG - Intronic
1153689789 18:7580663-7580685 CCCATTTACAAATAAAAGCTTGG + Intronic
1158031305 18:52968276-52968298 CACATTTTCTACTAATAGTGAGG + Intronic
1164118472 19:22244501-22244523 CTCATTTTCTACTTATAGTTGGG - Intergenic
1165125339 19:33591898-33591920 GACAATTACTATTAATACCTTGG + Intergenic
1165337497 19:35182031-35182053 CAAATTTATTTCTGATAGCTAGG - Intergenic
929362188 2:41105428-41105450 CATATTTACTACATATAGGTAGG - Intergenic
930385479 2:50689003-50689025 CCCCTTTACTACTAATAGTAGGG + Intronic
930623635 2:53670770-53670792 CACTTTTATTACTAAGAGTTGGG - Intronic
930869283 2:56153729-56153751 CACACTTACTCCTGATATCTAGG + Intergenic
931076611 2:58721830-58721852 GATATTCACTCCTAATAGCTAGG - Intergenic
934911253 2:98256532-98256554 CACATGTAGTACTGATACCTGGG - Intronic
936615496 2:114043651-114043673 CAAATTTACTACTCACAGATAGG - Intergenic
941466565 2:165834931-165834953 CACATTTACAGCTATTAGATGGG + Intergenic
942201167 2:173572934-173572956 CACATTTCATACTAAGAGCATGG + Intergenic
943287308 2:186018643-186018665 CTAATTAACTACTATTAGCTGGG + Intergenic
944707383 2:202304844-202304866 CAAATTTACTAATAAAAACTAGG - Intergenic
944747938 2:202676984-202677006 CACCCTTACCACTAATAGCATGG + Intronic
1168919298 20:1517628-1517650 CACATAGGCTAGTAATAGCTTGG - Intergenic
1171129221 20:22633752-22633774 AACATTTACTCTTAATAGGTTGG + Intergenic
1175012323 20:55751119-55751141 CGCATTTACAACTAAGAACTGGG + Intergenic
952300790 3:32103037-32103059 CTCATTTACTTCTAAAGGCTGGG - Intergenic
955764899 3:62332637-62332659 CATTTTTAATACAAATAGCTTGG - Intronic
956159022 3:66328413-66328435 CACATTACCTACTAATAAATAGG + Intronic
956457664 3:69439457-69439479 CACATTTCCAAATAATACCTTGG - Intronic
958888148 3:99752348-99752370 TACCACTACTACTAATAGCTGGG - Intronic
958984273 3:100762317-100762339 CAAACTTACTACTGATAGCAAGG - Intronic
959726461 3:109548321-109548343 CACATATACTACTCATTCCTTGG - Intergenic
959949155 3:112160062-112160084 CATTGTTACTACTAATAGGTAGG + Intronic
962428744 3:135299623-135299645 CACACTTTCTACTCTTAGCTTGG - Intergenic
968318929 3:197748797-197748819 CACATTTACTATTTTTTGCTTGG - Intronic
971705941 4:30043253-30043275 TACATTTTCTATAAATAGCTAGG + Intergenic
975964770 4:79958653-79958675 CAAATTTACAACCAACAGCTCGG + Intronic
976926875 4:90509774-90509796 CACCTTCACTGCTCATAGCTGGG + Intronic
978400778 4:108328251-108328273 CACATTTACTCTTCATAGGTAGG - Intergenic
980454687 4:133023377-133023399 CAGATTGACTAATAATTGCTGGG - Intergenic
980551408 4:134341118-134341140 CACATTTGATTTTAATAGCTTGG + Intergenic
981072849 4:140562842-140562864 CTCATTTAATACTAATATATGGG - Intronic
987780295 5:22425243-22425265 CATTTTTACTAACAATAGCTAGG + Intronic
991516366 5:67440144-67440166 CACTTTTACTGCTAATATTTAGG + Intergenic
