ID: 1153585292

View in Genome Browser
Species Human (GRCh38)
Location 18:6614641-6614663
Sequence CAGCAAGAATACCATGACCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153585290_1153585292 -8 Left 1153585290 18:6614626-6614648 CCATTTGAGTTGCTGCAGCAAGA No data
Right 1153585292 18:6614641-6614663 CAGCAAGAATACCATGACCTGGG No data
1153585289_1153585292 -7 Left 1153585289 18:6614625-6614647 CCCATTTGAGTTGCTGCAGCAAG No data
Right 1153585292 18:6614641-6614663 CAGCAAGAATACCATGACCTGGG No data
1153585288_1153585292 3 Left 1153585288 18:6614615-6614637 CCTGTCTTAGCCCATTTGAGTTG No data
Right 1153585292 18:6614641-6614663 CAGCAAGAATACCATGACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153585292 Original CRISPR CAGCAAGAATACCATGACCT GGG Intergenic
No off target data available for this crispr