ID: 1153585294

View in Genome Browser
Species Human (GRCh38)
Location 18:6614658-6614680
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153585294_1153585298 8 Left 1153585294 18:6614658-6614680 CCTGGGTGATTTATAAACAACAC No data
Right 1153585298 18:6614689-6614711 TTCTTGTAGTTCTGGAGGCTGGG No data
1153585294_1153585296 3 Left 1153585294 18:6614658-6614680 CCTGGGTGATTTATAAACAACAC No data
Right 1153585296 18:6614684-6614706 TTTATTTCTTGTAGTTCTGGAGG No data
1153585294_1153585295 0 Left 1153585294 18:6614658-6614680 CCTGGGTGATTTATAAACAACAC No data
Right 1153585295 18:6614681-6614703 ACATTTATTTCTTGTAGTTCTGG No data
1153585294_1153585299 30 Left 1153585294 18:6614658-6614680 CCTGGGTGATTTATAAACAACAC No data
Right 1153585299 18:6614711-6614733 GAAGTCCAAGATCCAGACACTGG No data
1153585294_1153585297 7 Left 1153585294 18:6614658-6614680 CCTGGGTGATTTATAAACAACAC No data
Right 1153585297 18:6614688-6614710 TTTCTTGTAGTTCTGGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153585294 Original CRISPR GTGTTGTTTATAAATCACCC AGG (reversed) Intergenic