ID: 1153585293

View in Genome Browser
Species Human (GRCh38)
Location 18:6614652-6614674
Sequence TTTATAAATCACCCAGGTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153585293_1153585297 13 Left 1153585293 18:6614652-6614674 CCATGACCTGGGTGATTTATAAA No data
Right 1153585297 18:6614688-6614710 TTTCTTGTAGTTCTGGAGGCTGG No data
1153585293_1153585295 6 Left 1153585293 18:6614652-6614674 CCATGACCTGGGTGATTTATAAA No data
Right 1153585295 18:6614681-6614703 ACATTTATTTCTTGTAGTTCTGG No data
1153585293_1153585298 14 Left 1153585293 18:6614652-6614674 CCATGACCTGGGTGATTTATAAA No data
Right 1153585298 18:6614689-6614711 TTCTTGTAGTTCTGGAGGCTGGG No data
1153585293_1153585296 9 Left 1153585293 18:6614652-6614674 CCATGACCTGGGTGATTTATAAA No data
Right 1153585296 18:6614684-6614706 TTTATTTCTTGTAGTTCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153585293 Original CRISPR TTTATAAATCACCCAGGTCA TGG (reversed) Intergenic