ID: 1153585296 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 18:6614684-6614706 |
Sequence | TTTATTTCTTGTAGTTCTGG AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1153585293_1153585296 | 9 | Left | 1153585293 | 18:6614652-6614674 | CCATGACCTGGGTGATTTATAAA | No data | ||
Right | 1153585296 | 18:6614684-6614706 | TTTATTTCTTGTAGTTCTGGAGG | No data | ||||
1153585294_1153585296 | 3 | Left | 1153585294 | 18:6614658-6614680 | CCTGGGTGATTTATAAACAACAC | No data | ||
Right | 1153585296 | 18:6614684-6614706 | TTTATTTCTTGTAGTTCTGGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1153585296 | Original CRISPR | TTTATTTCTTGTAGTTCTGG AGG | Intergenic | ||