ID: 1153584112

View in Genome Browser
Species Human (GRCh38)
Location 18:6603475-6603497
Sequence TAAGGTTCCAAAAATTCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153584110_1153584112 -3 Left 1153584110 18:6603455-6603477 CCTACTCATGGTGGGAAGTTTAA No data
Right 1153584112 18:6603475-6603497 TAAGGTTCCAAAAATTCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153584112 Original CRISPR TAAGGTTCCAAAAATTCTGC AGG Intergenic
No off target data available for this crispr