ID: 1153585298

View in Genome Browser
Species Human (GRCh38)
Location 18:6614689-6614711
Sequence TTCTTGTAGTTCTGGAGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153585294_1153585298 8 Left 1153585294 18:6614658-6614680 CCTGGGTGATTTATAAACAACAC No data
Right 1153585298 18:6614689-6614711 TTCTTGTAGTTCTGGAGGCTGGG No data
1153585293_1153585298 14 Left 1153585293 18:6614652-6614674 CCATGACCTGGGTGATTTATAAA No data
Right 1153585298 18:6614689-6614711 TTCTTGTAGTTCTGGAGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153585298 Original CRISPR TTCTTGTAGTTCTGGAGGCT GGG Intergenic