ID: 1153585296

View in Genome Browser
Species Human (GRCh38)
Location 18:6614684-6614706
Sequence TTTATTTCTTGTAGTTCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 9880
Summary {0: 7, 1: 128, 2: 834, 3: 3015, 4: 5896}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153585294_1153585296 3 Left 1153585294 18:6614658-6614680 CCTGGGTGATTTATAAACAACAC No data
Right 1153585296 18:6614684-6614706 TTTATTTCTTGTAGTTCTGGAGG 0: 7
1: 128
2: 834
3: 3015
4: 5896
1153585293_1153585296 9 Left 1153585293 18:6614652-6614674 CCATGACCTGGGTGATTTATAAA No data
Right 1153585296 18:6614684-6614706 TTTATTTCTTGTAGTTCTGGAGG 0: 7
1: 128
2: 834
3: 3015
4: 5896

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153585296 Original CRISPR TTTATTTCTTGTAGTTCTGG AGG Intergenic
Too many off-targets to display for this crispr