ID: 1153585295

View in Genome Browser
Species Human (GRCh38)
Location 18:6614681-6614703
Sequence ACATTTATTTCTTGTAGTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 5689
Summary {0: 4, 1: 33, 2: 291, 3: 1450, 4: 3911}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153585293_1153585295 6 Left 1153585293 18:6614652-6614674 CCATGACCTGGGTGATTTATAAA No data
Right 1153585295 18:6614681-6614703 ACATTTATTTCTTGTAGTTCTGG 0: 4
1: 33
2: 291
3: 1450
4: 3911
1153585294_1153585295 0 Left 1153585294 18:6614658-6614680 CCTGGGTGATTTATAAACAACAC No data
Right 1153585295 18:6614681-6614703 ACATTTATTTCTTGTAGTTCTGG 0: 4
1: 33
2: 291
3: 1450
4: 3911

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153585295 Original CRISPR ACATTTATTTCTTGTAGTTC TGG Intergenic
Too many off-targets to display for this crispr