ID: 1153585299

View in Genome Browser
Species Human (GRCh38)
Location 18:6614711-6614733
Sequence GAAGTCCAAGATCCAGACAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153585294_1153585299 30 Left 1153585294 18:6614658-6614680 CCTGGGTGATTTATAAACAACAC No data
Right 1153585299 18:6614711-6614733 GAAGTCCAAGATCCAGACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153585299 Original CRISPR GAAGTCCAAGATCCAGACAC TGG Intergenic
No off target data available for this crispr