994007348 5:94854448-94854470 CACATTTTCTATTAAAAACTTGG - Intronic
994440306 5:99794308-99794330 CAGATTTATTCCTAATAACTTGG + Intergenic
995469504 5:112485733-112485755 TATATTAAATACTAATAGCTAGG + Intergenic
995952143 5:117729021-117729043 CAAATTTATTACTAATGGGTAGG - Intergenic
996226439 5:121004584-121004606 ATCATTTACTACTTATAGATAGG + Intergenic
996961574 5:129256039-129256061 CACATTATCTACTGATAGCCAGG - Intergenic
997946085 5:138202767-138202789 TACATTTACTACTCAACGCTTGG - Intronic
1002841963 6:913987-914009 CCCATTTATTATTAATAGTTGGG - Intergenic
1005108452 6:22251259-22251281 CACATTTATTATTAATAGCATGG + Intergenic
1005121741 6:22397679-22397701 AACATATACTATTATTAGCTTGG - Intergenic
1007056806 6:38894344-38894366 CACATATACTACCAATAATTAGG + Intronic
1008042972 6:46821439-46821461 CACAATTACTACTGAGAGATAGG - Intronic
1008119884 6:47600576-47600598 TATATTTACTACTAATTTCTGGG + Intronic
1008852318 6:56037850-56037872 CATATTTTCTACTACTAACTGGG + Intergenic
1010911650 6:81565562-81565584 CACATTTAATATTAATAGTTAGG - Intronic
1013745018 6:113335101-113335123 CACATATATTACACATAGCTGGG - Intergenic
1015283264 6:131456808-131456830 CACATTTAAGACTACTGGCTGGG + Intergenic
1015844478 6:137505521-137505543 CACATTTACTTCTAATAAACTGG - Intergenic
1020501273 7:8924517-8924539 CACAACTACTATCAATAGCTTGG + Intergenic
1021308583 7:19062803-19062825 CAGATTTATTACTTATAGATAGG - Intronic
1022985330 7:35648614-35648636 CACATTTACTAATACTACATTGG - Intronic
1027984285 7:85266356-85266378 AACAGTTACTGTTAATAGCTGGG - Intergenic
1032832282 7:135640320-135640342 CAAATTTAATACTACTAGCTAGG - Intronic
1032951322 7:136917559-136917581 CACATTTACTACTTTTTGCAAGG + Intronic
1032992341 7:137407660-137407682 CACTGTTTCTACTAATTGCTTGG + Intronic
1034024079 7:147678791-147678813 TATATTTACTACTTATAGGTGGG + Intronic
1042121652 8:65495021-65495043 CACATTTATTTTTATTAGCTGGG + Intergenic
1042319530 8:67460543-67460565 CTCATTCACTACTCATAGATTGG - Intronic
1042645785 8:70984585-70984607 CCCATTTAAAACAAATAGCTAGG - Intergenic
1045398566 8:101786605-101786627 GACATTTACCTCTAATAGATAGG + Intronic
1046331690 8:112724356-112724378 CACCTCTACTGCTAATATCTTGG - Intronic
1050299572 9:4243442-4243464 CACATTTAGTACTAACACCAGGG + Intronic
1050806389 9:9683924-9683946 CATATTTACTTCTACCAGCTTGG - Intronic
1186670651 X:11764355-11764377 CCCATTTAATACTACTAGCTAGG - Intronic
1188366183 X:29317636-29317658 CATATTCACTACTAATCCCTTGG - Intronic
1188850202 X:35122896-35122918 CACAGTCACTACTAGAAGCTGGG + Intergenic
1190999344 X:55643872-55643894 CACGTTTCCTACCAATTGCTGGG - Intergenic
1196603881 X:117633580-117633602 CATAGTTAATACAAATAGCTTGG - Intergenic
1198638916 X:138734241-138734263 CAAATTTACTACTACTGGCTGGG - Intronic
1201345208 Y:12976108-12976130 CAGATTTATTACTTATAGGTAGG + Intergenic